1. Oligonucleotides
  2. Antisense Oligonucleotides
  3. Inactive ASO (in vivo) sodium

Inactive ASO (in vivo) sodium is an inactive Antisense Oligonucleotide. ASO is a class of oligonucleotide molecules, usually composed of 20-30 bases, used to interfere with or regulate gene expression. Inactive ASO (in vivo) sodium is not targeted in the rodent genome and can be used as a negative control for Tofersen. Inactive ASO (in vivo) sodium contains thiophosphate skeleton modification and MOE modification. Cytosine in Inactive ASO (in vivo) is 5' methylcytosine. See References for the location of chemical modifications

For research use only. We do not sell to patients.

CCTATAGGACTATCCAGGAA

Inactive ASO (in vivo) sodium Chemical Structure

Size Price Stock Quantity
1 mg In-stock
5 mg In-stock
10 mg In-stock
50 mg   Get quote  
100 mg   Get quote  

* Please select Quantity before adding items.

This product is a controlled substance and not for sale in your territory.

Customer Review

Based on 1 publication(s) in Google Scholar

Top Publications Citing Use of Products
  • Biological Activity

  • Purity & Documentation

  • References

  • Customer Review

Description

Inactive ASO (in vivo) sodium is an inactive Antisense Oligonucleotide. ASO is a class of oligonucleotide molecules, usually composed of 20-30 bases, used to interfere with or regulate gene expression. Inactive ASO (in vivo) sodium is not targeted in the rodent genome and can be used as a negative control for Tofersen. Inactive ASO (in vivo) sodium contains thiophosphate skeleton modification and MOE modification. Cytosine in Inactive ASO (in vivo) is 5' methylcytosine. See References for the location of chemical modifications

Appearance

Solid

Color

White to off-white

SMILES

[CCTATAGGACTATCCAGGAA]

Shipping

Room temperature in continental US; may vary elsewhere.

Storage

-20°C, sealed storage, away from moisture

*In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)

Solvent & Solubility
In Vitro: 

H2O : 100 mg/mL (Need ultrasonic)

  • Molarity Calculator

  • Dilution Calculator

Mass (g) = Concentration (mol/L) × Volume (L) × Molecular Weight (g/mol)

Mass
=
Concentration
×
Volume
×
Molecular Weight *

Concentration (start) × Volume (start) = Concentration (final) × Volume (final)

This equation is commonly abbreviated as: C1V1 = C2V2

Concentration (start)

C1

×
Volume (start)

V1

=
Concentration (final)

C2

×
Volume (final)

V2

In Vivo Dissolution Calculator
Please enter the basic information of animal experiments:

Dosage

mg/kg

Animal weight
(per animal)

g

Dosing volume
(per animal)

μL

Number of animals

Recommended: Prepare an additional quantity of animals to account for potential losses during experiments.
Calculation results:
Working solution concentration: mg/mL
This product has good water solubility, please refer to the measured solubility data in water/PBS/Saline for details.
The concentration of the stock solution you require exceeds the measured solubility. The following solution is for reference only.If necessary, please contact MedChemExpress (MCE).
Purity & Documentation

Purity: 92.18%

References
  • No file chosen (Maximum size is: 1024 Kb)
  • If you have published this work, please enter the PubMed ID.
  • Your name will appear on the site.

Inactive ASO (in vivo) sodium Related Classifications

Help & FAQs
  • Do most proteins show cross-species activity?

    Species cross-reactivity must be investigated individually for each product. Many human cytokines will produce a nice response in mouse cell lines, and many mouse proteins will show activity on human cells. Other proteins may have a lower specific activity when used in the opposite species.

Your Recently Viewed Products:

Inquiry Online

Your information is safe with us. * Required Fields.

Product Name

 

Salutation

Applicant Name *

 

Email Address *

Phone Number *

 

Organization Name *

Department *

 

Requested quantity *

Country or Region *

     

Remarks

Bulk Inquiry

Inquiry Information

Product Name:
Inactive ASO (in vivo) sodium
Cat. No.:
HY-153734
Quantity:
MCE Japan Authorized Agent: