HBV

Hepatitis B virus

HBV

Related Products

HBV (Hepatitis B virus), abbreviated HBV, is a species of the genus Orthohepadnavirus, which is likewise a part of the Hepadnaviridae family of viruses. HBV causes the disease hepatitis B. The hepatitis B virus is classified as the type species of the Orthohepadnavirus, which contains three other species: the Ground squirrel hepatitis virus, Woodchuck hepatitis virus, and theWoolly monkey hepatitis B virus. The genus is classified as part of the Hepadnaviridae family. HBV is divided into four major serotypes (adr, adw, ayr, ayw) based on antigenic epitopes present on its envelope proteins, and into eight genotypes (A–H) according to overall nucleotide sequence variation of the genome. The genotypes have a distinct geographical distribution and are used in tracing the evolution and transmission of the virus. Differences between genotypes affect the disease severity, course and likelihood of complications, and response to treatment and possibly vaccination.

HBV Related Products (260)
Antibodies (1)

By Effects:	Inhibitors (237) Activators (4) Modulators (2)

Cat. No.	Product Name	Effect	Purity	Chemical Structure

HY-109137

Selgantolimod	Inhibitor	98.23%
Selgantolimod (GS-9688) is an orally active, potent and selective toll-like receptor 8 (TLR8) agonist for the treatment of hepatitis B virus (HBV) and human immunodeficiency virus (HIV) infection.

HY-B2116

Osalmid	Inhibitor	99.80%
Osalmid is a ribonucleotide reductase small subunit M2 (RRM2) targeting compound; suppresses ribonucleotide reductase activity with an IC₅₀ of 8.23 μM.

HY-13623A

Entecavir monohydrate	Inhibitor	99.85%
Entecavir monohydrate (BMS200475 monohydrate; SQ34676 monohydrate) is a potent and selective inhibitor of HBV, with an EC₅₀ of 3.75 nM in HepG2 cell.

HY-117650A

RG7834	Inhibitor	99.85%
RG7834 (RO 7020322) is a highly selective and orally bioavailable HBV inhibitor, potently inhibits HBV antigens (both HBsAg and HBeAg) and HBV DNA, with IC₅₀s of 2.8, 2.6, and 3.2 nM, respectively, in dHepaRG Cells.

HY-B1464

Cetylpyridinium chloride	Inhibitor	99.75%
Cetylpyridinium chloride, a cationic quaternary ammonium compound, is an anti-bacterial agent with broad-spectrum activity. Cetylpyridinium chloride is an effective anti-HBV capsid assembly inhibitor with an IC₅₀ of 2.5 μM. Cetylpyridinium chloride is used in pesticides and various types of mouthwashes, and other personal care products.

HY-N0639

Punicalin	Inhibitor	99.89%
Punicalin is a species that can be isolated from the leaves of Punica granatum. Punicalin is an active molecule against hepatitis b virus (HBV). Punicalin can induce pyroptosis. Punicalin is a Carbonic anhydrase inhibitor. Punicalin blocks the binding of S-glycoprotein and ACE2 receptors. Pnuicalin has anti-inflammatory, antioxidant and antiviral activity.

HY-19314A

Azvudine hydrochloride	Inhibitor
Azvudine (RO-0622) hydrochloride is a potent nucleoside reverse transcriptase inhibitor (NRTI), with antiviral activity on HIV, HBV and HCV. Azvudine hydrochloride exerts highly potent inhibition on HIV-1 (EC₅₀s ranging from 0.03 to 6.92 nM) and HIV-2 (EC₅₀s ranging from 0.018 to 0.025 nM). Azvudine hydrochloride inhibits NRTI-resistant viral strains. Azvudine (hydrochloride) is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. It can also undergo strain-promoted alkyne-azide cycloaddition (SPAAC) reactions with molecules containing DBCO or BCN groups.

HY-N6939

Pseudolaric Acid B	Inhibitor	99.47%
Pseudolaric Acid B is a diterpene isolated from the root of Pseudolarix kaempferi (pinaceae), has anti-cancer, antifungal, and antifertile activities, and shows immunosuppressive activity on T lymphocytes. Pseudolaric Acid B inhibits hepatitis B virus (HBV) secretion through apoptosis and cell cycle arrest. Pseudolaric Acid B induces autophagy.

HY-B0255

Adefovir dipivoxil	Inhibitor	99.03%
Adefovir dipivoxil, an adenosine analogue, is an oral proagent of the nucleoside reverse transcriptase inhibitor Adefovir. Adefovir dipivoxil inhibits both the wild type and HBV Lamivudine-resistant strains. Adefovir dipivoxil shows anti-orthopoxvirus activity.

HY-108917

Morphothiadin	Inhibitor	99.84%
Morphothiadin is a potent inhibitor on the replication of both wild-type and adefovir-resistant HBV with an IC₅₀ of 12 nM.

