Search Result

Pathways Recommended:	Cell Cycle/DNA Damage

Results for "

DNA reduction

" in MedChemExpress (MCE) Product Catalog:

By Targets:	DNA Alkylator/Crosslinker (2) DNA/RNA Synthesis (4) Apoptosis (2) Biochemical Assay Reagents (1) E1/E2/E3 Enzyme (1) Endogenous Metabolite (2) HBV (3) Isotope-Labeled Compounds (2) p62 (1)
By Research Areas:	Cancer (6) Infection (3) Metabolic Disease (2)
Oligonucleotides:	Nucleotides and their Analogs (1) Antisense Oligonucleotides (2)

Inhibitors & Agonists

Biochemical Assay Reagents

Natural
Products

Isotope-Labeled Compounds

Oligonucleotides

Targets Recommended: DNA-PK DNA Methyltransferase DNA Stain DNA Alkylator/Crosslinker DNA/RNA Synthesis

Cat. No.	Product Name	Target	Research Areas	Chemical Structure

HY-N0510A

Aristolochic acid sodium salt Maximum Cited Publications 9 Publications Verification Aristolochic acid I sodium; TR 1736 sodium; Sodium aristolochate	Biochemical Assay Reagents	Others
Aristolochic acid sodium salt (Sodium aristolate 1) is a component of some Chinese herbal medicines and is responsible for nephrotoxicity. It is a proagent that is activated by reduction of nitro groups to amines, resulting in the formation of cytotoxic DNA adducts.

HY-W011142

2'-Deoxyuridine 5'-monophosphate disodium	Endogenous Metabolite	Metabolic Disease
2'-Deoxyuridine 5'-monophosphate disodium is reductively methylated to dTMP (2'-deoxythymidine 5'-monophosphate) by bisubstrate enzyme thymidylate synthase (TS). dTMP is a nucleotide required for DNA synthesis .

HY-147217A

Bepirovirsen sodium ISIS 505358 sodium	HBV	Infection
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-13543

Tretazicar CB 1954	DNA Alkylator/Crosslinker	Cancer
Tretazicar (CB 1954), an antitumor proagent, is highly selective against the Walker 256 rat tumour line. Tretazicar is enzymatically activated to generate a bifunctional agent, which can form DNA-DNA interstrand cross-links. Tretazicar in rat cells involves the reduction of its 4-nitro group to a 4-hydroxylamine by the enzyme NAD(P)H:quinone oxidoreductase 1 (NQO1) .

HY-129241

AGX51 5+ Cited Publications	DNA/RNA Synthesis DNA Alkylator/Crosslinker	Cancer
AGX51 is the first-in-class pan-Id (inhibitors of DNA-binding/differentiation proteins) antagonist and degrader. AGX51 inhibits Id1-E47 interaction, leading to ubiquitin-mediated degradation of Ids, cell growth arrest, and viability reduction. AGX51 can inhibit TNBC and has an IC₅₀ of about 25 nM. AGX51 can be used in cancer research.

HY-144319

SHR5133	HBV	Infection
SHR5133 is a highly potent, orally active HBV capsid assembly modulator. SHR5133 displays HBV DNA reduction (EC₅₀=26.6 nM) .

HY-W394006

2'-Deoxyuridine 5'-monophosphate dUMP	Endogenous Metabolite	Metabolic Disease
2'-Deoxyuridine 5'-monophosphate is reductively methylated to dTMP (2'-deoxythymidine 5'-monophosphate) by bisubstrate enzyme thymidylate synthase (TS). dTMP is a nucleotide required for DNA synthesis .

HY-129762

Yoshi-864 NSC-102627	DNA/RNA Synthesis	Cancer
Yoshi-864 (NSC-102627) is an alkylsulfonate *DNA* crosslinker with anticancer activity. Yoshi-864 extends markedly the survival times of mice bearing L1210 leukemia or Ehrlich ascites carcinoma. Yoshi-864 also has a persistent reduction in ability to synthesize *DNA* in tumor cells from mice bearing the Ehrlich tumor .

