miRNA inhibitors

miRNA inhibitors (4607):

Cat. No.	Product Name	CAS No.	Purity	Chemical Structure

HY-RI04602

MicroRNA Inhibitor Negative Control
MicroRNA Inhibitor Negative Control is a full-length nucleotide 2'-methoxy modified oligonucleotide, and can be used as a negative control. The sequence of MicroRNA Inhibitor Negative Control is derived from cel-mir-239b. It has minimal sequence identity with miRNAs in human, mouse, and rat.

RNA, (CAGUACUUUUGUGUAGUACAA) (full-length nucleotide 2'-methoxy modification) RNA, (CAGUACUUUUGUGUAGUACAA) (full-length nucleotide 2'-methoxy modification)

HY-RI00449

hsa-miR-21-5p inhibitor
hsa-miR-21-5p inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

RNA, (UCAACAUCAGUCUGAUAAGC) (full-length nucleotide 2'-methoxy modification) RNA, (UCAACAUCAGUCUGAUAAGC) (full-length nucleotide 2'-methoxy modification)

HY-RI00497

hsa-miR-26b-5p inhibitor
hsa-miR-26b-5p inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

RNA, (ACCUAUCCUGAAUUACUUG) (full-length nucleotide 2'-methoxy modification) RNA, (ACCUAUCCUGAAUUACUUG) (full-length nucleotide 2'-methoxy modification)

HY-RI00138

hsa-miR-124-3p inhibitor
hsa-miR-124-3p inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

RNA, (UUGGCAUUCACCGCGUGCCU) (full-length nucleotide 2'-methoxy modification) RNA, (UUGGCAUUCACCGCGUGCCU) (full-length nucleotide 2'-methoxy modification)

HY-RI00282

hsa-miR-145-5p inhibitor
hsa-miR-145-5p inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

RNA, (AGGGAUUCCUGGGAAAACUGG) (full-length nucleotide 2'-methoxy modification) RNA, (AGGGAUUCCUGGGAAAACUGG) (full-length nucleotide 2'-methoxy modification)

HY-RI04606

hsa-miR-24-3p inhibitor
hsa-miR-24-3p inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

RNA, (CUGUUCCUGCUGAACUGAGC) (full-length nucleotide 2'-methoxy modification) RNA, (CUGUUCCUGCUGAACUGAGC) (full-length nucleotide 2'-methoxy modification)

HY-RI04608

hsa-miR-222-3p inhibitor
hsa-miR-222-3p inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

RNA, (ACCCAGUAGCCAGAUGUAG) (full-length nucleotide 2'-methoxy modification) RNA, (ACCCAGUAGCCAGAUGUAG) (full-length nucleotide 2'-methoxy modification)

HY-RI04607

hsa-miR-134-3p inhibitor
hsa-miR-134-3p inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

RNA, (GGUGACUAGGUGGCCCACAGG) (full-length nucleotide 2'-methoxy modification) RNA, (GGUGACUAGGUGGCCCACAGG) (full-length nucleotide 2'-methoxy modification)

HY-RI00416

hsa-miR-204-5p inhibitor
hsa-miR-204-5p inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

RNA, (AGGCAUAGGAUGACAAAGGG) (full-length nucleotide 2'-methoxy modification) RNA, (AGGCAUAGGAUGACAAAGGG) (full-length nucleotide 2'-methoxy modification)

HY-RI00495

hsa-miR-26a-5p inhibitor
hsa-miR-26a-5p inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

RNA, (AGCCUAUCCUGGAUUACUUG) (full-length nucleotide 2'-methoxy modification) RNA, (AGCCUAUCCUGGAUUACUUG) (full-length nucleotide 2'-methoxy modification)

HY-RI02691

mmu-miR-155-5p inhibitor
mmu-miR-155-5p inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

RNA, (ACCCCUAUCACAAUUAGCAUU) (full-length nucleotide 2'-methoxy modification) RNA, (ACCCCUAUCACAAUUAGCAUU) (full-length nucleotide 2'-methoxy modification)

HY-RI00714

hsa-miR-34a-5p inhibitor
hsa-miR-34a-5p inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

RNA, (ACAACCAGCUAAGACACUGC) (full-length nucleotide 2'-methoxy modification) RNA, (ACAACCAGCUAAGACACUGC) (full-length nucleotide 2'-methoxy modification)

HY-RI00686

hsa-miR-328-3p inhibitor
hsa-miR-328-3p inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

RNA, (ACGGAAGGGCAGAGAGGGCC) (full-length nucleotide 2'-methoxy modification) RNA, (ACGGAAGGGCAGAGAGGGCC) (full-length nucleotide 2'-methoxy modification)

HY-RI00499

hsa-miR-27a-5p inhibitor
hsa-miR-27a-5p inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

RNA, (UGCUCACAAGCAGCUAAGCC) (full-length nucleotide 2'-methoxy modification) RNA, (UGCUCACAAGCAGCUAAGCC) (full-length nucleotide 2'-methoxy modification)

HY-RI00500

hsa-miR-27b-3p inhibitor
hsa-miR-27b-3p inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

RNA, (GCAGAACUUAGCCACUGUG) (full-length nucleotide 2'-methoxy modification) RNA, (GCAGAACUUAGCCACUGUG) (full-length nucleotide 2'-methoxy modification)

HY-RI00428

hsa-miR-20b-5p inhibitor
hsa-miR-20b-5p inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

RNA, (CUACCUGCACUAUGAGCACUU) (full-length nucleotide 2'-methoxy modification) RNA, (CUACCUGCACUAUGAGCACUU) (full-length nucleotide 2'-methoxy modification)

HY-RI00248

hsa-miR-132-3p inhibitor
hsa-miR-132-3p inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

RNA, (CGACCAUGGCUGUAGACUGU) (full-length nucleotide 2'-methoxy modification) RNA, (CGACCAUGGCUGUAGACUGU) (full-length nucleotide 2'-methoxy modification)

HY-RI00147

hsa-miR-1248 inhibitor
hsa-miR-1248 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

RNA, (UUUAGCACAGUGCUUAUACAAGAAG) (full-length nucleotide 2'-methoxy modification) RNA, (UUUAGCACAGUGCUUAUACAAGAAG) (full-length nucleotide 2'-methoxy modification)

HY-RI00540

hsa-miR-30c-5p inhibitor
hsa-miR-30c-5p inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

RNA, (GCUGAGAGUGUAGGAUGUUUA) (full-length nucleotide 2'-methoxy modification) RNA, (GCUGAGAGUGUAGGAUGUUUA) (full-length nucleotide 2'-methoxy modification)

HY-RI02536

hsa-miR-9-5p inhibitor
hsa-miR-9-5p inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

RNA, (UCAUACAGCUAGAUAACCAAA) (full-length nucleotide 2'-methoxy modification) RNA, (UCAUACAGCUAGAUAACCAAA) (full-length nucleotide 2'-methoxy modification)

Name
Email *

	Sorry, but the email address you supplied was invalid.