1. Anti-infection
  2. HBV
  3. Bepirovirsen

Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).

The free form of the compound is prone to instability, it is advisable to consider the stable salt form (Bepirovirsen sodium) that retains the same biological activity.

For research use only. We do not sell to patients.

DNA, d(P-thio)([2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]m5rC-[2′-O-(2-methoxyethyl)]rA-[2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]rA-G-G-T-G-A-A-G-m5C-G-A-[2′-O-(2-methoxyethyl)]rA-[2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]m5rU-[2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]m5rC)

Bepirovirsen Chemical Structure

CAS No. : 1403787-62-1

Size Price Stock
1 mg Ask For Quote & Lead Time
5 mg Ask For Quote & Lead Time

* Please select Quantity before adding items.

This product is a controlled substance and not for sale in your territory.

Other Forms of Bepirovirsen:

Top Publications Citing Use of Products
  • Biological Activity

  • Purity & Documentation

  • References

  • Customer Review

Description

Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC)[1].

In Vitro

Bepirovirsen (16-250 nM; 16 h) reduces hepatitis B virus (HBV) RNA, DNA, and viral proteins in HepG2.2.15 cells[1].

MedChemExpress (MCE) has not independently confirmed the accuracy of these methods. They are for reference only.

In Vivo

Bepirovirsen (22-50 mg/kg/week; s.c. twice weekly for week 1 and once weekly for weeks 2-4) reduces hepatic HBV RNA and DNA in HBV-transgenic mice[1].

MedChemExpress (MCE) has not independently confirmed the accuracy of these methods. They are for reference only.

Animal Model: Male HBV transgenic mice (Tg[HBV 1.3 genome]Chi32 against C57BL/6 background) aged 7-12 weeks and weight 18-25 g[1].
Dosage: 22, 50 mg/kg/week
Administration: Injected subcutaneously twice weekly for week 1 and once weekly for weeks 2-4
Result: Dose-dependently reduced hepatic levels of HBV DNA and HBV RNA in HBV transgenic mice.
Reduced levels of serum HBV DNA, serum HBsAg and serum HBeAg.
Clinical Trial
Molecular Weight

7344.00

CAS No.
Appearance

Solid

Color

White to off-white

Sequence

DNA, d(P-thio)([2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]m5rC-[2′-O-(2-methoxyethyl)]rA-[2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]rA-G-G-T-G-A-A-G-m5C-G-A-[2′-O-(2-methoxyethyl)]rA-[2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]m5rU-[2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]m5rC)

SMILES

[Bepirovirsen]

Shipping

Room temperature in continental US; may vary elsewhere.

Storage

-20°C, sealed storage, away from moisture

*In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)

Solvent & Solubility
In Vitro: 

H2O : ≥ 20 mg/mL (2.72 mM)

*"≥" means soluble, but saturation unknown.

Preparing
Stock Solutions
Concentration Solvent Mass 1 mg 5 mg 10 mg
1 mM 0.1362 mL 0.6808 mL 1.3617 mL
5 mM --- --- ---
View the Complete Stock Solution Preparation Table

* Please refer to the solubility information to select the appropriate solvent. Once prepared, please aliquot and store the solution to prevent product inactivation from repeated freeze-thaw cycles.
Storage method and period of stock solution: -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture). When stored at -80°C, please use it within 6 months. When stored at -20°C, please use it within 1 month.

* Note: If you choose water as the stock solution, please dilute it to the working solution, then filter and sterilize it with a 0.22 μm filter before use.

  • Molarity Calculator

  • Dilution Calculator

Mass (g) = Concentration (mol/L) × Volume (L) × Molecular Weight (g/mol)

Mass
=
Concentration
×
Volume
×
Molecular Weight *

Concentration (start) × Volume (start) = Concentration (final) × Volume (final)

This equation is commonly abbreviated as: C1V1 = C2V2

Concentration (start)

C1

×
Volume (start)

V1

=
Concentration (final)

C2

×
Volume (final)

V2

In Vivo Dissolution Calculator
Please enter the basic information of animal experiments:

Dosage

mg/kg

Animal weight
(per animal)

g

Dosing volume
(per animal)

μL

Number of animals

Recommended: Prepare an additional quantity of animals to account for potential losses during experiments.
Calculation results:
Working solution concentration: mg/mL
This product has good water solubility, please refer to the measured solubility data in water/PBS/Saline for details.
The concentration of the stock solution you require exceeds the measured solubility. The following solution is for reference only.If necessary, please contact MedChemExpress (MCE).
Purity & Documentation

Purity: 98.44%

References

Complete Stock Solution Preparation Table

* Please refer to the solubility information to select the appropriate solvent. Once prepared, please aliquot and store the solution to prevent product inactivation from repeated freeze-thaw cycles.
Storage method and period of stock solution: -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture). When stored at -80°C, please use it within 6 months. When stored at -20°C, please use it within 1 month.

Optional Solvent Concentration Solvent Mass 1 mg 5 mg 10 mg 25 mg
H2O 1 mM 0.1362 mL 0.6808 mL 1.3617 mL 3.4041 mL

* Note: If you choose water as the stock solution, please dilute it to the working solution, then filter and sterilize it with a 0.22 μm filter before use.

  • No file chosen (Maximum size is: 1024 Kb)
  • If you have published this work, please enter the PubMed ID.
  • Your name will appear on the site.
Help & FAQs
  • Do most proteins show cross-species activity?

    Species cross-reactivity must be investigated individually for each product. Many human cytokines will produce a nice response in mouse cell lines, and many mouse proteins will show activity on human cells. Other proteins may have a lower specific activity when used in the opposite species.

Your Recently Viewed Products:

Inquiry Online

Your information is safe with us. * Required Fields.

Product Name

 

Salutation

Applicant Name *

 

Email Address *

Phone Number *

 

Organization Name *

Department *

 

Requested quantity *

Country or Region *

     

Remarks

Bulk Inquiry

Inquiry Information

Product Name:
Bepirovirsen
Cat. No.:
HY-147217
Quantity:
MCE Japan Authorized Agent: