hsa-miR-34c-5p antagomir

Cat. No.: HY-RI00718A: FAQs
Data Sheet Handling Instructions

Molarity Calculator

hsa-miR-34c-5p antagomirs are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA antagomirs have 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 1 cholesterol group at the 3' end, and full-length nucleotide 2'-methoxy modification. The miRNA antagomirs strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Stability of miRNA antagomirs appears to be significantly higher than miRNA inhibitors, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

For research use only. We do not sell to patients.

RNA, (GCAAUCAGCUAACUACACUGC) (2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

hsa-miR-34c-5p antagomir Chemical Structure

Size	Price	Stock	Quantity
5 nmol	USD 225	Get quote 1-2 weeks 1-2 weeks 1-2 weeks	Estimated Time of Arrival: December 31
20 nmol	USD 450	Get quote 1-2 weeks 1-2 weeks 1-2 weeks	Estimated Time of Arrival: December 31

Synthetic products have potential research and development risk.

or Bulk Inquiry

* Please select Quantity before adding items.

This product is a controlled substance and not for sale in your territory.

Customer Review

Based on 1 publication(s) in Google Scholar

Other Forms of hsa-miR-34c-5p antagomir:

hsa-miR-34c-5p inhibitor Get quote

Featured Recommendations

•Related Small Molecules:

•Related Proteins:

Biological Activity
Purity & Documentation
Customer Review

Description	hsa-miR-34c-5p antagomirs are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA antagomirs have 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 1 cholesterol group at the 3' end, and full-length nucleotide 2'-methoxy modification. The miRNA antagomirs strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Stability of miRNA antagomirs appears to be significantly higher than miRNA inhibitors, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.
Molecular Weight	7653.00
miRBase Accession Number	MI0000743
Mature miRNA Sequence	AGGCAGUGUAGUUAGCUGAUUGC
Stem-loop ID	hsa-mir-34c
Stem-loop Sequence	AGUCUAGUUACUAGGCAGUGUAGUUAGCUGAUUGCUAAUAGUACCAAUCACUAACCACACGGCCAGGUAAAAAGAUU
Species	Human, Mouse, Rat, Callithrix jacchus, Chicken, Chrysemys picta, Columba livia, Cricetulus griseus, Dasypus novemcinctus, Dog, Goat, Guinea pig, Horse, Microcebus murinus, Monodelphis domestica, Nomascus leucogenys, Ornithorhynchus anatinus, Otolemur garnettii, Pan paniscus, Pig, Pongo pygmaeus, Pteropus alecto, Rabbit, Rhesus monkey, Taeniopygia guttata, Tupaia chinensis
Shipping	Room temperature in continental US; may vary elsewhere.
Storage	Please store the product under the recommended conditions in the Certificate of Analysis.
Purity & Documentation	Data Sheet (229 KB) Handling Instructions (2659 KB)