2. Signaling Pathways
  3. Neuronal Signaling
  4. Tau Protein

Tau Protein

Tau is well established as a microtubule-associated protein in neurons. They have roles primarily in maintaining the stability of microtubules in axons and are abundant in the neurons of the central nervous system (CNS). However, under pathological conditions, aberrant assembly of tau into insoluble aggregates is accompanied by synaptic dysfunction and neural cell death in a range of neurodegenerative disorders, collectively referred to as tauopathies.

Cat. No. Product Name Effect Purity Chemical Structure
  • HY-154851
    GSK-3 inhibitor 3
    		Inhibitor 98.72%
    GSK-3 inhibitor 3 is a selective, orally active and brain-penetrant inhibitor of GSK-3, with IC50s of 0.35 nM and 0.25 nM for GSK-3α and GSK-3β, respectively. GSK-3 inhibitor 3 lowers levels of tau protein phosphorylation at S396 in a triple-transgenic mouse Alzheimer’s disease model, with IC50 of 10 nM. GSK-3 inhibitor 3 can be used for neurological disease research.
    GSK-3 inhibitor 3
  • HY-139307
    MG-2119
    		99.67%
    MG-2119 is a potent monomeric tau and α-syn aggregation inhibitor. MG-2119 is a potential agent for neurological disorders research.
    MG-2119
  • HY-P1707A
    Tau protein (592-597), human TFA
    		99.20%
    Tau protein (592-597), human TFA is a peptide fragment of human Tau protein. The dysfunction of Tau protein is involved in neurodegeneration and dementia.
    Tau protein (592-597), human TFA
  • HY-P99648
    Gosuranemab
    		Inhibitor
    Gosuranemab (BMS-986168) is a humanised IgG4 anti-tau monoclonal antibody. Gosuranemab binds to human N-terminal tau residues 15-22. Gosuranemab has the potential for the research of alzheimer’s disease (AD).
    Gosuranemab
  • HY-132582A
    Tau ASO-12 (murine) (sodium)
    		Inhibitor
    TauASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (TauASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )
    Tau ASO-12 (murine) (sodium)
  • HY-19738
    NQTrp
    		Inhibitor 98.37%
    NQTrp, an aromatic naphthoquinone-tryptophan hybrid molecule, an inhibitor of the aggregation of the tau protein with generic anti-amyloidogenic effects. NQTrp inhibits the in vitro aggregation of hexapeptide (41GCWMLY46 within the N-terminus of γD-crystallin) as well as full-length γD-crystallin.
    NQTrp
  • HY-141660
    BSc3094
    		98.86%
    BSc3094 is a Tau aggregation inhibitor. BSc3094 can be used for the research of Alzheimer's disease (AD).
    BSc3094
  • HY-P9995
    Posdinemab
    		Inhibitor
    Posdinemab is a humanized IgG1κ antibody, targeting to microtubule-associated protein tau (MAPT).
    Posdinemab
  • HY-P2516
    Tau Peptide (275-305) (Repeat 2 domain)
    		98.83%
    Tau Peptide (275-305) (Repeat 2 domain) is the Alzheimer's tau fragment R2, corresponding to the second repeat unit of the microtubule-binding domain, which is believed to be pivotal to the biochemical properties of full tau protein.
    Tau Peptide (275-305) (Repeat 2 domain)
  • HY-153822
    JG-23
    		99.64%
    JG-23 is a 4-chloro modified analog with ability to promote t-tau degradation. JG-23 exhibits good metabolic stability with a long T1/2 value (36 min) in mouse liver microsome assays.
    JG-23
  • HY-134968A
    (R)-TTBK1-IN-1
    		Inhibitor 98.93%
    (R)-TTBK1-IN-1 is a potent, selective and brain-penetrant tau tubulin kinase 1 (TTBK1) inhibitor. (R)-TTBK1-IN-1 is an enantiomer of TTBK1-IN-1 (HY-134968). (R)-TTBK1-IN-1 can be used in the research of alzheimer’s disease and related tauopathies. (R)-TTBK1-IN-1 is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.
    (R)-TTBK1-IN-1
  • HY-P0181
    Microtubule-associated protein tau (26-44)
    		98.10%
    Microtubule-associated protein tau (26-44) is a synthetic peptide chain with an amine group attached to glutamine and an carboxyl group attached to lysine.
    Microtubule-associated protein tau (26-44)
  • HY-105022
    Sabeluzole
    		Inhibitor 99.82%
    Sabeluzole (R 58735), a benzothiazol derivative, has antiischemic, antiepileptic, and cognitive-enhancing properties. Sabeluzole protects rat hippocampal neurons against NMDA- and glutamate-induced neurotoxicity via preventing tau expression. Sabeluzole enhances memory in rats, and prevents the amnesic effect of Chlordiazepoxide. Sabeluzole can be used fro research of Alzheimer's disease.
    Sabeluzole
  • HY-P4924
    Tau Peptide (244-274) (Repeat 1 Domain)
    Tau Peptide (244-274) (Repeat 1 Domain) is aTau fragment.
    Tau Peptide (244-274) (Repeat 1 Domain)
  • HY-P4927
    Tau Peptide (245-274) (Repeat 1 Domain)
    Tau Peptide (245-274) (Repeat 1 Domain) is aTau fragment.
    Tau Peptide (245-274) (Repeat 1 Domain)
  • HY-P4943
    Tau Peptide (273-284)
    		99.75%
    Tau Peptide (273-284) is aTau fragment.
    Tau Peptide (273-284)
  • HY-P4960
    Tau Peptide (294-305) (human)
    Tau Peptide (294-305) (human) is aTau fragment.
    Tau Peptide (294-305) (human)
  • HY-P4972
    Tau Peptide (45-73) (Exon 2/Insert 1 Domain)
    Tau Peptide (45-73) (Exon 2/Insert 1 Domain) is aTau fragment.
    Tau Peptide (45-73) (Exon 2/Insert 1 Domain)
  • HY-P4933
    Tau Peptide (255-314) (Repeat 2 Domain) (human)
    Tau Peptide (255-314) (Repeat 2 Domain) (human) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development.
    Tau Peptide (255-314) (Repeat 2 Domain) (human)
  • HY-153431
    TRV-1387
    		Inhibitor
    TRV-1387 is a benzofurazan that inhibits the aggregation of tau and amyloid-β.
    TRV-1387
Cat. No. Product Name / Synonyms Application Reactivity