Inactive ASO (in vivo) sodium

Cat. No.: HY-153734 Purity: 92.18%: FAQs
Data Sheet SDS COA Handling Instructions

Molarity Calculator

Inactive ASO (in vivo) sodium is an inactive Antisense Oligonucleotide. ASO is a class of oligonucleotide molecules, usually composed of 20-30 bases, used to interfere with or regulate gene expression. Inactive ASO (in vivo) sodium is not targeted in the rodent genome and can be used as a negative control for Tofersen. Inactive ASO (in vivo) sodium contains thiophosphate skeleton modification and MOE modification. Cytosine in Inactive ASO (in vivo) is 5' methylcytosine. See References for the location of chemical modifications

For research use only. We do not sell to patients.

CCTATAGGACTATCCAGGAA

Inactive ASO (in vivo) sodium Chemical Structure

Size	Price	Stock	Quantity
1 mg	USD 143	In-stock	Estimated Time of Arrival: December 31
5 mg	USD 332	In-stock	Estimated Time of Arrival: December 31
10 mg	USD 588	In-stock	Estimated Time of Arrival: December 31
50 mg		Get quote
100 mg		Get quote

or Bulk Inquiry

* Please select Quantity before adding items.

This product is a controlled substance and not for sale in your territory.

Customer Review

Based on 1 publication(s) in Google Scholar

Featured Recommendations

•Related Small Molecules:

•Related Proteins:

Biological Activity
Purity & Documentation
References
Customer Review

Description	Inactive ASO (in vivo) sodium is an inactive Antisense Oligonucleotide. ASO is a class of oligonucleotide molecules, usually composed of 20-30 bases, used to interfere with or regulate gene expression. Inactive ASO (in vivo) sodium is not targeted in the rodent genome and can be used as a negative control for Tofersen. Inactive ASO (in vivo) sodium contains thiophosphate skeleton modification and MOE modification. Cytosine in Inactive ASO (in vivo) is 5' methylcytosine. See References for the location of chemical modifications
Appearance	Solid
Color	White to off-white
SMILES	[CCTATAGGACTATCCAGGAA]
Shipping	Room temperature in continental US; may vary elsewhere.
Storage	-20°C, sealed storage, away from moisture *In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)
Solvent & Solubility	In Vitro: H₂O : 100 mg/mL (Need ultrasonic) Molarity Calculator Dilution Calculator Mass (g) = Concentration (mol/L) × Volume (L) × Molecular Weight (g/mol) Mass = Concentration × Volume × Molecular Weight * Concentration _(start) × Volume _(start) = Concentration _(final) × Volume _(final) This equation is commonly abbreviated as: C₁V₁ = C₂V₂ Concentration _(start) C1 × Volume _(start) V1 = Concentration _(final) C2 × Volume _(final) V2 In Vivo Dissolution Calculator Please enter the basic information of animal experiments: Dosage mg/kg Animal weight (per animal) g Dosing volume (per animal) μL Number of animals Recommended: Prepare an additional quantity of animals to account for potential losses during experiments. Calculation results: Working solution concentration: mg/mL This product has good water solubility, please refer to the measured solubility data in water/PBS/Saline for details. The concentration of the stock solution you require exceeds the measured solubility. The following solution is for reference only.If necessary, please contact MedChemExpress (MCE). Tel: 609-228-6898 E-mail: sales@medchemexpress.com Technical Support: tech@medchemexpress.com
Purity & Documentation	Purity: 92.18% Select Batch: Data Sheet (263 KB) SDS (251 KB) COA (241 KB) LCMS (307 KB) Handling Instructions (2659 KB)
References	[1]. McCampbell A, Cole T, Wegener AJ, et al. Antisense oligonucleotides extend survival and reverse decrement in muscle response in ALS models. J Clin Invest. 2018;128(8):3558-3567. [Content Brief]