Search Result
Results for "
messenger RNA
" in MedChemExpress (MCE) Product Catalog:
2
Biochemical Assay Reagents
3
Isotope-Labeled Compounds
Cat. No. |
Product Name |
Target |
Research Areas |
Chemical Structure |
-
- HY-147217
-
ISIS 505358
|
HBV
|
Infection
|
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
|
-
-
- HY-147217A
-
ISIS 505358 sodium
|
HBV
|
Infection
|
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .
|
-
-
- HY-151507
-
|
Liposome
|
Others
|
306Oi10 is a branched ionizable lipid that can be used to construct lipid nanoparticles (LNPs) for delivering messenger RNA. The surface ionization of lipid nanoparticles is related to the effectiveness of mRNA delivery. The tail of 306Oi10 has a one-carbon branch, which provides it with stronger surface ionization compared to lipids with linear tails, thereby enhancing its mRNA delivery efficacy. 306Oi10 can be used in research related to mRNA delivery .
|
-
-
- HY-132587A
-
ALN-AT3SC sodium; SAR439774 sodium
|
Factor Xa
|
Others
|
Fitusiran sodium, an small interfering RNA, specifically targets antithrombin (AT) messenger RNA to lower production of AT in the liver. Fitusiran sodium increases thrombin generation and has the potential for the research of the hemophilia .
|
-
-
- HY-132587
-
ALN-AT3SC; SAR439774
|
Small Interfering RNA (siRNA)
Factor Xa
|
Others
|
Fitusiran (ALN-AT3SC), an small interfering RNA, specifically targets antithrombin (AT) messenger RNA to lower production of AT in the liver. Fitusiran increases thrombin generation and has the potential for the research of the hemophilia .
|
-
-
- HY-150224
-
|
Small Interfering RNA (siRNA)
Factor Xa
|
Others
|
GalNAc unconjugated/naked Fitusiran (sodium), an small interfering RNA without GalNAc conjugation, specifically targets antithrombin (AT) messenger RNA to lower production of AT in the liver. Fitusiran increases thrombin generation and has the potential for the research of the hemophilia .
|
-
-
- HY-N0086
-
6-Methyladenosine; N-Methyladenosine
|
Influenza Virus
Endogenous Metabolite
|
Infection
|
N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities.
|
-
-
- HY-132609
-
|
Small Interfering RNA (siRNA)
Transthyretin (TTR)
|
Neurological Disease
|
Patisiran sodium is a double-stranded small interfering RNA that targets a sequence within the transthyretin (TTR) messenger RNA. Patisiran sodium specifically inhibits hepatic synthesis of mutant and wild-type TTR. Patisiran sodium can be used for the research of hereditary TTR amyloidosis .
|
-
-
- HY-143700
-
-
-
- HY-174792
-
|
mRNA
|
Others
|
The Cre-T2A-GFP mRNA is a capped and polyadenylated messenger RNA encoding a Cre recombinase with a nuclear localization sequence (NLS) and a green fluorescent protein (GFP).
|
-
-
- HY-132610A
-
ALN-AS1 sodium
|
Small Interfering RNA (siRNA)
|
Neurological Disease
Cancer
|
Givosiran sodium is a small interfering RNA that targets hepatic aminolevulinate synthase 1 (ALAS1) messenger RNA. Givosiran sodium downregulates ALAS1 mRNA and prevents accumulation of neurotoxic δ-aminolevulinic acid and porphobilinogen levels. Givosiran sodium can be used for the research of acute intermittent porphyria .
|
-
-
- HY-153609
-
|
Transthyretin (TTR)
Small Interfering RNA (siRNA)
|
Neurological Disease
|
AS-Patisiran sodium is an antisense strand of Patisiran. Patisiran is a double-stranded small interfering RNA that targets a sequence within the transthyretin (TTR) messenger RNA. Patisiran specifically inhibits hepatic synthesis of mutant and wild-type TTR. Patisiran can be used for the research of hereditary TTR amyloidosis .
|
-
-
- HY-114208
-
|
Histone Methyltransferase
|
Cancer
|
BI-9321, a chemical probe, is a potent, selective and cellular active nuclear receptor-binding SET domain 3 (NSD3)-PWWP1 domain antagonist with a Kd value of 166 nM. BI-9321 is inactive against NSD2-PWWP1 and NSD3-PWWP2. BI-9321 specifically disrupts histone interactions of the NSD3-PWWP1 domain with an IC50 of 1.2 μM in U2OS cells .
|
-
-
- HY-114208A
-
|
Histone Methyltransferase
|
Cancer
|
BI-9321 trihydrochloride is a potent, selective and cellular active nuclear receptor-binding SET domain 3 (NSD3)-PWWP1 domain antagonist with a Kd value of 166 nM. BI-9321 trihydrochloride is inactive against NSD2-PWWP1 and NSD3-PWWP2. BI-9321 trihydrochloride specifically disrupts histone interactions of the NSD3-PWWP1 domain with an IC50 of 1.2 μM in U2OS cells .
|
-
-
- HY-132610
-
ALN-AS1
|
Small Interfering RNA (siRNA)
|
Neurological Disease
|
Givosiran (ALN-AS1) is a small interfering RNA that targets hepatic aminolevulinate synthase 1 (ALAS1) messenger RNA. Givosiran downregulates ALAS1 mRNA and prevents accumulation of neurotoxic δ-aminolevulinic acid and porphobilinogen levels. Givosiran can be used for the research of acute intermittent porphyria .
|
-
-
- HY-112980A
-
|
DNA/RNA Synthesis
|
Neurological Disease
|
Nusinersen sodium is an antisense oligonucleotide active molecule. Nusinersen sodium modifies the pre-messenger RNA splicing of the SMN2 gene, thereby promoting the production of full-length SMN protein. Nusinersen sodium improves spinal muscular atrophy .
|
-
-
- HY-112980
-
|
DNA/RNA Synthesis
|
Neurological Disease
|
Nusinersen is an antisense oligonucleotide active molecule. Nusinersen modifies the pre-messenger RNA splicing of the SMN2 gene, thereby promoting the production of full-length SMN protein. Nusinersen improves spinal muscular atrophy .
|
-
-
- HY-153238
-
|
Parasite
|
Infection
|
AN15368 is an orally active small-molecule precursor that can be activated by parasite carboxypeptidase to produce a compound that targets the messenger RNA processing pathway in T. cruzi. cruzi. AN15368 has the potential to prevent and research Chagas disease potential .
|
-
-
- HY-174791
-
|
mRNA
|
Others
|
The Cre-T2A-GFP mRNA is a capped and polyadenylated messenger RNA encoding a Cre recombinase with a nuclear localization sequence (NLS) and a green fluorescent protein (GFP). The incorporation of N1-Methylpseudo-UTP can reduce the immunogenicity of the resulting mRNA.
|
-
-
- HY-N0086S2
-
6-Methyladenosine-13C4; N-Methyladenosine-13C4
|
Isotope-Labeled Compounds
Influenza Virus
Endogenous Metabolite
|
Infection
|
N6-Methyladenosine- 13C4 (6-Methyladenosine- 13C4; N-Methyladenosine- 13C4) is 13C-labeled N6-Methyladenosine (HY-N0086). N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities.
|
-
-
- HY-N0086S3
-
6-Methyladenosine-13C3; N-Methyladenosine-13C3
|
Isotope-Labeled Compounds
Influenza Virus
Endogenous Metabolite
|
Infection
|
N6-Methyladenosine- 13C3 (6-Methyladenosine- 13C3) is 13C-labeled N6-Methyladenosine (HY-N0086). N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities .
|
-
-
- HY-N0086S
-
6-Methyladenosine-d3; N-Methyladenosine-d3
|
Isotope-Labeled Compounds
Influenza Virus
Endogenous Metabolite
|
Infection
|
N6-Methyladenosine-d3 (6-Methyladenosine-d3; N-Methyladenosine-d3) is a deuterium labeled N6-Methyladenosine (HY-N0086). N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities.