HY-B1826

Adefovir	Inhibitor	99.74%
Adefovir (GS-0393) is an adenosine monophosphate analog antiviral agent that after intracellular conversion to Adefovir diphosphate inhibits HBV DNA polymerase. Adefovir has an IC₅₀ of 0.7 μM against HBV in the HepG2.2.15 cell line. Adefovir has good antiviral activity against several viruses, including HBV and herpesviruses.

HY-13986

Merimepodib	Inhibitor	99.27%
Merimepodib (VX-497) is a noncompetitive and oral inhibitor of inosine monophosphate dehydrogenase (IMPDH) with broad spectrum antiviral activities.

HY-B0766

Bicyclol	Inhibitor	99.91%
Bicyclol (SY801) is an orally active derivative of the traditional Chinese medicine Schisandra chinensis, which has antiviral, anti-inflammatory, immunomodulatory, antioxidant, anti-steatosis, anti-fibrotic and anti-tumor activities. Bicyclol regulates the expression of heat shock proteins and plays an anti-apoptosis role in hepatocytes. Bicyclol reduces the activation of NF-κB and the levels of inflammatory factors in hepatocytes infected with hepatitis C virus (HCV) by inhibiting the activation of the ROS-MAPK-NF-κB pathway, and prevents ferroptosis in acute liver injury. Bicyclol can change the expression of Mdr-1, GSH/GST and Bcl-2, increase the intracellular concentration of anticancer drugs, and sensitize drug-resistant cells to anticancer drugs. Bicyclol inhibits the proliferation of human malignant hepatoma cells by regulating the PI3K/AKT pathway and the Ras/Raf/MEK/ERK pathway. Bicyclol can be used in the study of chronic hepatitis, acute liver injury, nonalcoholic fatty liver disease, liver fibrosis and hepatocellular carcinoma.

HY-13782A

Tenofovir Disoproxil	Inhibitor	99.84%
Tenofovir Disoproxil (Bis(POC)-PMPA) is a nucleotide reverse transcriptase inhibitor to treat HIV and chronic Hepatitis B.

HY-148560

ccc_R08	Inhibitor	98.87%
ccc_R08 is a non-cytotoxic and orally active cccDNA inhibitor that reduces cccDNA levels in the liver of HBV-infected mice. ccc_R08 can be used in the study of HBV virus (hepatitis B virus) infection.

HY-B0017

Telbivudine	Inhibitor	99.98%
Telbivudine (Epavudine), an orally active thymidine nucleoside analog, is a potent antiviral inhibitor of hepatitis B virus (HBV) replication.

HY-147217A

Bepirovirsen sodium	Inhibitor	98.44%
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC).

HY-W018791

Bifendate	Inhibitor	99.91%
Bifendate (DDB), extracted from Schisandrae chinensis, is an orally active anti-HBV agent against chronic hepatitis B. Bifendate inhibits ATG5-dependent autophagy and attenuates oleic acid-induced lipid accumulation with anti-oxidant properties in vitro. Bifendate can decrease alanine transaminase (ALT) level in mice. Bifendate attenuates hepatic steatosis in cholesterol/bile salt- and high-fat diet-induced hypercholesterolemia in mice. Bifendate potently increases the activity of cytochrome proteins (CYPs) and reverse P-gp-mediated multi-drug resistance (MDR).

HY-16468

Squalamine	Inhibitor	99.54%
Squalamine (MSI-1256) is an aminosterol compound with broad-spectrum antiviral activity. Squalamine makes cells less conducive to certain viral replication by altering the electrostatic interactions in the inner membrane of host cells. Squalamine also has antibacterial and antitumor activities. Squalamine has broad-spectrum antibacterial activity against Gram-negative and Gram-positive bacteria, fungi and protozoa. Squalamine inhibits tumor-related angiogenesis and the growth of human breast cancer cells. Squalamine restores the function of enteric nervous system in Parkinson^,s disease mouse models.

HY-19314

Azvudine	Inhibitor	99.79%
Azvudine (RO-0622) is a potent nucleoside reverse transcriptase inhibitor (NRTI), with antiviral activity on HIV, HBV and HCV. Azvudine exerts highly potent inhibition on HIV-1 (EC₅₀s ranging from 0.03 to 6.92 nM) and HIV-2 (EC₅₀s ranging from 0.018 to 0.025 nM). Azvudine inhibits NRTI-resistant viral strains. Azvudine is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. It can also undergo strain-promoted alkyne-azide cycloaddition (SPAAC) reactions with molecules containing DBCO or BCN groups.

Name
Email *

	Sorry, but the email address you supplied was invalid.

HBV

HBV

HBV Related Products (260)

Antibodies (1)

HBV Related Products (260):