1. Epigenetics
  2. MicroRNA
  3. mmu-miR-207 antagomir

mmu-miR-207 antagomirs are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA antagomirs have 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 1 cholesterol group at the 3' end, and full-length nucleotide 2'-methoxy modification. The miRNA antagomirs strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Stability of miRNA antagomirs appears to be significantly higher than miRNA inhibitors, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

For research use only. We do not sell to patients.

RNA, (GAGGGAGGAGAGCCAGGAGAA) (2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

mmu-miR-207 antagomir Chemical Structure

Size Price Stock Quantity
5 nmol Get quote 1-2 weeks 1-2 weeks 1-2 weeks
20 nmol Get quote 1-2 weeks 1-2 weeks 1-2 weeks
Synthetic products have potential research and development risk.

* Please select Quantity before adding items.

This product is a controlled substance and not for sale in your territory.

Customer Review

Based on 1 publication(s) in Google Scholar

Other Forms of mmu-miR-207 antagomir:

Top Publications Citing Use of Products
  • Biological Activity

  • Purity & Documentation

  • Customer Review

Description

mmu-miR-207 antagomirs are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA antagomirs have 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 1 cholesterol group at the 3' end, and full-length nucleotide 2'-methoxy modification. The miRNA antagomirs strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Stability of miRNA antagomirs appears to be significantly higher than miRNA inhibitors, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

Molecular Weight

7993.28

miRBase Accession Number
Mature miRNA Sequence

GCUUCUCCUGGCUCUCCUCCCUC

Stem-loop ID

mmu-mir-207

Stem-loop Sequence

AAGGCAGGGGUGAGGGGCUGCGGGAGGAGCCGGGCGGAGGCUGCGGCUUGCGCUUCUCCUGGCUCUCCUCCCUCUCUUU

Species

Mouse

Shipping

Room temperature in continental US; may vary elsewhere.

Storage

Please store the product under the recommended conditions in the Certificate of Analysis.

Purity & Documentation
  • No file chosen (Maximum size is: 1024 Kb)
  • If you have published this work, please enter the PubMed ID.
  • Your name will appear on the site.
  • Molarity Calculator

  • Dilution Calculator

The molarity calculator equation

Mass (g) = Concentration (mol/L) × Volume (L) × Molecular Weight (g/mol)

Mass   Concentration   Volume   Molecular Weight *
= × ×

The dilution calculator equation

Concentration (start) × Volume (start) = Concentration (final) × Volume (final)

This equation is commonly abbreviated as: C1V1 = C2V2

Concentration (start) × Volume (start) = Concentration (final) × Volume (final)
× = ×
C1   V1   C2   V2
Help & FAQs
  • Do most proteins show cross-species activity?

    Species cross-reactivity must be investigated individually for each product. Many human cytokines will produce a nice response in mouse cell lines, and many mouse proteins will show activity on human cells. Other proteins may have a lower specific activity when used in the opposite species.

Your Recently Viewed Products:

Inquiry Online

Your information is safe with us. * Required Fields.

Product Name

 

Requested Quantity *

Applicant Name *

 

Salutation

Email Address *

 

Phone Number *

Department

 

Organization Name *

City

State

Country or Region *

     

Remarks

Bulk Inquiry

Inquiry Information

Product Name:
mmu-miR-207 antagomir
Cat. No.:
HY-RI02819A
Quantity:
MCE Japan Authorized Agent: