MicroRNA Agomir Negative Control

Cat. No.: HY-R04602A: FAQs
Data Sheet SDS COA Handling Instructions Technical Support

MicroRNA Agomir Negative Control is a chemically-modified double-strand miRNA mimic, and can be used as a negative control. The sequence of MicroRNA Agomir Negative Control is derived from cel-mir-239b. It has minimal sequence identity with miRNAs in human, mouse, and rat.

For research use only. We do not sell to patients.

RNA, (UUGUACUACACAAAAGUACUG), complex with RNA, (GUACUUUUGUGUAGUACAANN) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

MicroRNA Agomir Negative Control Chemical Structure

Size	Price	Stock	Quantity
5 nmol		Get quote 1-2 weeks 1-2 weeks 1-2 weeks	Estimated Time of Arrival: December 31
20 nmol		Get quote 1-2 weeks 1-2 weeks 1-2 weeks	Estimated Time of Arrival: December 31

Synthetic products have potential research and development risk.

or Bulk Inquiry

* Please select Quantity before adding items.

This product is a controlled substance and not for sale in your territory.

Customer Review

Based on 1 publication(s) in Google Scholar

Other Forms of MicroRNA Agomir Negative Control:

MicroRNA Mimic Negative Control Get quote

Featured Recommendations

•Related Small Molecules:

•Related Proteins:

Biological Activity
Purity & Documentation
Customer Review

Description	MicroRNA Agomir Negative Control is a chemically-modified double-strand miRNA mimic, and can be used as a negative control. The sequence of MicroRNA Agomir Negative Control is derived from cel-mir-239b. It has minimal sequence identity with miRNAs in human, mouse, and rat.
Molecular Weight	13973.44
miRBase Accession Number	MI0000315
Mature miRNA Sequence	UUUGUACUACACAAAAGUACUG
Stem-loop ID	cel-miR-239b
Stem-loop Sequence	GCGACAGAUGCAAUUUUUGUACUACACAAAAGUACUGGUCAUUUAAGUUGAGGCUCAGCACUUUUGUGGUGUGCAAAAAUGGCAAGUUGCUUUUAUCU
Species	Caenorhabditis elegans
Appearance	Solid
Color	White to off-white
SMILES	[MicroRNA Agomir Negative Control]
Shipping	Room temperature in continental US; may vary elsewhere.
Storage	-20°C, sealed storage, away from moisture *In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)
Purity & Documentation	Purity: 97.72% Select Batch: Data Sheet (237 KB) SDS (251 KB) COA (243 KB) RP-HPLC (220 KB) Handling Instructions (2659 KB)