MicroRNA Antagomir Negative Control

Cat. No.: HY-RI04602A Purity: 98.15%: FAQs
Data Sheet SDS COA Handling Instructions

Molarity Calculator

MicroRNA Antagomir Negative Control is a chemically-modified oligonucleotide (2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 1 cholesterol group at the 3' end, and full-length nucleotide 2'-methoxy modification), and can be used as a negative control. The sequence of MicroRNA Antagomir Negative Control is derived from cel-mir-239b. It has minimal sequence identity with miRNAs in human, mouse, and rat.

For research use only. We do not sell to patients.

RNA, (CAGUACUUUUGUGUAGUACAA) (2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

MicroRNA Antagomir Negative Control Chemical Structure

Size	Price	Stock	Quantity
5 nmol	USD 225	In-stock	Estimated Time of Arrival: December 31
20 nmol	USD 450	In-stock	Estimated Time of Arrival: December 31

or Bulk Inquiry

* Please select Quantity before adding items.

This product is a controlled substance and not for sale in your territory.

Featured Recommendations

•Related Small Molecules:

•Related Proteins:

Biological Activity
Purity & Documentation
Customer Review

Description	MicroRNA Antagomir Negative Control is a chemically-modified oligonucleotide (2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 1 cholesterol group at the 3' end, and full-length nucleotide 2'-methoxy modification), and can be used as a negative control. The sequence of MicroRNA Antagomir Negative Control is derived from cel-mir-239b. It has minimal sequence identity with miRNAs in human, mouse, and rat.
Molecular Weight	7540.89
miRBase Accession Number	MI0000315
Mature miRNA Sequence	UUUGUACUACACAAAAGUACUG
Stem-loop ID	cel-miR-239b
Stem-loop Sequence	GCGACAGAUGCAAUUUUUGUACUACACAAAAGUACUGGUCAUUUAAGUUGAGGCUCAGCACUUUUGUGGUGUGCAAAAAUGGCAAGUUGCUUUUAUCU
Species	Caenorhabditis elegans
Appearance	Solid
Color	White to off-white
SMILES	[MicroRNA Antagomir Negative Control]
Shipping	Room temperature in continental US; may vary elsewhere.
Storage	-20°C, sealed storage, away from moisture *In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)
Purity & Documentation	Purity: 98.61% Select Batch: Data Sheet (237 KB) SDS (251 KB) COA (242 KB) LCMS (361 KB) Handling Instructions (2659 KB)