MicroRNA Mimic Negative Control 

MicroRNA Mimic Negative Control is a miRNA mimic of 21-nucleotides, and can be used as a negative control. The sequence of MicroRNA Mimic Negative Control is derived from cel-mir-239b. It has minimal sequence identity with miRNAs in human, mouse, and rat.

1. miRNA Resuspension

1.1 Briefly centrifuge the tube to ensure that the dried miRNA is at the bottom of the tube.

1.2 Resuspend the miRNA using nuclease free water to generate 20 μM stock solution.

For 5 nmol miRNA: add 250 μL nuclease free water.

For 20 nmol miRNA: add 1000 μL nuclease free water.

1.3 Aliquot miRNAs into one or more tubes to limit the number of freeze-thaw cycles (<5).

1.4 Store at or below -20°C or -80°C in a non-frost-free freezer until use.

2. Prepare cells

2.1 Inoculate cells in advance for cell transfection. The viability and general health of cells prior to transfection significantly affect transfection result.

3. Transfection

3.1 Prepare transfection mix A and B.

For per well of a 6-well plate: A: 245 μL serum-free medium + 5 μL miRNA; B: 240 μL serum-free medium + 10 μL HY-K2017 siRNA/miRNA Transfection Reagent.

For per well of a 12-well plate: A: 97.5 μL serum-free medium + 2.5 μL miRNA; B: 121 μL serum-free medium + 4 μL HY-K2017 siRNA/miRNA Transfection Reagent.

For per well of a 24-well plate: A: 48.75 μL serum-free medium + 1.25 μL miRNA; B: 47.5 μL serum-free medium + 2.5 μL HY-K2017 siRNA/miRNA Transfection Reagent.

For per well of a 96-well plate: A: 24.75 μL serum-free medium + 0.25 μL miRNA; B: 24.5 μL serum-free medium + 0.5 μL HY-K2017 siRNA/miRNA Transfection Reagent.

Note: The recommended working concentration is 50nM for miRNA mimics. miRNA function can vary greatly, depending on the miRNA, the cell line, and the chosen analysis method. To determine the concentration that provides optimal results, optimization experiments using varying mimic/inhibitor concentrations should be performed. The optimized range suggests changing the miRNA concentration in the range of 10 to 200nM.

If other transfection reagents are used, the amount of transfection reagent needs to be adjusted according to the specific situation.

3.2 Mix A and B gently. Incubate at room temperature for 15 minutes.

3.3 Remove culture medium from cells, wash with PBS.

3.4 Add transfection mix (A+B) to cells.

For per well of a 6-well plate: add 1500 μL serum-free medium, then add 500 μL of the transfection mix (A+B) to the well, and mix well.

For per well of a 12-well plate: add 800 μL serum-free medium, then add 200 μL of the transfection mix (A+B) to the well, and mix well.

For per well of a 24-well plate: add 400 μL serum-free medium, then add 100 μL of the transfection mix (A+B) to the well, and mix well.

For per well of a 96-well plate: add 50 μL serum-free medium, then add 50 μL of the transfection mix (A+B) to the well, and mix well.

3.5 Incubate cells for 1–3 days at 37°C. Then, analyze transfected cells. The medium can be replaced with fresh serum-containing medium after 6 hours if necessary.

Note: Antibiotics can increase toxicity and should be omitted during transfection. Culture medium containing polyanions such as heparin, heparin sulfate or dextran sulfate can inhibit transfection.

MedChemExpress (MCE) has not independently confirmed the accuracy of these methods. They are for reference only.

13332.58

MI0000315

UUUGUACUACACAAAAGUACUG

cel-miR-239b

GCGACAGAUGCAAUUUUUGUACUACACAAAAGUACUGGUCAUUUAAGUUGAGGCUCAGCACUUUUGUGGUGUGCAAAAAUGGCAAGUUGCUUUUAUCU

Caenorhabditis elegans

Solid

White to off-white

[MicroRNA Mimic Negative Control]

Room temperature in continental US; may vary elsewhere.

-20°C, sealed storage, away from moisture

*In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)

• [1]. Xia W, Huang J, Sun C, Shen F, Yang K. MicroRNA‑1224 inhibits cell proliferation by downregulating CBX3 expression in chordoma. Oncol Lett. 2024;27(6):262.  [Content Brief]