1. Search Result
Search Result
Pathways Recommended: Cell Cycle/DNA Damage
Results for "

DNA sequence

" in MedChemExpress (MCE) Product Catalog:

58

Inhibitors & Agonists

2

Screening Libraries

1

Fluorescent Dye

1

Biochemical Assay Reagents

18

Peptides

5

Natural
Products

1

Antibodies

11

Oligonucleotides

Cat. No. Product Name Target Research Areas Chemical Structure
  • HY-107769
    Duocarmycin TM
    1 Publications Verification

    CBI-TMI

    ADC Cytotoxin DNA Alkylator/Crosslinker Antibiotic Cancer
    Duocarmycin TM (CBI-TMI) is a potent antitumor antibiotic. Duocarmycin TM induces a sequence-selective alkylation of duplex DNA.
    Duocarmycin TM
  • HY-D1180

    3,3′-Diethylthiatricarbocyanine iodide

    Fluorescent Dye Others
    DTTCI (3,3′-Diethylthiatricarbocyanine iodide) is an infrared photographic sensitizing dye. DTTCI is a highly sensitive chiroptical reporter of DNA helicity and sequence .
    DTTCI
  • HY-N6181

    Others Endocrinology
    Terrelumamide A is a lumazine-containing peptide. Terrelumamide A is isolated from the culture broth of the marine-derived fungus Aspergillus terreus. Terrelumamide A exhibits pharmacological activity by improving insulin sensitivity. Terrelumamide A has the potential in the application of DNA sequence recognition .
    Terrelumamide A
  • HY-E70212

    Hhal

    DNA Methyltransferase Cancer
    Hhal Methyltransferase (Hhal) is a DNA methyltransferase (recognition sequence: GCGC) .
    Hhal Methyltransferase
  • HY-E70401

    Biochemical Assay Reagents Others
    Golden Taq DNA Polymerase is a thermostable enzyme that can be used in molecular biology to amplify DNA sequences through the polymerase chain reaction (PCR) .
    Golden Taq DNA Polymerase
  • HY-157001

    Others Others
    7-Deaza-dGTP tetralithium can be used for amplification of GC-rich DNA sequences .
    7-Deaza-dGTP tetralithium
  • HY-E70402

    Biochemical Assay Reagents Others
    that can be used in molecular biology to amplify DNA sequences through the polymerase chain reaction (PCR) .
    Double-block Hotstart Taq DNA Polymerase
  • HY-E70209

    DNA Methyltransferase Cancer
    EcoRI Methyltransferase is a bacterial sequence-specific S-adenosyl-L-methionine-dependent DNA methyltransferase. EcoRI Methyltransferase relies on a complex conformational mechanism to achieve its remarkable specificity, including DNA bending, base flipping and intercalation into the DNA .
    EcoRI Methyltransferase
  • HY-P5343

    p53 Consensus binding sequence

    MDM-2/p53 Others
    p53 CBS (p53 Consensus binding sequence) is a biological active peptide. (p53 consensus DNA binding site)
    p53 CBS
  • HY-160226

    STING Inflammation/Immunology
    ISD (interferon stimulatory DNA) Control sodium is a non-immunostimulatory single-stranded oligonucleotide with the same sequence as ISD, its double-stranded counterpart .
    ISD Control sodium
  • HY-101160

    DRG16

    DNA Alkylator/Crosslinker ADC Cytotoxin Cancer
    SG2057 (DRG16) is a PBD dimer containing a pentyldioxy linkage which binds sequence selectively in the minor groove of DNA forming DNA interstrand and intrastrand cross-linked adducts. SG2057 is a highly active antitumor agent .
    SG2057
  • HY-147740

    DNA Alkylator/Crosslinker Cancer
    WEHI-150 is a replica of mitoxantrone, is a portent DNA interstrand crosslinksequences and exhibits a preference for methylated CpG sites. Formaldehyde-activated WEHI-150 induces DNA interstrand crosslinks. Formaldehyde-activated WEHI-150 shows Concentration-dependent transcription blockages. WEHI-150 can mediate covalent adducts that are independent of interactions with the N-2 of guanine and is capable of adduct formation at novel DNA sequences .
    WEHI-150
  • HY-155869A

    5-Fluoro-2′-deoxycytidine 5′-triphosphate sodium

    DNA/RNA Synthesis Others
    5-fluoro-dCTP sodium is a fluorinated pyrimidine dNTP that can be used as a substrate for the incorporation of fluorine modification into specific DNA sequences by primer extension (PEX) catalyzed by Pwo polymerase .
    5-fluoro-dCTP sodium
  • HY-155869

    5-Fluoro-2′-deoxycytidine 5′-triphosphate

    DNA/RNA Synthesis Others
    5-fluoro-dCTP is a fluorinated pyrimidine dNTP that can be used as a substrate for the incorporation of fluorine modification into specific DNA sequences by primer extension (PEX) catalyzed by Pwo polymerase .
    5-fluoro-dCTP
  • HY-153916

    T417

    Others Neurological Disease Inflammation/Immunology Cancer
    TCRS-417 (T417) is a small molecule compound capable of docking to the interface between PBX1 and its cognate DNA target sequence, effectively interfering with PBX1-DNA interaction. TCRS-417 can be used in the research of cancer, developmental disorders, inflammatory disorders, autoimmune diseases or neurodegenerative diseases .
    TCRS-417
  • HY-112951
    ChX710
    2 Publications Verification

    STING Cancer
    ChX710 could prime the type I interferon response to cytosolic DNA, which induces the ISRE promoter sequence, specific cellular Interferon-Stimulated Genes (ISGs), and the phosphorylation of Interferon Regulatory Factor (IRF) 3.
    ChX710
  • HY-12455

    ADC Cytotoxin Apoptosis Caspase Cancer
    Duocarmycin A, which is one of well-known antitumor antibiotics, is a DNA alkylator and efficiently alkylates adenine N3 at the 3′ end of AT-rich sequences in the DNA. Duocarmycin A, as a chemotherapeutic agent, results HLC-2 cells typically apoptotic changes, including chromatin condensation, sub-G1 accumulation in DNA histogram pattern, and decrease in procaspase-3 and 9 levels .
    Duocarmycin A
  • HY-160728

    3′-O-Azidomethyl dATP

    Biochemical Assay Reagents Others
    3′-O-N3-dATP (3′-O-Azidomethyl dATP) is a modified nucleotide, which is utilized for DNA polymerase. 3′-O-N3-dATP acts as reversible terminator with enhanced raman scattering (SERS) at 2125 cm -1, which determines the DNA sequences continuously .
    3′-O-N3-dATP
  • HY-153494

    PNT100

    Bcl-2 Family Cancer
    PNT100 is a 24-base, chemically unmodified DNA oligonucleotide sequence that is complementary to the regulatory region upstream of the BCL-2 gene. Exposure of tumor cells to PNT100 results in suppression of proliferation and cell death.
    Rosomidnar
  • HY-153494A

    PNT100 sodium

    Bcl-2 Family Cancer
    PNT100 sodium is a 24-base, chemically unmodified DNA oligonucleotide sequence that is complementary to the regulatory region upstream of the BCL-2 gene. Exposure of tumor cells to PNT100 results in suppression of proliferation and cell death.
    Rosomidnar sodium
  • HY-150729

    Toll-like Receptor (TLR) Inflammation/Immunology
    ODN 1982 is a unmethylated oligodeoxyribonucleotide (ODN) with no CpG motif, can be used to prepare DNA vaccines. ODN 1982 inhibits R-848 signaling. ODN 1982 sequence: 5’-tccaggacttctctcaggtt-3’ .
    ODN 1982
  • HY-W040129
    Chromomycin A3
    1 Publications Verification

    Bacterial Fungal Apoptosis Antibiotic Infection Cancer
    Chromomycin A3 is an aureolic acid-type antitumor antibiotic. Chromomycin A3 forms dimeric complexes with divalent cations, such as Mg 2+, which strongly binds to the GC rich sequence of DNA to inhibit DNA replication and transcription. Chromomycin A3 has a variety of utilities as a staining agent for human sperm chromatin, autophagy inducing agent, and apoptosis inhibitor .
    Chromomycin A3
  • HY-100758
    FUBP1-IN-1
    2 Publications Verification

    Others Cancer
    FUBP1-IN-1 is a potent FUSE binding protein 1 (FUBP1) inhibitor which interferes with the binding of FUBP1 to its single stranded target DNA FUSE sequence , with an IC50 value of 11.0 μM .
    FUBP1-IN-1
  • HY-P1310
    VKGILS-NH2
    1 Publications Verification

    Protease Activated Receptor (PAR) Inflammation/Immunology
    VKGILS-NH2 is a reversed amino acid sequence control peptide for SLIGKV-NH2 (protease-activated receptor 2 (PAR2) agonist). VKGILS-NH2 has no effect on DNA synthesis in cells .
    VKGILS-NH2
  • HY-147217

    ISIS 505358

    HBV Infection
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen
  • HY-W001952

    Fluorescent Dye Others
    6-Bromo-2-naphthol is an RTP (real-time polymerase chain reaction) probe capable of real-time monitoring of PCR reactions and quantification of specific nucleic acid sequences. 6-Bromo-2-naphthol phosphoresces at room temperature. RTP probes are a type of small DNA or RNA sequence labeled with fluorescent dyes and quencher molecules and can be widely used for gene expression analysis, SNP genotyping and pathogen detection .
    6-Bromo-2-naphthol
  • HY-148424

    ADC Cytotoxin Cancer
    PBD dimer-2 (compound 2c) is a C8-linked pyrrolobenzodiazepine dimer. PBD dimer-2 can span an extra base pair and cross-link the 5′-Pu-GA(T/A)TC-Py sequence. PBD dimer-2 can be used as a payload for antibody–agent conjugates (ADCs), and it can be used for the research of cancer .
    PBD dimer-2
  • HY-P1310A

    Protease Activated Receptor (PAR) Inflammation/Immunology
    VKGILS-NH2 TFA is a reversed amino acid sequence control peptide for SLIGKV-NH2 (protease-activated receptor 2 (PAR2) agonist). VKGILS-NH2 TFA has no effect on DNA synthesis in cells .
    VKGILS-NH2 TFA
  • HY-400705

    Antibiotic Cancer
    Duocarmycin SA intermediate-1 is an intermediate in the synthesis of the antibiotic Duocarmycin SA (HY-12456). Duocarmycin SA intermediate-1 induces sequence-selective alkylation of double-stranded DNA and has synergistic, tumor-suppressive cytotoxicity with proton irradiation .
    Duocarmycin SA intermediate-1
  • HY-400706

    Antibiotic Cancer
    Duocarmycin SA intermediate-2 is an intermediate in the synthesis of the antibiotic Duocarmycin SA (HY-12456). Duocarmycin SA intermediate-2 induces sequence-selective alkylation of double-stranded DNA and has synergistic, tumor suppressor cytotoxicity with proton irradiation .
    Duocarmycin SA intermediate-2
  • HY-147217A

    ISIS 505358 sodium

    HBV Infection
    Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen sodium
  • HY-E70371

    Biochemical Assay Reagents Others
    Cre recombinase is a resolvase derived from the P1 bacteriophage. Cre recombinase catalyzes site-specific recombination between two loxP DNA sequences, converts dimers of P1 chromosome into monomers before cell division. Cre recombinase is utilized in genetic engineering and molecular biology applications .
    Cre recombinase
  • HY-12456

    Antibiotic ADC Cytotoxin DNA Alkylator/Crosslinker Necroptosis Apoptosis Cancer
    Duocarmycin SA is an orally active antitumor antibiotic with an IC50 of 10 pM . Duocarmycin SA is an extremely potent cytotoxic agent capable of inducing a sequence-selective alkylation of duplex DNA. Duocarmycin SA demonstrates synergistic cytotoxicity against glioblastoma multiforme (GBM) cells treated with proton radiation in vitro .
    Duocarmycin SA
  • HY-P1286

    PKC Neurological Disease
    PKC β pseudosubstrate is a selective cell-permeable inhibitor of PKC .
    PKC β pseudosubstrate
  • HY-P1286A

    PKC Neurological Disease
    PKC β pseudosubstrate TFA is a selective cell-permeable inhibitor of PKC .
    PKC β pseudosubstrate TFA
  • HY-13642
    RG108
    Maximum Cited Publications
    9 Publications Verification