|
-
-
- HY-P0063A
-
GHK-Cu acetate
|
Biochemical Assay Reagents
|
Inflammation/Immunology
|
Copper tripeptide (GHK-Cu) acetate is a tripeptide. During wound healing, Copper tripeptide acetate may be freed from existing extracellular proteins via proteolysis and serves as a chemoattractant for inflammatory and endothelial cells. Copper tripeptide acetate has been shown to increase messenger RNA production for collagen, elastin, proteoglycans, and glycosaminoglycans in fibroblasts. Copper tripeptide acetate is a natural modulator of multiple cllular pathways in skin regeneration .
|
-
-
- HY-P0063
-
GHK-Cu
|
Biochemical Assay Reagents
|
Inflammation/Immunology
|
Copper tripeptide (GHK-Cu) is a tripeptide. During wound healing, Copper tripeptide may be freed from existing extracellular proteins via proteolysis and serves as a chemoattractant for inflammatory and endothelial cells. Copper tripeptide has been shown to increase messenger RNA production for collagen, elastin, proteoglycans, and glycosaminoglycans in fibroblasts. Copper tripeptide is a natural modulator of multiple cllular pathways in skin regeneration .
|
-
-
- HY-N0086R
-
6-Methyladenosine (Standard); N-Methyladenosine (Standard)
|
Endogenous Metabolite
Influenza Virus
Reference Standards
|
Infection
|
N6-Methyladenosine (Standard) is the analytical standard of N6-Methyladenosine. This product is intended for research and analytical applications. N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities.
In Vitro: N6-methyladenosine (m6A) is selectively recognized by the human YTH domain family 2 (YTHDF2) protein to regulate mRNA degradation. N6-methyladenosine (m6A), a prevalent internal modification in the messenger RNA of all eukaryotes, is post-transcriptionally installed by m6A methyltransferase (e.g., MT-A70) within the consensus sequence of G(m6A)C (70%) or A(m6A)C (30%). N6-methyladenosine (m6A)-containing RNAs are greatly enriched in the YTHDF-bound portion and diminished in the flow-through portion . N6-methyladenosine (m6A), the most abundant internal RNA modification, functions in diverse biological processes, including regulation of embryonic stem cell self-renewal and differentiation. N6-methyladenosine (m6A) is a large protein complex, consisting in part of methyltransferase-like 3 (METTL3) and methyltransferase-like 14 (METTL14) catalytic subunits .
|
-
-
- HY-W416291
-
Poly(A)
|
Biochemical Assay Reagents
|
Cancer
|
Polyadenylic acid potassium, also known as Poly(A), is enzymatically added to messenger RNA (mRNA) in eukaryotic cells to stabilize mRNAs. Poly(A) is used to evaluate binding on cationic liposomes doped with non-ionic nucleolipids. Poly(A) is used in small molecule mRNA targeted drug development to evaluate the binding of potential therapeutic agents such as the Isoquinoline group of alkaloids. Small molecules that could bind to this poly(A) tail could influence and possibly inhibit mRNA function and subsequent protein production in the cell leading to the development of new type of therapeutic agents.
|
-
-
- HY-156985
-
|
Isotope-Labeled Compounds
Liposome
|
Others
|
Lipid AX4 is an ionizable cationic lipid with the pKa of 6.89, and can be used the study for the formation of lipid nanoparticles (LNPs) for the delivery of mRNA in vivo .
|
-
Cat. No. |
Product Name |
Type |
-
- HY-151507
-
|
Drug Delivery
|
306Oi10 is a branched ionizable lipid that can be used to construct lipid nanoparticles (LNPs) for delivering messenger RNA. The surface ionization of lipid nanoparticles is related to the effectiveness of mRNA delivery. The tail of 306Oi10 has a one-carbon branch, which provides it with stronger surface ionization compared to lipids with linear tails, thereby enhancing its mRNA delivery efficacy. 306Oi10 can be used in research related to mRNA delivery .
|
-
- HY-143700
-
|
Drug Delivery
|
18:0 DAP can be used to formulate lipid nanoparticles (LNPs), which mRNA is encapsulated in their core .
|
Cat. No. |
Product Name |
Target |
Research Area |
-
- HY-P0063
-
GHK-Cu
|
Biochemical Assay Reagents
|
Inflammation/Immunology
|
Copper tripeptide (GHK-Cu) is a tripeptide. During wound healing, Copper tripeptide may be freed from existing extracellular proteins via proteolysis and serves as a chemoattractant for inflammatory and endothelial cells. Copper tripeptide has been shown to increase messenger RNA production for collagen, elastin, proteoglycans, and glycosaminoglycans in fibroblasts. Copper tripeptide is a natural modulator of multiple cllular pathways in skin regeneration .
|
Cat. No. |
Product Name |
Category |
Target |
Chemical Structure |
-
- HY-N0086
-
-
-
- HY-P0063
-
-
-
- HY-N0086R
-
6-Methyladenosine (Standard); N-Methyladenosine (Standard)
|
Structural Classification
Natural Products
Microorganisms
Source classification
Endogenous metabolite
|
Endogenous Metabolite
Influenza Virus
Reference Standards
|
N6-Methyladenosine (Standard) is the analytical standard of N6-Methyladenosine. This product is intended for research and analytical applications. N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities.
In Vitro: N6-methyladenosine (m6A) is selectively recognized by the human YTH domain family 2 (YTHDF2) protein to regulate mRNA degradation. N6-methyladenosine (m6A), a prevalent internal modification in the messenger RNA of all eukaryotes, is post-transcriptionally installed by m6A methyltransferase (e.g., MT-A70) within the consensus sequence of G(m6A)C (70%) or A(m6A)C (30%). N6-methyladenosine (m6A)-containing RNAs are greatly enriched in the YTHDF-bound portion and diminished in the flow-through portion . N6-methyladenosine (m6A), the most abundant internal RNA modification, functions in diverse biological processes, including regulation of embryonic stem cell self-renewal and differentiation. N6-methyladenosine (m6A) is a large protein complex, consisting in part of methyltransferase-like 3 (METTL3) and methyltransferase-like 14 (METTL14) catalytic subunits .
|
-
Cat. No. |
Product Name |
Chemical Structure |
-
- HY-N0086S2
-
|
N6-Methyladenosine- 13C4 (6-Methyladenosine- 13C4; N-Methyladenosine- 13C4) is 13C-labeled N6-Methyladenosine (HY-N0086). N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities.
|
-
-
- HY-N0086S
-
|
N6-Methyladenosine-d3 (6-Methyladenosine-d3; N-Methyladenosine-d3) is a deuterium labeled N6-Methyladenosine (HY-N0086). N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities.
|
-
-
- HY-N0086S3
-
|
N6-Methyladenosine- 13C3 (6-Methyladenosine- 13C3) is 13C-labeled N6-Methyladenosine (HY-N0086). N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities .
|
-
Cat. No. |
Product Name |
|
Classification |
-
- HY-147217
-
ISIS 505358
|
|
Antisense Oligonucleotides
|
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
|
-
- HY-147217A
-
ISIS 505358 sodium
|
|
Antisense Oligonucleotides
|
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .
|
-
- HY-151507
-
|
|
Cationic Lipids
|
306Oi10 is a branched ionizable lipid that can be used to construct lipid nanoparticles (LNPs) for delivering messenger RNA. The surface ionization of lipid nanoparticles is related to the effectiveness of mRNA delivery. The tail of 306Oi10 has a one-carbon branch, which provides it with stronger surface ionization compared to lipids with linear tails, thereby enhancing its mRNA delivery efficacy. 306Oi10 can be used in research related to mRNA delivery .
|
-
- HY-132587A
-
ALN-AT3SC sodium; SAR439774 sodium
|
|
siRNAs
siRNA drugs
|
Fitusiran sodium, an small interfering RNA, specifically targets antithrombin (AT) messenger RNA to lower production of AT in the liver. Fitusiran sodium increases thrombin generation and has the potential for the research of the hemophilia .
|
-
- HY-132587
-
ALN-AT3SC; SAR439774
|
|
siRNAs
siRNA drugs
|
Fitusiran (ALN-AT3SC), an small interfering RNA, specifically targets antithrombin (AT) messenger RNA to lower production of AT in the liver. Fitusiran increases thrombin generation and has the potential for the research of the hemophilia .
|
-
- HY-150224
-
|
|
siRNAs
siRNA drugs
|
GalNAc unconjugated/naked Fitusiran (sodium), an small interfering RNA without GalNAc conjugation, specifically targets antithrombin (AT) messenger RNA to lower production of AT in the liver. Fitusiran increases thrombin generation and has the potential for the research of the hemophilia .
|
-
- HY-132609
-
|
|
siRNAs
siRNA drugs
|
Patisiran sodium is a double-stranded small interfering RNA that targets a sequence within the transthyretin (TTR) messenger RNA. Patisiran sodium specifically inhibits hepatic synthesis of mutant and wild-type TTR. Patisiran sodium can be used for the research of hereditary TTR amyloidosis .
|
-
- HY-132610A
-
ALN-AS1 sodium
|
|
siRNAs
siRNA drugs
|
Givosiran sodium is a small interfering RNA that targets hepatic aminolevulinate synthase 1 (ALAS1) messenger RNA. Givosiran sodium downregulates ALAS1 mRNA and prevents accumulation of neurotoxic δ-aminolevulinic acid and porphobilinogen levels. Givosiran sodium can be used for the research of acute intermittent porphyria .
|
-
- HY-143700
-
|
|
Cationic Lipids
|
18:0 DAP can be used to formulate lipid nanoparticles (LNPs), which mRNA is encapsulated in their core .
|
-
- HY-174792
-
|
|
mRNA
|
The Cre-T2A-GFP mRNA is a capped and polyadenylated messenger RNA encoding a Cre recombinase with a nuclear localization sequence (NLS) and a green fluorescent protein (GFP).
|
-
- HY-153609
-
|
|
siRNAs
siRNA drugs
|
AS-Patisiran sodium is an antisense strand of Patisiran. Patisiran is a double-stranded small interfering RNA that targets a sequence within the transthyretin (TTR) messenger RNA. Patisiran specifically inhibits hepatic synthesis of mutant and wild-type TTR. Patisiran can be used for the research of hereditary TTR amyloidosis .
|
-
- HY-132610
-
ALN-AS1
|
|
siRNAs
siRNA drugs
|
Givosiran (ALN-AS1) is a small interfering RNA that targets hepatic aminolevulinate synthase 1 (ALAS1) messenger RNA. Givosiran downregulates ALAS1 mRNA and prevents accumulation of neurotoxic δ-aminolevulinic acid and porphobilinogen levels. Givosiran can be used for the research of acute intermittent porphyria .
|
-
- HY-112980A
-
|
|
Antisense Oligonucleotides
|
Nusinersen sodium is an antisense oligonucleotide active molecule. Nusinersen sodium modifies the pre-messenger RNA splicing of the SMN2 gene, thereby promoting the production of full-length SMN protein. Nusinersen sodium improves spinal muscular atrophy .
|
-
- HY-112980
-
|
|
Antisense Oligonucleotides
|
Nusinersen is an antisense oligonucleotide active molecule. Nusinersen modifies the pre-messenger RNA splicing of the SMN2 gene, thereby promoting the production of full-length SMN protein. Nusinersen improves spinal muscular atrophy .
|
-
- HY-174791
-
|
|
mRNA
|
The Cre-T2A-GFP mRNA is a capped and polyadenylated messenger RNA encoding a Cre recombinase with a nuclear localization sequence (NLS) and a green fluorescent protein (GFP). The incorporation of N1-Methylpseudo-UTP can reduce the immunogenicity of the resulting mRNA.
|
-
- HY-156985
-
|
|
Cationic Lipids
|
Lipid AX4 is an ionizable cationic lipid with the pKa of 6.89, and can be used the study for the formation of lipid nanoparticles (LNPs) for the delivery of mRNA in vivo .
|
Your information is safe with us. * Required Fields.
Inquiry Information
- Product Name:
- Cat. No.:
- Quantity:
- MCE Japan Authorized Agent: