From 11:00 pm to 12:00 pm EST ( 8:00 pm to 9:00 pm PST ) on January 6th, the website will be under maintenance. We are sorry for the inconvenience. Please arrange your schedule properly.
γ-glutamyltransferase, Porcine kidney (GGT, Porcine kidney) is an enzyme located on the outer surface of the cell membrane. Gamma glutamyltransferase maintains the physiological concentration of cytoplasmic glutathione and the cell's defense against oxidative stress by cleaving extracellular glutathione and increasing the availability of amino acids. Gamma glutamyltransferase can be used as a biomaterial or organic compound for life science related research .
Acivicin (AT-125), a natural product produced by Streptomyces sviceus is a γ-glutamyl transpeptidase (GGT) inhibitor. Acivicin can across the blood-brain barrier and has anti-cancer, anti-parasitic properties .
Acivicin hydrochloride (AT-125 hydrochloride), a natural product produced by Streptomyces sviceus, is a γ-glutamyl transpeptidase (GGT) inhibitor. Acivicin hydrochloride can across the blood-brain barrier and has anti-cancer, anti-parasitic properties .
GPNA hydrochloride is a well known substrate of the enzyme γ-glutamyltransferase (GGT). GPNA hydrochloride is a specific glutamine (Gln) transporter ASCT2 inhibitor. GPNA hydrochloride also inhibit Na +-dependent carriers, such as SNAT family (SNAT1/2/4/5), and the Na +-independent leucine transporters LAT1/2. GPNA reversibly induces apoptosis in A549 cells .
GGsTop (Nahlsgen) is a potent, non-toxic, highly selective and irreversible γ-GGT inhibitor, with a Ki of 170 μM for Human GGT. GGsTop shows a pKa of 9.71, also exhibits Kons of 150 and 51 M -1 s -1 against E.coli GGT and human GGT, respectively. GGsTop protects hepatic ischemia-reperfusion injury in rat model .
GGT1 Human Pre-designed siRNA Set A contains three designed siRNAs for GGT1 gene (Human), as well as a negative control, a positive control, and a FAM-labeled negative control.
GGT5 Human Pre-designed siRNA Set A contains three designed siRNAs for GGT5 gene (Human), as well as a negative control, a positive control, and a FAM-labeled negative control.
GGT6 Human Pre-designed siRNA Set A contains three designed siRNAs for GGT6 gene (Human), as well as a negative control, a positive control, and a FAM-labeled negative control.
GGT7 Human Pre-designed siRNA Set A contains three designed siRNAs for GGT7 gene (Human), as well as a negative control, a positive control, and a FAM-labeled negative control.
γ-glutamyltransferase, Human liver (GGT, Human liver) is an enzyme located on the outer surface of the cell membrane. γ-glutamyltransferase maintains the physiological concentration of cytoplasmic glutathione and the cell's defense against oxidative stress by cleaving extracellular glutathione and increasing the availability of amino acids. γ-glutamyltransferase can be used as a biomaterial or organic compound for life science related research .
FGTI-2734 is a RAS C-terminal mimetic dual farnesyl transferase (FT) and geranylgeranyl transferase-1 (GGT-1) inhibitor with IC50s of 250 nM and 520 nM for FT and GGT-1, respectively. FGTI-2734 can prevent membrane localization of KRAS, hence solving KRAS resistance problem and thwarting mutant KRAS patient-derived pancreatic tumors .
AS 1411 (AGRO-100) is an oligonucleotide aptamer targeting nucleoproteins. AS 1411 inhibits tumor cell proliferation by affecting the activity of nucleoprotein-containing complexes and can be used as a carrier to precisely deliver nanoparticles, oligonucleotides and small molecules to cancer cells. AS 1411 reduces PRMT5 expression to inhibit tumor growth in DU145 prostate cancer cells. AS 1411 works by blocking the binding of nucleoproteins to bcl-2 mRNA in MCF-7 breast cancer cells. AS 1411-coupled Jin nanospheres can inhibit breast cancer cell proliferation in vitro and in mouse models, has the ability to cross the blood-brain barrier with low tissue toxicity .
FTI-2148 is a RAS C-terminal mimetic dual farnesyl transferase (FT-1) and geranylgeranyl transferase-1 (GGT-1) inhibitor with IC50s of 1.4 nM and 1.7 μM, respectively .
