1. Signaling Pathways
  2. Neuronal Signaling
  3. Tau Protein
  4. Tau Protein Inhibitor

Tau Protein Inhibitor

Tau Protein Inhibitors (53):

Cat. No. Product Name Effect Purity
  • HY-10863
    Anandamide
    Inhibitor ≥99.0%
    Anandamide is an endocannabinoid. Anandamide modulates both neuronal and immune functions through two protein-coupled cannabinoid receptors (CB1 and CB2). Anandamide can activate numerous other receptors like PPARS, TRPV1, and GPR18/GPR55. Anandamide also has potential anti-fungal and anti-inflammatory activities. Anandamide can be used for the research of Alzheimer’s disease (AD) and ulcerative colitis.
  • HY-N1472
    Levistolide A
    Inhibitor 99.26%
    Levistolide A is an apoptosis inducer and a PEDV virus inhibitor. Levistolide A can induce apoptosis in colon cancer cells and suppress the replication of porcine epidemic diarrhea virus (PEDV) by promoting ROS generation. Levistolide A activates peroxisome proliferator-activated receptor γ (PPARγ) in N2a/APP695swe cells and reduces excessive phosphorylation of tau through the GSK3α/β pathway, improving symptoms in Alzheimer’s mice. Levistolide A improves kidney damage in 5/6 nephrectomy (Nx) mice by inhibiting the RAS,TGF-β1/Smad, and MAPK pathways.
  • HY-N2014
    Verbenalin
    Inhibitor 99.91%
    Verbenalin is an orally active terpenoid glycoside that can be extracted from the medicinal plant Verbena officinalis. Verbenalin has anti-inflammatory, antiviral, and neuroprotective effects. Verbenalin has a strong binding affinity to the nsp-12 protein of the SARS-CoV-2 virus. Verbenalin can be used in the research of inflammatory and nervous system diseases such as hepatitis and Alzheimer's disease.
  • HY-172544
    TTBK1/2-IN-3
    Inhibitor
    TTBK1/2-IN-3 (compound 10) is a potent Tau tubulin kinase 1 (TTBK1) and TTBK2 inhibitor with IC50s of 579 nM and 258 nM, respectively. TTBK1/2-IN-3 reduces the expression of primary cilia on the surface of human induced pluripotent stem cells (iPSCs).
  • HY-134968
    TTBK1-IN-1
    Inhibitor 99.53%
    TTBK1-IN-1 is a potent, selective and brain-penetrant tau tubulin kinase 1 (TTBK1) inhibitor with an IC50 of 2.7 nM. TTBK1-IN-1 can be used for the research of alzheimer’s disease and related tauopathies. TTBK1-IN-1 is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.
  • HY-P99399
    Semorinemab
    Inhibitor 99.90%
    Semorinemab (RG 6100) is an anti-Tau humanized IgG4 monoclonal antibody, targets the N-terminal portion of the Tau protein (amino acid residues 6-23). Semorinemab binds with human Tau with a Kd value of 3.8 nM. Semorinemab can be used for the research of Alzheimer's Disease.
  • HY-P99163
    Tilavonemab
    Inhibitor
    Tilavonemab (ABBV-8E12) is a humanized anti-tau antibody that targets the extracellular form of pathological tau protein aggregates by binding to the N-terminal 25-30 amino acid residues of tau protein. Tilavonemab blocks the ability of human and mouse neurons to take up tau aggregates, reduces the loss of brain volume, slows the progression of tau pathology, and improves cognitive abilities in transgenic mice expressing mutant human tau. Tilavonemab is used in Alzheimer's disease research.
  • HY-P99471
    Bepranemab
    Inhibitor 99.79%
    Bepranemab (UCB 0107) is a humanized, full-length IgG4 monoclonal antibody that binds to a central tau epitope (amino acids 235-250). Bepranemab can be used for Alzheimer’s disease (AD) research.
  • HY-132582C
    IONIS-MAPTRx sodium
    Inhibitor
    IONIS-MAPTRx sodium is the first Tau-lowering antisense oligonucleotide (ASO). IONIS-MAPTRx sodium has the potential for the research of Alzheimer Disease.
  • HY-156585
    CNS-11
    Inhibitor 98.88%
    CNS-11 is a blood-brain barrier permeable tau fibril-degrading compound. CNS-11 reduces α-synuclein. CNS-11 can be used in Alzheimer's and Parkinson's disease research.
  • HY-132582
    IONIS-MAPTRx
    Inhibitor
    IONIS-MAPTRx (BIIB080) is the first Tau-lowering antisense oligonucleotide (ASO). IONIS-MAPTRx has the potential for the research of Alzheimer Disease.
  • HY-154851
    GSK-3 inhibitor 3
    Inhibitor 98.72%
    GSK-3 inhibitor 3 is a selective, orally active and brain-penetrant inhibitor of GSK-3, with IC50s of 0.35 nM and 0.25 nM for GSK-3α and GSK-3β, respectively. GSK-3 inhibitor 3 lowers levels of tau protein phosphorylation at S396 in a triple-transgenic mouse Alzheimer’s disease model, with IC50 of 10 nM. GSK-3 inhibitor 3 can be used for neurological disease research.
  • HY-145313
    TTBK1-IN-2
    Inhibitor 99.91%
    TTBK1-IN-2 (compound 29) is a potent Tau-Tubulin kinase (TTBK1) inhibitor with IC50s of 0.24 and 4.22 µM, respectively. TTBK1-IN-2 reveals good brain penetration in vivo and is able to reduce TDP-43 phosphorylation not only in cell cultures but also in the spinal cord of transgenic TDP-43 mice.
  • HY-P99648
    Gosuranemab
    Inhibitor
    Gosuranemab (BMS-986168) is a humanised IgG4 anti-tau monoclonal antibody. Gosuranemab binds to human N-terminal tau residues 15-22. Gosuranemab has the potential for the research of alzheimer’s disease (AD).
  • HY-132582A
    Tau ASO-12 (murine) (sodium)
    Inhibitor
    TauASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (TauASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )
  • HY-19738
    NQTrp
    Inhibitor 98.37%
    NQTrp, an aromatic naphthoquinone-tryptophan hybrid molecule, an inhibitor of the aggregation of the tau protein with generic anti-amyloidogenic effects. NQTrp inhibits the in vitro aggregation of hexapeptide (41GCWMLY46 within the N-terminus of γD-crystallin) as well as full-length γD-crystallin.
  • HY-P9995
    Posdinemab
    Inhibitor ≥99.0%
    Posdinemab is a humanized IgG1κ antibody, targeting to microtubule-associated protein tau (MAPT).
  • HY-134968A
    (R)-TTBK1-IN-1
    Inhibitor 98.93%
    (R)-TTBK1-IN-1 is a potent, selective and brain-penetrant tau tubulin kinase 1 (TTBK1) inhibitor. (R)-TTBK1-IN-1 is an enantiomer of TTBK1-IN-1 (HY-134968). (R)-TTBK1-IN-1 can be used in the research of alzheimer’s disease and related tauopathies. (R)-TTBK1-IN-1 is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.
  • HY-105022
    Sabeluzole
    Inhibitor 99.82%
    Sabeluzole (R 58735), a benzothiazol derivative, has antiischemic, antiepileptic, and cognitive-enhancing properties. Sabeluzole protects rat hippocampal neurons against NMDA- and glutamate-induced neurotoxicity via preventing tau expression. Sabeluzole enhances memory in rats, and prevents the amnesic effect of Chlordiazepoxide. Sabeluzole can be used fro research of Alzheimer's disease.
  • HY-10863S
    Anandamide-d8
    Inhibitor 99.90%
    Anandamide-d8 is a deuterated labeled Anandamide. Anandamide is an endocannabinoid. Anandamide modulates both neuronal and immune functions through two protein-coupled cannabinoid receptors (CB1 and CB2). Anandamide can activate numerous other receptors like PPARS, TRPV1, and GPR18/GPR55. Anandamide also has potential anti-fungal and anti-inflammatory activities. Anandamide can be used for the research of Alzheimer’s disease (AD) and ulcerative colitis.