    N-Phthalyl-L-tryptophan

    DNA Methyltransferase Cancer
    RG108 (N-Phthalyl-L-tryptophan) is a non-nucleoside DNA methyltransferases (DNMTs) inhibitor (IC50=115 nM) that blocks the DNMTs active site. RG108 (N-Phthalyl-L-tryptophan) causes demethylation and reactivation of tumor suppressor genes, but it does not affect the methylation of centromeric satellite sequences .
    RG108
  • HY-W591768

    Fluorescent Dye Others
    (E)-4-(4-(Dimethylamino)styryl)-1-methylpyridin-1-ium (iodide) (Py-NMe2) is a styryl-based dye for fluorescence and CD-based sensing of various ds-DNA/RNA sequence. ( maxλAbs = 450 nm, maxλEm = 615 nm) .
    (E)-4-(4-(Dimethylamino)styryl)-1-methylpyridin-1-ium iodide
  • HY-E70090

    DNA/RNA Synthesis Others
    T7 RNA polymerase is a polymerase expressed by Escherichia coli from the RNA polymerase gene of T7 bacteriophage. T7 RNA polymerase is highly specific and involved in in vitro transcription (IVT) of mRNA. In the presence of Mg 2+, T7 RNA polymerase only uses the single-stranded or double-stranded DNA containing the T7 promoter sequence as a template, and uses NTP as a substrate to synthesize RNA complementary to the single-stranded DNA downstream of the promoter .
    T7 RNA polymerase
  • HY-W010970
    5'-Guanylic acid disodium salt
    1 Publications Verification

    5'-GMP disodium salt; 5'-guanosine monophosphate disodium salt

    Endogenous Metabolite Others
    5'-Guanylic acid disodium salt (5'-GMP disodium salt) is composed of guanine, ribose, and phosphate moieties and it is a nucleotide monomer in messenger RNA. Guanosine derivatives are involved in intracellular signal transduction and have been identified in repetitive genomic sequences in telomeres, in ribosomal DNA, immunoglobulin heavy‐chain switch regions, and in the control regions of proto-oncogenes .
    5'-Guanylic acid disodium salt
  • HY-135900

    ADC Cytotoxin Bacterial Cancer
    Aniline-MPB-amino-C3-PBD is a cytotoxic agent comprised non-alkylating group. Aniline-MPB-amino-C3-PBD is a sequence-selective DNA minor-groove binding agent. Aniline-MPB-amino-C3-PBD acts as the payload for ADCs. Antimicrobial activity .
    Aniline-MPB-amino-C3-PBD
  • HY-W406070

    LNA-G

    Nucleoside Antimetabolite/Analog DNA/RNA Synthesis Others
    2′-O,4′-C-Methyleneguanosine (LNA-G) is a reverse guanine analogue, where LNA (locked nucleic acid) is a nucleic acid analogue. LNA modification can be used in a variety of applications such as effective binding affinity to complementary sequences and greater nuclease resistance than natural nucleotides, offering great potential for applications in disease diagnosis and research. LNA-G is also available via KOD DNA polymerase, which allows the integration of LNA-G nucleotides into the DNA strand .
    2'-O,4'-C-Methyleneguanosine
  • HY-160728A

    3′-O-Azidomethyl dATP trisodium

    Biochemical Assay Reagents Others
    3′-O-N3-dATP trisodium (3′-O-Azidomethyl dATP trisodium) is the trisodium salt form of 3′-O-N3-dATP. 3′-O-N3-dATP trisodium is a modified nucleotide, which is utilized for DNA polymerase. 3′-O-N3-dATP trisodium acts as reversible terminator with enhanced raman scattering (SERS) at 2125 cm -1, which determines the DNA sequences continuously .
    3′-O-N3-dATP trisodium
  • HY-107767

    DC 81

    Antibiotic Apoptosis DNA/RNA Synthesis Cancer
    Antibiotic DC 81 (DC 81), an antitumor antibiotic produced by Streptomyces species, is a PBD (pyrrolo[2,1-c][1,4]benzodiazepine). Antibiotic DC 81 is potent inhibitor of nucleic acid synthesis. Antibiotic DC 81 can recognize and bind to specific sequences of DNA and form a labile covalent adduct .
    Antibiotic DC 81
  • HY-132243

