1. Search Result
Search Result
Results for "

messenger RNA

" in MedChemExpress (MCE) Product Catalog:

25

Inhibitors & Agonists

2

Biochemical Assay Reagents

1

Peptides

5

Natural
Products

3

Isotope-Labeled Compounds

15

Oligonucleotides

Cat. No. Product Name Target Research Areas Chemical Structure
  • HY-147217A

    ISIS 505358 sodium

    HBV Infection
    Bepirovirsen sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen sodium
  • HY-151507

    Liposome Others
    306Oi10 is a branched ionizable lipid that can be used to construct lipid nanoparticles (LNPs) for delivering messenger RNA. The surface ionization of lipid nanoparticles is related to the effectiveness of mRNA delivery. The tail of 306Oi10 has a one-carbon branch, which provides it with stronger surface ionization compared to lipids with linear tails, thereby enhancing its mRNA delivery efficacy. 306Oi10 can be used in research related to mRNA delivery .
    306Oi10
  • HY-132587A

    ALN-AT3SC sodium; SAR439774 sodium

    Factor Xa Others
    Fitusiran sodium, an small interfering RNA, specifically targets antithrombin (AT) messenger RNA to lower production of AT in the liver. Fitusiran sodium increases thrombin generation and has the potential for the research of the hemophilia .
    Fitusiran sodium
  • HY-150224

    Small Interfering RNA (siRNA) Factor Xa Others
    GalNAc unconjugated/naked Fitusiran (sodium), an small interfering RNA without GalNAc conjugation, specifically targets antithrombin (AT) messenger RNA to lower production of AT in the liver. Fitusiran increases thrombin generation and has the potential for the research of the hemophilia .
    GalNAc unconjugated/naked Fitusiran sodium
  • HY-112980A
    Nusinersen sodium
    1 Publications Verification

    DNA/RNA Synthesis Inflammation/Immunology
    Nusinersen sodium is an antisense oligonucleotide agent that modifies pre–messenger RNA splicing of the SMN2 gene and thus promotes increased production of full-length SMN protein .
    Nusinersen sodium
  • HY-N0086
    N6-Methyladenosine
    5 Publications Verification

    6-Methyladenosine; N-Methyladenosine

    Influenza Virus Endogenous Metabolite Infection
    N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities.
    N6-Methyladenosine
  • HY-147217

    ISIS 505358

    HBV Infection
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen
  • HY-132587

    ALN-AT3SC; SAR439774

    Small Interfering RNA (siRNA) Factor Xa Others
    Fitusiran (ALN-AT3SC), an small interfering RNA, specifically targets antithrombin (AT) messenger RNA to lower production of AT in the liver. Fitusiran increases thrombin generation and has the potential for the research of the hemophilia .
    Fitusiran
  • HY-143700

    Liposome Neurological Disease
    18:0 DAP can be used to formulate lipid nanoparticles (LNPs), which mRNA is encapsulated in their core .
    18:0 DAP
  • HY-112980

    DNA/RNA Synthesis Inflammation/Immunology
    Nusinersen is an antisense oligonucleotide agent that modifies pre–messenger RNA splicing of the SMN2 gene and thus promotes increased production of full-length SMN protein .
    Nusinersen
  • HY-132609

    Small Interfering RNA (siRNA) Transthyretin (TTR) Neurological Disease
    Patisiran sodium is a double-stranded small interfering RNA that targets a sequence within the transthyretin (TTR) messenger RNA. Patisiran sodium specifically inhibits hepatic synthesis of mutant and wild-type TTR. Patisiran sodium can be used for the research of hereditary TTR amyloidosis .
    Patisiran sodium
  • HY-114208A

    Histone Methyltransferase Cancer
    BI-9321 trihydrochloride is a potent, selective and cellular active nuclear receptor-binding SET domain 3 (NSD3)-PWWP1 domain antagonist with a Kd value of 166 nM. BI-9321 trihydrochloride is inactive against NSD2-PWWP1 and NSD3-PWWP2. BI-9321 trihydrochloride specifically disrupts histone interactions of the NSD3-PWWP1 domain with an IC50 of 1.2 μM in U2OS cells .
    BI-9321 trihydrochloride
  • HY-114208

    Histone Methyltransferase Cancer
    BI-9321 is a potent, selective and cellular active nuclear receptor-binding SET domain 3 (NSD3)-PWWP1 domain antagonist with a Kd value of 166 nM. BI-9321 is inactive against NSD2-PWWP1 and NSD3-PWWP2. BI-9321 specifically disrupts histone interactions of the NSD3-PWWP1 domain with an IC50 of 1.2 μM in U2OS cells .
    BI-9321
  • HY-132610A

    ALN-AS1 sodium

    Small Interfering RNA (siRNA) Neurological Disease
    Givosiran sodium is a small interfering RNA that targets hepatic aminolevulinate synthase 1 (ALAS1) messenger RNA. Givosiran sodium downregulates ALAS1 mRNA and prevents accumulation of neurotoxic δ-aminolevulinic acid and porphobilinogen levels. Givosiran sodium can be used for the research of acute intermittent porphyria .
    Givosiran sodium
  • HY-153609

    Transthyretin (TTR) Small Interfering RNA (siRNA) Neurological Disease
    AS-Patisiran sodium is an antisense strand of Patisiran. Patisiran is a double-stranded small interfering RNA that targets a sequence within the transthyretin (TTR) messenger RNA. Patisiran specifically inhibits hepatic synthesis of mutant and wild-type TTR. Patisiran can be used for the research of hereditary TTR amyloidosis .
    AS-Patisiran sodium
  • HY-132610

    ALN-AS1

    Small Interfering RNA (siRNA) Neurological Disease
    Givosiran (ALN-AS1) is a small interfering RNA that targets hepatic aminolevulinate synthase 1 (ALAS1) messenger RNA. Givosiran downregulates ALAS1 mRNA and prevents accumulation of neurotoxic δ-aminolevulinic acid and porphobilinogen levels. Givosiran can be used for the research of acute intermittent porphyria .
    Givosiran
  • HY-153238

    Parasite Infection
    AN15368 is an orally active small-molecule precursor that can be activated by parasite carboxypeptidase to produce a compound that targets the messenger RNA processing pathway in T. cruzi. cruzi. AN15368 has the potential to prevent and research Chagas disease potential .
    AN15368
  • HY-W010970
    5'-Guanylic acid disodium salt
    1 Publications Verification

    5'-GMP disodium salt; 5'-guanosine monophosphate disodium salt

    Endogenous Metabolite Others
    5'-Guanylic acid disodium salt (5'-GMP disodium salt) is composed of guanine, ribose, and phosphate moieties and it is a nucleotide monomer in messenger RNA. Guanosine derivatives are involved in intracellular signal transduction and have been identified in repetitive genomic sequences in telomeres, in ribosomal DNA, immunoglobulin heavy‐chain switch regions, and in the control regions of proto-oncogenes .
    5'-Guanylic acid disodium salt
  • HY-P0063
    Copper tripeptide
    1 Publications Verification

    GHK-Cu

    Endogenous Metabolite Inflammation/Immunology
    Copper tripeptide (GHK-Cu) is a tripeptide. During wound healing, copper tripeptide may be freed from existing extracellular proteins via proteolysis and serves as a chemoattractant for inflammatory and endothelial cells. Copper tripeptide has been shown to increase messenger RNA production for collagen, elastin, proteoglycans, and glycosaminoglycans in fibroblasts. Copper tripeptide is a natural modulator of multiple cllular pathways in skin regeneration .
    Copper tripeptide
  • HY-N0086S

    6-Methyladenosine-d3; N-Methyladenosine-d3

    Isotope-Labeled Compounds Infection
    N6-Methyladenosine-d3 (6-Methyladenosine-d3; N-Methyladenosine-d3) is a deuterium labeled N6-Methyladenosine (HY-N0086). N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities.
    N6-Methyladenosine-d3
  • HY-N0086S2

    6-Methyladenosine-13C4; N-Methyladenosine-13C4

    Isotope-Labeled Compounds Influenza Virus Endogenous Metabolite Infection
    N6-Methyladenosine- 13C4 (6-Methyladenosine- 13C4; N-Methyladenosine- 13C4) is 13C-labeled N6-Methyladenosine (HY-N0086). N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities.
    N6-Methyladenosine-13C4
  • HY-N0086S3

    6-Methyladenosine-13C3; N-Methyladenosine-13C3

    Isotope-Labeled Compounds Influenza Virus Endogenous Metabolite Infection
    N6-Methyladenosine- 13C3 (6-Methyladenosine- 13C3) is 13C-labeled N6-Methyladenosine (HY-N0086). N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities .
    N6-Methyladenosine-13C3
  • HY-N0086R

    Influenza Virus Endogenous Metabolite Infection
    N6-Methyladenosine (Standard) is the analytical standard of N6-Methyladenosine. This product is intended for research and analytical applications. N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities. In Vitro: N6-methyladenosine (m6A) is selectively recognized by the human YTH domain family 2 (YTHDF2) protein to regulate mRNA degradation. N6-methyladenosine (m6A), a prevalent internal modification in the messenger RNA of all eukaryotes, is post-transcriptionally installed by m6A methyltransferase (e.g., MT-A70) within the consensus sequence of G(m6A)C (70%) or A(m6A)C (30%). N6-methyladenosine (m6A)-containing RNAs are greatly enriched in the YTHDF-bound portion and diminished in the flow-through portion . N6-methyladenosine (m6A), the most abundant internal RNA modification, functions in diverse biological processes, including regulation of embryonic stem cell self-renewal and differentiation. N6-methyladenosine (m6A) is a large protein complex, consisting in part of methyltransferase-like 3 (METTL3) and methyltransferase-like 14 (METTL14) catalytic subunits .
    N6-Methyladenosine (Standard)
  • HY-W010970R

    Endogenous Metabolite Others
    5'-Guanylic acid (disodium salt) (Standard) is the analytical standard of 5'-Guanylic acid (disodium salt). This product is intended for research and analytical applications. 5'-Guanylic acid disodium salt (5'-GMP disodium salt) is composed of guanine, ribose, and phosphate moieties and it is a nucleotide monomer in messenger RNA. Guanosine derivatives are involved in intracellular signal transduction and have been identified in repetitive genomic sequences in telomeres, in ribosomal DNA, immunoglobulin heavy‐chain switch regions, and in the control regions of proto-oncogenes .
    5'-Guanylic acid disodium salt (Standard)
  • HY-156985

    Isotope-Labeled Compounds Liposome Others
    Lipid AX4 is an ionizable cationic lipid with the pKa of 6.89, and can be used the study for the formation of lipid nanoparticles (LNPs) for the delivery of mRNA in vivo .
    Lipid AX4

Inquiry Online

Your information is safe with us. * Required Fields.

Salutation

 

Country or Region *

Applicant Name *

 

Organization Name *

Department *

     

Email Address *

 

Product Name *

Cat. No.

 

Requested quantity *

Phone Number *

     

Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: