mmu-miR-12189-3p agomir

Cat. No.: HY-R02608A: FAQs
Data Sheet Handling Instructions

Molarity Calculator

mmu-miR-12189-3p agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

For research use only. We do not sell to patients.

RNA, (AUGGCCUGUACUCUCACACU), complex with RNA, (UGUGAGAGUACAGGCCAUNN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

mmu-miR-12189-3p agomir Chemical Structure

Size	Price	Stock	Quantity
5 nmol	USD 225	Get quote 1-2 weeks 1-2 weeks 1-2 weeks	Estimated Time of Arrival: December 31
20 nmol	USD 450	Get quote 1-2 weeks 1-2 weeks 1-2 weeks	Estimated Time of Arrival: December 31

Synthetic products have potential research and development risk.

or Bulk Inquiry

* Please select Quantity before adding items.

This product is a controlled substance and not for sale in your territory.

Customer Review

Based on 1 publication(s) in Google Scholar

Other Forms of mmu-miR-12189-3p agomir:

mmu-miR-12189-3p mimic Get quote

Featured Recommendations

•Related Small Molecules:

•Related Proteins:

Biological Activity
Purity & Documentation
Customer Review

Description	mmu-miR-12189-3p agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.
Molecular Weight	13804.57
miRBase Accession Number	MI0040631
Mature miRNA Sequence	AUGGCCUGUACUCUCACACU
Stem-loop ID	mmu-mir-12189
Stem-loop Sequence	GUGUGACAUGGCAGUCGCCAUGGCCUUCCCCAGGACAUGGCCUGUACUCUCACACUA
Species	Mouse
Shipping	Room temperature in continental US; may vary elsewhere.
Storage	Please store the product under the recommended conditions in the Certificate of Analysis.
Purity & Documentation	Data Sheet (229 KB) Handling Instructions (2659 KB)