FTI-2148 diTFA is a RAS C-terminal mimetic dual farnesyl transferase (FT-1) and geranylgeranyl transferase-1 (GGT-1) inhibitor with IC50s of 1.4 nM and 1.7 μM, respectively .
Rovunaptabin (ARC 183) is a DNA aptamer, which is a single-stranded DNA molecule consisting of 15 deoxynucleotides that forms well-defined three-dimensional configuration, allowing it to bind to thrombin with high affinity and specificity.
ODN TTAGGG (A151), inhibitory oligonucleotide (ODN), is a TLR9, AIM2 and cGAS antagonist. ODN TTAGGG is immunosuppressive and inhibits AIM2 inflammasome activation, as well as cGAS activation, by competing with DNA. ODN TTAGGG can be used in the study of lupus erythematosus and other related autoimmune diseases. ODN TTAGGG sequence: 5'-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-3' .
FGTI-2734 mesylate is a RAS C-terminal mimetic dual farnesyl transferase (FT) and geranylgeranyl transferase-1 (GGT) inhibitor with IC50s of 250 nM and 520 nM for FT and GGT, respectively. FGTI-2734 mesylate can prevent membrane localization of KRAS, hence solving KRAS resistance problem and thwarting mutant KRAS patient-derived pancreatic tumors .
Prenyl-IN-1 is a protein prenylation inhibitor, especially a geranylgeranyltransferase (GGT) or a farnesyltransferase (FT) inhibitor, exhibiting potent activity against oxidative stress, and particularly in the treatment of Parkinson's Disease.
BMI-Glu is a selective γ-glutamyl transpeptidase (GGT) fluorescent probe with a Km of 69.63 µM. BMI-Glu has high sensitivity, good water solubility and biocompatibility .
Aprinocarsen (ISIS 3521) sodium, a specific antisense oligonucleotide inhibitor of protein kinase C-alpha (PKC-α). Aprinocarsen sodium is a 20-mer oligonucleotide, it regulates cell differentiation and proliferation. Aprinocarsen sodium inhibits the growth of human tumor cell lines in nude mice. Aprinocarsen sodium shows the value as a chemotherapeutic compound of human cancers .
ODN 1585 is a potent inducer of IFN and TNFα production. ODN 1585 is a potent stimulator of NK (natural killer) function. ODN 1585 increases CD8+ T-cell function, including the CD8+ T cell-mediated production of IFN-γ. ODN 1585 induces regression of established melanomas in mice. ODN 1585 can confer complete protection against malaria in mice. ODN 1585 can be used for acute myelogenous leukemia (AML) and malaria research. ODN 1585 can be used as a vaccine adjuvant .
ODN D-SL01, a class B CpG ODN (oligodeoxynucleotide), is a TLR9 agonist. ODN D-SL01 has strong immunostimulatory activity in a variety of vertebrate species and has anticancer activity. ODN D-SL01 sequence: 5'- T-C-G-C-G-A-C-G-T-T-C-G-C-C-C-G-A-C-G-T-T-C-G-G-T-A-3' .
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
Acivicin (AT-125), a natural product produced by Streptomyces sviceus is a γ-glutamyl transpeptidase (GGT) inhibitor. Acivicin can across the blood-brain barrier and has anti-cancer, anti-parasitic properties .
Acivicin hydrochloride (AT-125 hydrochloride), a natural product produced by Streptomyces sviceus, is a γ-glutamyl transpeptidase (GGT) inhibitor. Acivicin hydrochloride can across the blood-brain barrier and has anti-cancer, anti-parasitic properties .
The GGT5 protein is an important glycosaminoglycan lyase that selectively cleaves heparin and heparan sulfate using a β-elimination mechanism. It targets specific linkages, such as alpha-D-GlcNp2S6S(1->4) alpha-L-IdoAp2S in heparin and alpha-D-GlcNp2Ac(or 2S)6OH(1->4)beta- in heparan sulfate D-GlcAp. GGT5 Protein, Human (HEK293, His) is the recombinant human-derived GGT5 protein, expressed by HEK293 , with N-His labeled tag. The total length of GGT5 Protein, Human (HEK293, His) is 557 a.a., with molecular weight of ~23-27 & 48-61.8 KDa.
GGT1 Protein cleaves the gamma-glutamyl bond of extracellular glutathione, glutathione conjugates, and other gamma-glutamyl compounds. Its metabolism releases free glutamate and cysteinyl-glycine, hydrolyzed to cysteine and glycine. In the presence of high dipeptide concentrations, it catalyzes transpeptidation, forming new gamma-glutamyl compounds. GGT1 contributes to cysteine and glutathione homeostasis and converts leukotriene LTC4 to LTD4. Note: GGT1 seems to be inactive. GGT1 Protein, Human (HEK293, His) is the recombinant human-derived GGT1 protein, expressed by HEK293, with N-His labeled tag. The total length of GGT1 Protein, Human (HEK293, His) is 543 a.a., with molecular weight of 55-65 kDa (heavy chain) & 25-30 kDa (light chain), respectively.
GGT1 Antibody (YA2634) is a rabbit-derived non-conjugated IgG antibody (Clone NO.: YA2634), targeting GGT1, with a predicted molecular weight of 61 kDa (observed band size: 50-60 kDa). GGT1 Antibody (YA2634) can be used for WB, IHC-P experiment in human background.
Aprinocarsen (ISIS 3521) sodium, a specific antisense oligonucleotide inhibitor of protein kinase C-alpha (PKC-α). Aprinocarsen sodium is a 20-mer oligonucleotide, it regulates cell differentiation and proliferation. Aprinocarsen sodium inhibits the growth of human tumor cell lines in nude mice. Aprinocarsen sodium shows the value as a chemotherapeutic compound of human cancers .
GGT1 Human Pre-designed siRNA Set A contains three designed siRNAs for GGT1 gene (Human), as well as a negative control, a positive control, and a FAM-labeled negative control.
GGT5 Human Pre-designed siRNA Set A contains three designed siRNAs for GGT5 gene (Human), as well as a negative control, a positive control, and a FAM-labeled negative control.
GGT6 Human Pre-designed siRNA Set A contains three designed siRNAs for GGT6 gene (Human), as well as a negative control, a positive control, and a FAM-labeled negative control.
GGT7 Human Pre-designed siRNA Set A contains three designed siRNAs for GGT7 gene (Human), as well as a negative control, a positive control, and a FAM-labeled negative control.
AS 1411 (AGRO-100) is an oligonucleotide aptamer targeting nucleoproteins. AS 1411 inhibits tumor cell proliferation by affecting the activity of nucleoprotein-containing complexes and can be used as a carrier to precisely deliver nanoparticles, oligonucleotides and small molecules to cancer cells. AS 1411 reduces PRMT5 expression to inhibit tumor growth in DU145 prostate cancer cells. AS 1411 works by blocking the binding of nucleoproteins to bcl-2 mRNA in MCF-7 breast cancer cells. AS 1411-coupled Jin nanospheres can inhibit breast cancer cell proliferation in vitro and in mouse models, has the ability to cross the blood-brain barrier with low tissue toxicity .
Rovunaptabin (ARC 183) is a DNA aptamer, which is a single-stranded DNA molecule consisting of 15 deoxynucleotides that forms well-defined three-dimensional configuration, allowing it to bind to thrombin with high affinity and specificity.
ODN TTAGGG (A151), inhibitory oligonucleotide (ODN), is a TLR9, AIM2 and cGAS antagonist. ODN TTAGGG is immunosuppressive and inhibits AIM2 inflammasome activation, as well as cGAS activation, by competing with DNA. ODN TTAGGG can be used in the study of lupus erythematosus and other related autoimmune diseases. ODN TTAGGG sequence: 5'-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-3' .
ODN 1982 is a unmethylated oligodeoxyribonucleotide (ODN) with no CpG motif, can be used to prepare DNA vaccines. ODN 1982 inhibits R-848 signaling. ODN 1982 sequence: 5’-tccaggacttctctcaggtt-3’ .
ODN 1585 is a potent inducer of IFN and TNFα production. ODN 1585 is a potent stimulator of NK (natural killer) function. ODN 1585 increases CD8+ T-cell function, including the CD8+ T cell-mediated production of IFN-γ. ODN 1585 induces regression of established melanomas in mice. ODN 1585 can confer complete protection against malaria in mice. ODN 1585 can be used for acute myelogenous leukemia (AML) and malaria research. ODN 1585 can be used as a vaccine adjuvant .
ODN D-SL01, a class B CpG ODN (oligodeoxynucleotide), is a TLR9 agonist. ODN D-SL01 has strong immunostimulatory activity in a variety of vertebrate species and has anticancer activity. ODN D-SL01 sequence: 5'- T-C-G-C-G-A-C-G-T-T-C-G-C-C-C-G-A-C-G-T-T-C-G-G-T-A-3' .
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
