Bepirovirsen sodium  (Synonyms: ISIS 505358 sodium)

Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC)^[1][2][3].

Bepirovirsen sodium (16-250 nM, 96 h) reduces levels of HBV RNA transcripts in HBV-expressing HepG cells^[3].

MedChemExpress (MCE) has not independently confirmed the accuracy of these methods. They are for reference only.

Bepirovirsen sodium (22 and 50 mg/kg, s.c., twice weekly for week 1 and once weekly for weeks 2-4) reduces hepatic RNA transcripts, subsequent production of HBV DNA, and associated HBV serum antigens in HBV-transgenic mice^[3].

MedChemExpress (MCE) has not independently confirmed the accuracy of these methods. They are for reference only.

7762.00

C₂₃₀H₂₉₀N₈₈Na₁₉O₁₁₅P₁₉S₁₉

2563929-84-8

Solid

White to off-white

[Bepirovirsen (sodium)]

Room temperature in continental US; may vary elsewhere.

-20°C, sealed storage, away from moisture

*In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)

• [1]. Yuen MF, et al. Safety, tolerability and antiviral activity of the antisense oligonucleotide bepirovirsen in patients with chronic hepatitis B: a phase 2 randomized controlled trial. Nat Med. 2021 Oct;27(10):1725-1734.  [Content Brief]

  [2]. Yuen MF, et al. Efficacy and Safety of Bepirovirsen in Chronic Hepatitis B Infection. N Engl J Med. 2022 Nov 24;387(21):1957-1968.  [Content Brief]

  [3]. Han K, et al. Preclinical and Phase 1 Assessment of Antisense Oligonucleotide Bepirovirsen in Hepatitis B Virus-Transgenic Mice and Healthy Human Volunteers: Support for Clinical Dose Selection and Evaluation of Safety, Tolerability, and Pharmacokinetics of Single and Multiple Doses. Clin Pharmacol Drug Dev. 2022 Oct;11(10):1191-1202.  [Content Brief]