2. Epigenetics
  3. MicroRNA
  4. hsa-miR-9-5p antagomir

hsa-miR-9-5p antagomirs are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA antagomirs have 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 1 cholesterol group at the 3' end, and full-length nucleotide 2'-methoxy modification. The miRNA antagomirs strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Stability of miRNA antagomirs appears to be significantly higher than miRNA inhibitors, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

For research use only. We do not sell to patients.

RNA, (UCAUACAGCUAGAUAACCAAA) (2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

hsa-miR-9-5p antagomir Chemical Structure

Size Price Stock Quantity
5 nmol USD 225 Get quote 1-2 weeks 1-2 weeks 1-2 weeks
20 nmol USD 450 Get quote 1-2 weeks 1-2 weeks 1-2 weeks
Synthetic products have potential research and development risk.

* Please select Quantity before adding items.

This product is a controlled substance and not for sale in your territory.

Customer Review

Based on 1 publication(s) in Google Scholar

Other Forms of hsa-miR-9-5p antagomir:

hsa-miR-9-5p antagomir Related Antibodies

Top Publications Citing Use of Products

  • Biological Activity

  • Purity & Documentation

  • Customer Review

Description

hsa-miR-9-5p antagomirs are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA antagomirs have 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 1 cholesterol group at the 3' end, and full-length nucleotide 2'-methoxy modification. The miRNA antagomirs strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Stability of miRNA antagomirs appears to be significantly higher than miRNA inhibitors, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

Molecular Weight

7685.05

miRBase Accession Number
Mature miRNA Sequence

UCUUUGGUUAUCUAGCUGUAUGA

Stem-loop ID

hsa-mir-9-1

Stem-loop Sequence

CGGGGUUGGUUGUUAUCUUUGGUUAUCUAGCUGUAUGAGUGGUGUGGAGUCUUCAUAAAGCUAGAUAACCGAAAGUAAAAAUAACCCCA

Species

Human, Mouse, Rat, Drosophila melanogaster, Acyrthosiphon pisum, Aedes aegypti, Anopheles gambiae, Apis mellifera, Ascaris suum, Ateles geoffroyi, Bombyx mori, Branchiostoma belcheri, Callithrix jacchus, Capitella teleta, Chicken, Chrysemys picta, Columba livia, Daphnia pulex, Dasypus novemcinctus, Dinoponera quadriceps, Dog, Drosophila ananassae, Drosophila erecta, Drosophila grimshawi, Drosophila mojavensis, Drosophila persimilis, Drosophila pseudoobscura, Drosophila sechellia, Drosophila simulans, Drosophila virilis, Drosophila willistoni, Drosophila yakuba, Fugu rubripes, Gadus morhua, Goat, Gorilla gorilla, Guinea pig, Haemonchus contortus, Heligmosomoides polygyrus, Horse, Ictalurus punctatus, Lagothrix lagotricha, Locusta migratoria, Lottia gigantea, Macaca nemestrina, Melibe leonina, Metriaclima zebra, Monodelphis domestica, Nasonia giraulti, Nasonia longicornis, Nasonia vitripennis, Oryzias latipes, Pan troglodytes, Paralichthys olivaceus, Parasteatoda tepidariorum, Patiria miniata, Pig, Polistes canadensis, Pongo pygmaeus, Pteropus alecto, Rabbit, Rhesus monkey, Salmo salar, Taeniopygia guttata, Tetraodon nigroviridis, Triops cancriformis, Tupaia chinensis, Xenopus tropicalis, Zebrafish

Appearance

Solid

Color

White to off-white

Shipping

Room temperature in continental US; may vary elsewhere.
Storage

-20°C, sealed storage, away from moisture

*In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)

Purity & Documentation
  • No file chosen (Maximum size is: 1024 Kb)
  • If you have published this work, please enter the PubMed ID.
  • Your name will appear on the site.

hsa-miR-9-5p antagomir Related Classifications

  • Molarity Calculator

  • Dilution Calculator

The molarity calculator equation

Mass (g) = Concentration (mol/L) × Volume (L) × Molecular Weight (g/mol)

Mass   Concentration   Volume   Molecular Weight *
= × ×

The dilution calculator equation

Concentration (start) × Volume (start) = Concentration (final) × Volume (final)

This equation is commonly abbreviated as: C1V1 = C2V2

Concentration (start) × Volume (start) = Concentration (final) × Volume (final)
× = ×
C1   V1   C2   V2
Help & FAQs
  • Do most proteins show cross-species activity?

    Species cross-reactivity must be investigated individually for each product. Many human cytokines will produce a nice response in mouse cell lines, and many mouse proteins will show activity on human cells. Other proteins may have a lower specific activity when used in the opposite species.

Keywords:

hsa-miR-9-5p antagomirMicroRNAmiRNAInhibitorinhibitorinhibit

Your Recently Viewed Products:

Inquiry Online

Your information is safe with us. * Required Fields.

Product Name

  

Salutation

Applicant Name *

 

Email Address *

Phone Number *

 

Organization Name *

Department *

 

Requested quantity *

Country or Region *

      

Remarks

Bulk Inquiry

Inquiry Information

Product Name:
hsa-miR-9-5p antagomir
Cat. No.:
HY-RI02536A
Quantity:
MCE Japan Authorized Agent:

Customer Review

Thank You for Your Feedback!

Request for HNMR Report

Please fill out this form to request the QC report. We will send it to your Email address shortly.

Your information is safe with us. * Required Fields.

Product Name

  

Lot #

Applicant Name *

 

Email Address *

Phone Number

 

Department *

Organization Name *

 

Country or Region *

Remarks

SAFETY DATA SHEET (SDS)

English - EN (252 KB) Français - FR (252 KB) Deutsch - DE (252 KB) Norwegian - NO (252 KB) Español - ES (252 KB) Swedish - SV (252 KB)

Request for HNMR Report

We have received your request and will respond to you as soon as possible.