hsa-miR-214-3p agomir

Cat. No.: HY-R00445A: FAQs
Data Sheet SDS COA Handling Instructions

Molarity Calculator

hsa-miR-214-3p agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

For research use only. We do not sell to patients.

RNA, (ACAGCAGGCACAGACAGGCAGU), complex with RNA, (UGCCUGUCUGUGCCUGCUGUNN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

hsa-miR-214-3p agomir Chemical Structure

Size	Price	Stock	Quantity
5 nmol	USD 225	Get quote 1-2 weeks 1-2 weeks 1-2 weeks	Estimated Time of Arrival: December 31
20 nmol	USD 450	Get quote 1-2 weeks 1-2 weeks 1-2 weeks	Estimated Time of Arrival: December 31

Synthetic products have potential research and development risk.

or Bulk Inquiry

* Please select Quantity before adding items.

This product is a controlled substance and not for sale in your territory.

Customer Review

Based on 1 publication(s) in Google Scholar

Other Forms of hsa-miR-214-3p agomir:

hsa-miR-214-3p mimic Get quote

Featured Recommendations

•Related Small Molecules:

•Related Proteins:

Biological Activity
Purity & Documentation
Customer Review

Description	hsa-miR-214-3p agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.
Molecular Weight	15188.44
miRBase Accession Number	MI0000290
Mature miRNA Sequence	ACAGCAGGCACAGACAGGCAGU
Stem-loop ID	hsa-mir-214
Stem-loop Sequence	GGCCUGGCUGGACAGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCCGCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCU
Species	Human, Mouse, Anolis carolinensis, Artibeus jamaicensis, Bovine, Callithrix jacchus, Columba livia, Dasypus novemcinctus, Daubentonia madagascariensis, Dog, Guinea pig, Horse, Microcebus murinus, Nomascus leucogenys, Ornithorhynchus anatinus, Otolemur garnettii, Papio hamadryas, Pteropus alecto, Python bivittatus, Rabbit, Taeniopygia guttata
Appearance	Solid
Color	Off-white to light yellow
Shipping	Room temperature in continental US; may vary elsewhere.
Storage	-20°C, sealed storage, away from moisture *In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)
Purity & Documentation	Purity: 94.60% Select Batch: Data Sheet (230 KB) SDS (252 KB) COA (233 KB) RP-HPLC (615 KB) Handling Instructions (2659 KB)