HA Peptide 

HA Peptide (HA tag) is a nine amino acids peptide derived from the human influenza hemagglutinin (HA). HA Peptide is extensively used to isolate, purify, detect, and track the protein of interest in cell biology and biochemistry.

HA Peptide is a highly immunoreactive tag generally used for the separation of tagged proteins from cell culture supernatants and cell lysate under neutral pH conditions and thus are handy tools for coimmunoprecipitation but are also easily detected via western blot. HA Peptide is small and thus unlikely to interfere with the bioactivity and function of the fusion partner proteins. HA Peptide comes from human influenza hemagglutinin (HA) corresponding to amino acids 98–106 and is a strong immunoreactive epitope making it popular to isolate, purify, detect, and track the protein of interest. The recombinant HA-tagged proteins can be separated by highly specific anti-HA monoclonal antibody that is covalently immobilized on resin. The HA-tagged proteins can be eluted by mild elution approach with HA epitope at 1?mg/mL in TBS. On the other hand, three chemical elution options are available: 0.1?M glycine (pH 2-2.8), 3?M NaSCN, or 50?mM NaOH^[1]. The nucleotide sequences encoding an N-terminal HA Peptide in the mammalian expression vectors is an essential element for the T7 promoter-driven expression in E. coli even without trans-acting T7 RNAP^[2]. Research results suggest that HA Peptide is cleaved by caspase 3/7, and HA Peptide cleavage results in a total loss of immunoreactivity. Observations indicate that the use of HA to tag proteins and constructs to study cell death–related and apoptotic mechanisms can result in serious artifacts^[3].
HA-tagged Hop Protein Detection^[3]
1. Cell Transfection and Protein Expression
(1) Select HEK293T cells and culture them in DMEM medium containing 10% fetal bovine serum.
(2) Transfect the HEK293T cells with the pcDNA3.1-HOP wt-HA vector, which encodes the HA-tagged Hop protein gene. The control group uses a vector without the target gene.
(3) After 48 hours of transfection, wash the cells with PBS and collect the cells for lysis.
2. Cell Lysis and Protein Extraction
(1) Add the lysis buffer (containing 25 mM Tris-HCl pH 7.4, 250 mM sucrose, 5 mM MgCl2, 1% IGEPAL, 1 mM DTT, and protease inhibitors) to the collected cells and incubate at room temperature for 10 minutes.
(2) Centrifuge the mixture (16,100 g, 10 minutes) to separate the cell lysate and remove the cell pellet.
(3) Collect the supernatant, measure the protein concentration, and prepare the samples.
3. Protein Separation
(1) Divide the protein samples into different dilution ratios (e.g., 1:2 and 1:10). Based on the protein concentration, load 30 μg of the sample onto a 10% SDS-PAGE gel for electrophoresis.
(2) After electrophoresis, transfer the separated proteins onto a nitrocellulose membrane.
4. Protein Immunoblotting (Western Blot)
(1) Block the nitrocellulose membrane in blocking solution (containing 5% non-fat dry milk, TBS, 0.2% Tween 20 or IGEPAL) for 30 minutes.
(2) Incubate the membrane with the target antibody (e.g., AF291 or AE391 anti-HA antibody, diluted 1:1000) in TBS buffer for 1 hour.
(3) Use an anti-GAPDH antibody as a loading control (diluted 1:5000) and incubate simultaneously.
(4) Wash the membrane three times, each time for 15 minutes, with TBS containing 0.2% Tween 20 or IGEPAL.
(5) Incubate the membrane with HRP-conjugated secondary antibody for 1 hour, diluted 1:10,000.
(6) Wash the membrane again three times, each time for 15 minutes.
(7) Use ECL detection reagents for protein visualization and capture the signal using an imaging system.
5. Results Analysis
(1) Analyze the experimental results and check the signal strength of the HA-tagged protein.
(2) Note that the AF291 and AE391 antibodies may recognize several endogenous proteins unrelated to the target protein, so the results should be compared with a control antibody (e.g., HA.11 antibody) to ensure specificity.


Constructing a T7 Promoter-Driven HtrA1 Gene Expression System in E. coli Using HA Peptide^[4]
(1) Construction of the pHA-M-HtrA1 Plasmid:
(a) The pcDNA3-HA and pBS-M-HtrA1 plasmids were digested with EcoRI and XhoI to create an N-terminal fusion of HtrA1 with the HA tag.
(b) The pHA-M-HtrA1 plasmid was used as a template for PCR amplification with specific primers (Forward primer: ATCGATATGTACCCTTACGATGTACCG; Reverse primer: CTCGAGCTACTTGTCATCGTCGTCCTTGTA), resulting in the M-HtrA1 cDNA fragment. The amplified M-HtrA1 cDNA fragment was also digested with EcoRI and XhoI.
(c) The digested M-HtrA1 cDNA fragment was inserted into the pcDNA3.0 plasmid to complete the construction.
(2) Activity Assay in E. coli
The pHA-M-HtrA1 plasmid was transformed into E. coli TOP10 cells, which were then inoculated into Luria-Bertani medium (LB-Amp) containing 50 μg/ml Ampicillin (HY-B0522) and incubated at 37 °C. Growth was monitored by measuring the OD600 values.
(3) Detection of HtrA1 Expression by Immunoblotting (IB)
(a) The N-terminal HA-tagged HtrA1 gene can be detected by IB.
(b) The expression of N-terminal HA-tagged Parkin protein increases in the E. coli vector.
Summary: By constructing an HA peptide-tagged E. coli gene expression system, the expression of target genes and the effects on E. coli cell activity can be rapidly assessed, serving as a predictive tool for mammalian cell experiments.

MedChemExpress (MCE) has not independently confirmed the accuracy of these methods. They are for reference only.

1102.15

C₅₃H₆₇N₉O₁₇

92000-76-5

Solid

White to off-white

Tyr-Pro-Tyr-Asp-Val-Pro-Asp-Tyr-Ala

YPYDVPDYA

Room temperature in continental US; may vary elsewhere.

Sealed storage, away from moisture

*In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)

* Please refer to the solubility information to select the appropriate solvent. Once prepared, please aliquot and store the solution to prevent product inactivation from repeated freeze-thaw cycles.
Storage method and period of stock solution: -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture). When stored at -80°C, please use it within 6 months. When stored at -20°C, please use it within 1 month.

* Note: If you choose water as the stock solution, please dilute it to the working solution, then filter and sterilize it with a 0.22 μm filter before use.

• [1]. Zhao X, et al. Several affinity tags commonly used in chromatographic purification. J Anal Methods Chem. 2013;2013:581093.  [Content Brief]

  [2]. Schembri L, et al. The HA tag is cleaved and loses immunoreactivity during apoptosis. Nat Methods. 2007 Feb;4(2):107-8.  [Content Brief]

  [3]. Keszei Z, et al. AF291 and AE391 single-chain antibodies recognize the HA tag by Western blotting[J]. Antibody Reports, 2019: e25-e25.

  [4]. Moon JM, et al. A new idea for simple and rapid monitoring of gene expression: requirement of nucleotide sequences encoding an N-terminal HA tag in the T7 promoter-driven expression in E. coli. Biotechnol Lett. 2012 Oct;34(10):1841-6.  [Content Brief]