HY-147217

Bepirovirsen ISIS 505358	HBV	Infection
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-U00279B

Nitracrine hydrochloride	DNA/RNA Synthesis	Cancer
Nitracrine hydrochloride is a platinum-based antineoplastic drug with selective toxicity to hypoxic cells. Nitracrine hydrochloride exhibits significant cytotoxicity against the Chinese hamster ovary cell line AA8 under hypoxic conditions and is approximately 100,000 times more potent than misonidazole. Nitracrine hydrochloride exerts its effect by binding to the insertion of DNA and forming covalent adducts. The cytotoxicity of Nitracrine hydrochloride under hypoxic conditions is related to its reductive metabolism to form alkylated substances. At the same time, it may enhance the reactivity to DNA through the insertion of DNA, thereby improving the efficacy. Nitracrine hydrochloride can also inhibit RNA synthesis, contributing to its anti-tumor effect .

HY-W011500

TCEP hydrochloride 5+ Cited Publications Tris(2-carboxyethyl)phosphine hydrochloride	Others	Others
TCEP hydrochloride (Tris(2-carboxyethyl)phosphine hydrochloride) is a non-thiol reducing agent that is more stable and produces a faster S-S reductive reaction than other chemical reductants. TCEP hydrochloride is a trialkylphosphine, selectively reduces protein disuldes without altering the properties or interacting with thiol-directed agents in the reaction mixture. TCEP hydrochloride is also a commonly used reducing agent in the DNA/AuNP chemistry .

HY-16350

BOLD-100 NKP-1339; IT-139; KP-1339	DNA/RNA Synthesis Apoptosis	Cancer
BOLD-100 (NKP-1339; IT-139) is the first-in-class ruthenium-based anticancer agent in development against solid cancer with limited side effects. BOLD-100 induces G2/M cell cycle arrest, blockage of DNA synthesis, and induction of apoptosis via the mitochondrial pathway. BOLD-100 has a high tumor targeting potential, strongly binds to serum proteins such as albumin and transferrin and activates in the reductive tumor milieu .

HY-W011500S

TCEP-d16 hydrochloride 1 Publications Verification	Isotope-Labeled Compounds	Others
TCEP-d₁₆ (hydrochloride) is the deuterium labeled TCEP hydrochloride[1]. TCEP hydrochloride (Tris(2-carboxyethyl)phosphine hydrochloride) is a non-thiol reducing agent that is more stable and produces a faster S-S reductive reaction than other chemical reductants. TCEP hydrochloride is a trialkylphosphine, selectively reduces protein disuldes without altering the properties or interacting with thiol-directed agents in the reaction mixture. TCEP hydrochloride is also a commonly used reducing agent in the DNA/AuNP chemistry[2][3][4][5].

HY-W700621

TCEP-d12 hydrochloride Tris(2-carboxyethyl)phosphine hydrochloride-d₁₂	Isotope-Labeled Compounds Others	Others
TCEP-d₁₂ (hydrochloride) (Tris(2-?carboxyethyl)?phosphine hydrochloride-d₁₂) is deuterium labeled TCEP (hydrochloride). TCEP hydrochloride (Tris(2-carboxyethyl)phosphine hydrochloride) is a non-thiol reducing agent that is more stable and produces a faster S-S reductive reaction than other chemical reductants. TCEP hydrochloride is a trialkylphosphine, selectively reduces protein disuldes without altering the properties or interacting with thiol-directed agents in the reaction mixture. TCEP hydrochloride is also a commonly used reducing agent in the DNA/AuNP chemistry .

HY-151799

P62-RNF168 agonist-1	p62 E1/E2/E3 Enzyme Apoptosis	Cancer
P62-RNF168 agonist-1 (compound 5a) is a low cytotoxicity P62-RNF168 agonist that enhances the interaction between P62 and RNF168. P62-RNF168 agonist-1 induces a reduction in H2A ubiquitination mediated by RNF168 and impairs homologous recombination-mediated DNA repair. P62-RNF168 agonist-1 also inhibits the growth of xenograft tumors in mice in a dose-dependent manner .

Cat. No.	Product Name	Type

HY-N0510A

Aristolochic acid sodium salt 5+ Cited Publications Aristolochic acid I sodium; TR 1736 sodium; Sodium aristolochate	Biochemical Assay Reagents
Aristolochic acid sodium salt (Sodium aristolate 1) is a component of some Chinese herbal medicines and is responsible for nephrotoxicity. It is a proagent that is activated by reduction of nitro groups to amines, resulting in the formation of cytotoxic DNA adducts.

Cat. No.	Product Name	Category	Target	Chemical Structure

HY-W011142

2'-Deoxyuridine 5'-monophosphate disodium	Natural Products Classification of Application Fields Source classification Metabolic Disease Endogenous metabolite Disease Research Fields	Endogenous Metabolite
2'-Deoxyuridine 5'-monophosphate disodium is reductively methylated to dTMP (2'-deoxythymidine 5'-monophosphate) by bisubstrate enzyme thymidylate synthase (TS). dTMP is a nucleotide required for DNA synthesis .

Cat. No.	Product Name	Chemical Structure

HY-W011500S

TCEP-d16 hydrochloride 1 Publications Verification
TCEP-d₁₆ (hydrochloride) is the deuterium labeled TCEP hydrochloride[1]. TCEP hydrochloride (Tris(2-carboxyethyl)phosphine hydrochloride) is a non-thiol reducing agent that is more stable and produces a faster S-S reductive reaction than other chemical reductants. TCEP hydrochloride is a trialkylphosphine, selectively reduces protein disuldes without altering the properties or interacting with thiol-directed agents in the reaction mixture. TCEP hydrochloride is also a commonly used reducing agent in the DNA/AuNP chemistry[2][3][4][5].

TCEP-d16 hydrochloride

1 Publications Verification

TCEP-d₁₆ (hydrochloride) is the deuterium labeled TCEP hydrochloride[1]. TCEP hydrochloride (Tris(2-carboxyethyl)phosphine hydrochloride) is a non-thiol reducing agent that is more stable and produces a faster S-S reductive reaction than other chemical reductants. TCEP hydrochloride is a trialkylphosphine, selectively reduces protein disuldes without altering the properties or interacting with thiol-directed agents in the reaction mixture. TCEP hydrochloride is also a commonly used reducing agent in the DNA/AuNP chemistry[2][3][4][5].

HY-W700621

TCEP-d12 hydrochloride
TCEP-d₁₂ (hydrochloride) (Tris(2-?carboxyethyl)?phosphine hydrochloride-d₁₂) is deuterium labeled TCEP (hydrochloride). TCEP hydrochloride (Tris(2-carboxyethyl)phosphine hydrochloride) is a non-thiol reducing agent that is more stable and produces a faster S-S reductive reaction than other chemical reductants. TCEP hydrochloride is a trialkylphosphine, selectively reduces protein disuldes without altering the properties or interacting with thiol-directed agents in the reaction mixture. TCEP hydrochloride is also a commonly used reducing agent in the DNA/AuNP chemistry .

TCEP-d12 hydrochloride

TCEP-d₁₂ (hydrochloride) (Tris(2-?carboxyethyl)?phosphine hydrochloride-d₁₂) is deuterium labeled TCEP (hydrochloride). TCEP hydrochloride (Tris(2-carboxyethyl)phosphine hydrochloride) is a non-thiol reducing agent that is more stable and produces a faster S-S reductive reaction than other chemical reductants. TCEP hydrochloride is a trialkylphosphine, selectively reduces protein disuldes without altering the properties or interacting with thiol-directed agents in the reaction mixture. TCEP hydrochloride is also a commonly used reducing agent in the DNA/AuNP chemistry .

Cat. No.	Product Name		Classification

HY-W011142

2'-Deoxyuridine 5'-monophosphate disodium		Nucleotides and their Analogs
2'-Deoxyuridine 5'-monophosphate disodium is reductively methylated to dTMP (2'-deoxythymidine 5'-monophosphate) by bisubstrate enzyme thymidylate synthase (TS). dTMP is a nucleotide required for DNA synthesis .

HY-147217A

Bepirovirsen sodium ISIS 505358 sodium		Antisense Oligonucleotides
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-147217

Bepirovirsen ISIS 505358		Antisense Oligonucleotides
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .

Inquiry Online

Your information is safe with us. * Required Fields.

MCE Japan Authorized Agent ナミキ商事株式会社コスモ・バイオ株式会社
Salutation			Country or Region *
Applicant Name *			Organization Name *
Department *
Email Address *			Product Name *
Cat. No.			Requested quantity *
Phone Number *
Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent:

Name
Email *

	Sorry, but the email address you supplied was invalid.

DNA reduction

Inhibitors & Agonists

Biochemical Assay Reagents

NaturalProducts

Isotope-Labeled Compounds

Oligonucleotides

Natural
Products