    Nuclear Factor of activated T Cells (NFAT) Inflammation/Immunology
    NFAT Inhibitor-3 (Compound 10) is a factor nuclear factor of activated T cells (NFAT) inhibitor. NFAT Inhibitor-3 inhibits IL-2 production. NFAT Inhibitor-3 binds in a sequence-selective manner directly to DNA. NFAT Inhibitor-3 can be used for the research of transcription factor dysregulation .
    NFAT Inhibitor-3
  • HY-130670

    GABA Receptor Neurological Disease
    CGP 54626A (free base) is a GABAB receptor modulator, which is essential in the central and peripheral nervous systems. It is used as a tool to identify and characterize GABAB receptor agonists and antagonists, which will aid in the development of drugs targeting diseases related to these systems. This discovery involves purified GABAB receptors, receptor proteins and their encoding nucleic acids, facilitating the study of new members of the GABAB receptor family through DNA cloning technology and sequence-derived probes .
    CGP 54626A free base
  • HY-W010970R

    Endogenous Metabolite Others
    5'-Guanylic acid (disodium salt) (Standard) is the analytical standard of 5'-Guanylic acid (disodium salt). This product is intended for research and analytical applications. 5'-Guanylic acid disodium salt (5'-GMP disodium salt) is composed of guanine, ribose, and phosphate moieties and it is a nucleotide monomer in messenger RNA. Guanosine derivatives are involved in intracellular signal transduction and have been identified in repetitive genomic sequences in telomeres, in ribosomal DNA, immunoglobulin heavy‐chain switch regions, and in the control regions of proto-oncogenes .
    5'-Guanylic acid (disodium salt) (Standard)
  • HY-E70400

    DNA/RNA Synthesis Others
    Thermostable T7 RNA Polymerase is a thermostable version of T7 RNA Polymerase (HY-E70090). Compared with T7 RNA Polymerase, it has high temperature resistance and stable activity. T7 RNA polymerase is a polymerase expressed by Escherichia coli from the RNA polymerase gene of T7 bacteriophage. T7 RNA polymerase is highly specific and involved in in vitro transcription (IVT) of mRNA. In the presence of Mg 2+, T7 RNA polymerase only uses the single-stranded or double-stranded DNA containing the T7 promoter sequence as a template, and uses NTP as a substrate to synthesize RNA complementary to the single-stranded DNA downstream of the promoter .
    Thermostable T7 RNA Polymerase
  • HY-106262

    KAI-9803; BMS-875944

    PKC Cardiovascular Disease Inflammation/Immunology
    Delcasertib (KAI-9803) is a potent and selective δ-protein kinase C (δPKC) inhibitor. Delcasertib (KAI-9803) could ameliorate injury associated with ischemia and reperfusion in animal models of acute myocardial infarction (MI) .
    Delcasertib
  • HY-106262B
    Delcasertib hydrochloride
    2 Publications Verification

    KAI-9803 hydrochloride; BMS-875944 hydrochloride

    PKC Cardiovascular Disease Inflammation/Immunology
    Delcasertib (KAI-9803) hydrochloride is a potent and selective δ-protein kinase C (δPKC) inhibitor. Delcasertib (KAI-9803) hydrochloride could ameliorate injury associated with ischemia and reperfusion in animal models of acute myocardial infarction (MI) .
    Delcasertib hydrochloride
  • HY-150751

    ODN A151

    Toll-like Receptor (TLR) AIM2 Inflammation/Immunology
    ODN TTAGGG (A151), inhibitory oligonucleotide (ODN), is a TLR9, AIM2 and cGAS antagonist. ODN TTAGGG is immunosuppressive and inhibits AIM2 inflammasome activation, as well as cGAS activation, by competing with DNA. ODN TTAGGG can be used in the study of lupus erythematosus and other related autoimmune diseases. ODN TTAGGG sequence: 5'-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-3' .
    ODN TTAGGG

Inquiry Online

Your information is safe with us. * Required Fields.

Salutation

 

Country or Region *

Applicant Name *

 

Organization Name *

Department *

     

Email Address *

 

Product Name *

Cat. No.

 

Requested quantity *

Phone Number *

     

Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: