HBV

Hepatitis B virus

HBV

Related Products

HBV (Hepatitis B virus), abbreviated HBV, is a species of the genus Orthohepadnavirus, which is likewise a part of the Hepadnaviridae family of viruses. HBV causes the disease hepatitis B. The hepatitis B virus is classified as the type species of the Orthohepadnavirus, which contains three other species: the Ground squirrel hepatitis virus, Woodchuck hepatitis virus, and theWoolly monkey hepatitis B virus. The genus is classified as part of the Hepadnaviridae family. HBV is divided into four major serotypes (adr, adw, ayr, ayw) based on antigenic epitopes present on its envelope proteins, and into eight genotypes (A–H) according to overall nucleotide sequence variation of the genome. The genotypes have a distinct geographical distribution and are used in tracing the evolution and transmission of the virus. Differences between genotypes affect the disease severity, course and likelihood of complications, and response to treatment and possibly vaccination.

HBV Related Products (287)
Antibodies (2)

By Effects:	Controls (3) Inhibitors (259) Activators (4) Modulators (2)

Cat. No.	Product Name	Effect	Purity	Chemical Structure

HY-Y0073

4-Hydroxyacetophenone	Inhibitor	99.99%
4-Hydroxyacetophenone (P-hydroxyacetophenone) is a major hepatoprotective and choleretic compound found in Artemisia and Illicium plants, exhibiting antiviral and anti-inflammatory effects against hepatitis B virus. Additionally, 4-Hydroxyacetophenone inhibits cancer cell adhesion, invasion, and migration by remodeling actin. 4-Hydroxyacetophenone holds promise for research in the fields of inflammatory diseases and cancer.

HY-16468

Squalamine	Inhibitor	99.54%
Squalamine (MSI-1256) is an aminosterol compound with broad-spectrum antiviral activity. Squalamine makes cells less conducive to certain viral replication by altering the electrostatic interactions in the inner membrane of host cells. Squalamine also has antibacterial and antitumor activities. Squalamine has broad-spectrum antibacterial activity against Gram-negative and Gram-positive bacteria, fungi and protozoa. Squalamine inhibits tumor-related angiogenesis and the growth of human breast cancer cells. Squalamine restores the function of enteric nervous system in Parkinson^,s disease mouse models.

HY-109168

Bersacapavir	Inhibitor	99.24%
Bersacapavir is a novel Hepatitis B Virus capsid assembly modulator.

HY-138407

Evixapodlin	Inhibitor	98.14%
Evixapodlin (GS-4224) is a human PD-1/PD-L1 protein/protein interaction inhibitor with an IC₅₀ of 0.213 nM. Evixapodlin has anticancer and antiviral functions.

HY-147217

Bepirovirsen	Inhibitor	98.44%
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).

HY-B0955

Oxethazaine	Inhibitor	99.94%
Oxethazaine (Oxetacaine), a precursor of phentermine?acidic, is an acid-resistent and orally active analgesic agent. Oxethazaine (Oxetacaine) has the potential for the relief of pain associated with?peptic ulcer disease?or?esophagitis.

HY-N2189

Swertisin	Inhibitor	99.75%
Swertisin is an oral adenosine A1 receptor antagonist and an SGLT2 inhibitor. Swertisin has anti-diabetic, antioxidant properties, inhibits HBV, and improves cognitive and memory impairments in mice.

HY-131596B

Emtricitabine triphosphate tetrasodium salt	Inhibitor	99.06%
Emtricitabine triphosphate tetrasodium salt is the tetrasodium salt form of Emtricitabine triphosphate (HY-131596). However，Emtricitabine triphosphate ((-)-Emtricitabine triphosphate) is the phosphorylated anabolite of Emtricitabine (HY-17427)，a nucleoside reverse transcriptase inhibitor，targeting to HIV and HBV.

HY-124600

NVR 3-778	Inhibitor	99.88%
NVR 3-778 is a first-in-Class and oral bioavailable HBV CAM (capsid assembly modulator) belonging to the SBA (sulfamoylbenzamide) class, with anti-HBV activity.

HY-147255

Canocapavir	Inhibitor	98.40%
Canocapavir (ZM-H1505R) has orally antiviral activity. Canocapavir is a HBV capsid inhibitor that can be used in the research of Chronic hepatitis B. .

HY-17426

Famciclovir	Inhibitor	99.69%
Famciclovir (BRL 42810) is an orally active nucleoside analogue. Famciclovir is an antiviral agent with potent activities against HBV, HSV and VZV. Famciclovir can be used for the research of herpesvirus infection.

HY-109197

Vonafexor	Inhibitor	99.32%
Vonafexor (EYP001) is an orally active, non-steroidal and selective FXR agonist. Vonafexor shows significant HBsAg reduction when combined with Peg-IFNα. Vonafexor can be used for anti-HBV research.

HY-100029

Bay 41-4109	Inhibitor	99.24%
BAY 41-4109 is a potent inhibitor of human hepatitis B virus (HBV) with an IC₅₀ of 53 nM.

HY-13859

Clevudine	Inhibitor	99.93%
Clevudine (L-FMAU), a nucleoside analog of the unnatural L-configuration, has potent anti-HBV activity with long half-life, low toxicity. Clevudine is a non-competitive inhibitor that is not incorporated into the viral DNA but rather binds to the polymerase. Clevudine is active against cowpox virus respiratory infection in mice.

HY-10545A

Taribavirin hydrochloride	Inhibitor	99.96%
Taribavirin hydrochloride is an orally active inosine monophosphate dehydrogenase inhibitor, has activity against a wide range of viruses, especially the hepatitis C virus and influenza virus. Taribavirin hydrochloride is a Ribavirin proagent, is designed to concentrate within the liver to target HCV-infected hepatocytes while minimizing distribution within red blood cells (RBCs) and the development of hemolytic anemia.

HY-147266

Elebsiran sodium	Inhibitor
Elebsiran sodium is a siRNA against hepatitis B and D virus infections .

HY-148560A

trans-ccc_R08	Inhibitor	99.71%
trans-ccc_R08 (compound 1-B) is a potent cccDNA (covalently closed circular DMA) inhibitor. trans-ccc_R08 inhibits HBeAg level with an IC₅₀ value of 0.08 µM. trans-ccc_R08 has the potential for the research of Hepatitis B Virus infection (HBV).

HY-109195

Vebicorvir	Inhibitor	99.73%
Vebicorvir (ABI-H0731) is a first-generation hepatitis B virus (HBV) core protein inhibitor. Vebicorvir (ABI-H0731) suppresses covalently closed circular DNA (cccDNA) formation in two de novo infection models with EC₅₀s from 1.84 μM to 7.3 μM.

HY-124614

GLP-26	Inhibitor	98.36%
GLP-26 is a HBV capsid assembly modulators (CAM), inhibits HBV DNA replication in Hep AD38 system (IC₅₀=3 nM), and reduces cccDNA by >90% at 1 μM. GLP-26 disrupts the encapsidation of pre-genomic RNA, causes nucleocapsid disassembly and reduces cccDNA pools. GLP-26 is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.

HY-153797

Dox-btn2	Activator
Dox-btn2 is a biotinylated derivative of Doxorubicin (HY-15142A), with a biotin label at the point of conjugation to doxorubicin at 3'-NH₂. Dox-btn2 can be used for cell imaging. While Doxorubicin is mainly accumulated in the nucleus, while Dox-btn2 is mainly located in the cytoplasm.

Name
Email *

	Sorry, but the email address you supplied was invalid.

HBV

HBV

HBV Related Products (287)

Antibodies (2)

HBV Related Products (287):