2. Search Result
Search Result
Results for "

ASO

" in MedChemExpress (MCE) Product Catalog:

21

Inhibitors & Agonists

1

Peptides

24

Oligonucleotides

Cat. No. Product Name Classification
  • HY-148688
    ASO 556089 sodium

    		Antisense Oligonucleotides
    ASO 556089 sodium is a 16 nucleotide length gapmer (3-10-3) that targets the human and mouse long non-coding RNA MALAT1, with the sequence: 5’-GmCATTmCTAATAGmCAGmC-3’ .
  • HY-132582A
    Tau ASO-12 (murine) (sodium)

    		Antisense Oligonucleotides
    Tau ASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (Tau ASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )
  • HY-153734
    Inactive ASO (in vivo) sodium

    		Antisense Oligonucleotides
    Inactive ASO (in vivo) sodium is an inactive Antisense Oligonucleotide. ASO is a class of oligonucleotide molecules, usually composed of 20-30 bases, used to interfere with or regulate gene expression. Inactive ASO (in vivo) sodium is not targeted in the rodent genome and can be used as a negative control for Tofersen. Inactive ASO (in vivo) sodium contains thiophosphate skeleton modification and MOE modification. Cytosine in Inactive ASO (in vivo) is 5' methylcytosine. See References for the location of chemical modifications
  • HY-137501
    306-O12B-3

    		Cationic Lipids
    306-O12B-3 is a lipidoid that can efficiently deliver ASO both in vitro and in vivo. 306-O12B-3 is used to transport small molecule drugs across the blood-brain barrier (BBB) .
  • HY-148687A
    SPC5001 sodium

    		Antisense Oligonucleotides
    SPC5001 sodium is a locked nucleic acid (LNA)-modifed antisense oligonucleotide (ASO) complementary to human PCSK9 (proprotein convertase subtilisin/kexin type 9) mRNA. SPC5001 sodium can be used for the research of hypercholesterolemia. SPC5001 sequence: 5′-TGmCTACAAAACmCmCA-3′ .
  • HY-147410A
    Ulefnersen sodium

    ION-363 sodium

    		 Antisense Oligonucleotides
    Ulefnersen sodium (ION363) is an Antisense Oligonucleotide (ASO) directed against the 6th intron of the fused-in sarcoma (FUS) transcript to silence FUS in a non-allele-specific manner. Ulefnersen sodium can reduce postnatal levels of FUS protein in the brain and spinal cord in disease-relevant mouse model of ALS-FUS , delaying motor neuron degeneration. Ulefnersen sodium can be used in the research of Amyotrophic Lateral Sclerosis (ALS) .
  • HY-158830
    MDM4-targeting ASO sodium

    		Antisense Oligonucleotides
    MDM4-targeting ASO sodium is a 25mer antisense oligonucleotide targeting?MDM4. MDM4-targeting ASO sodium induced exon 6 skipping, leading to nonsense-mediated decay of the mRNA transcript that excludes exon-6. In multiple human melanoma cell lines and in melanoma patient-derived xenograft (PDX) mouse models, MDM4-targeting ASO-mediated skipping of exon 6 decreased MDM4 abundance, inhibited melanoma growth, and enhanced sensitivity to MAPK-targeting therapeutics.
  • HY-W570887
    LNA-A(Bz) amidite

    		Nucleoside Phosphoramidites
    LNA-A(Bz) amidite can be used for synthesis of ASOs (antisense oligonucleotides) .
  • HY-148687
    SPC5001

    		Antisense Oligonucleotides
    SPC5001 is a locked nucleic acid (LNA)-modifed antisense oligonucleotide (ASO) complementary to human PCSK9 (proprotein convertase subtilisin/kexin type 9) mRNA. SPC5001 can be used for the research of hypercholesterolemia. SPC5001 sequence: 5′-TGmCTACAAAACmCmCA-3′ .
  • HY-147410
    Ulefnersen

    ION-363

    		 Antisense Oligonucleotides
    Ulefnersen (ION363) is an Antisense Oligonucleotide (ASO) directed against the 6th intron of the fused-in sarcoma (FUS) transcript to silence FUS in a non-allele-specific manner. Ulefnersen can reduce postnatal levels of FUS protein in the brain and spinal cord in disease-relevant mouse model of ALS-FUS , delaying motor neuron degeneration. Ulefnersen can be used in the research of Amyotrophic Lateral Sclerosis (ALS) .
  • HY-132581A
    Tadnersen sodium

    BIIB078 sodium; IONIS-C9Rx sodium

    		 Antisense Oligonucleotides
    Tadnersen sodium, an antisense oligonucleotide (ASO), selectively targets C9ORF72 transcript variants 1 and 3 that carry the expansion .
  • HY-159695
    IONIS-GCCRRx

    ISIS 426115

    		 Antisense Oligonucleotides
    IONIS-GCCRRx (ISIS 426115), a glucocorticoid receptor antagonist, is a 2'-O-methoxyethyl (2'-MOE) antisense oligonucleotide (ASO) .
  • HY-159695A
    IONIS-GCCRRx sodium

    ISIS 426115 sodium

    		 Antisense Oligonucleotides
    IONIS-GCCRRx (ISIS 426115) sodium, a glucocorticoid receptor antagonist, is a 2'-O-methoxyethyl (2'-MOE) antisense oligonucleotide (ASO) .
  • HY-132581
    Tadnersen

    BIIB078; IONIS-C9Rx

    		 Antisense Oligonucleotides
    Tadnersen (BIIB078), an antisense oligonucleotide (ASO), selectively targets C9ORF72 transcript variants 1 and 3 that carry the expansion .
  • HY-132582
    IONIS-MAPTRx

    BIIB080; ISIS 814907

    		 Antisense Oligonucleotides
    IONIS-MAPTRx (BIIB080) is the first Tau-lowering antisense oligonucleotide (ASO). IONIS-MAPTRx has the potential for the research of Alzheimer Disease .
  • HY-158825
    Cepadacursen sodium

    CIVI007 sodium

    		 Antisense Oligonucleotides
    Cepadacursen sodium is a liver-targeting antisense oligonucleotide (ASO), inhibits proprotein convertase subtilisin/kexin type 9 (PCSK9) protein synthesis. Cepadacursen sodium can be used for hypercholesterolemia treatment and the prevention of atherosclerotic cardiovascular disease (ASCVD).
  • HY-148370A
    IONIS-FB-LRx sodium

    RG6299 sodium

    		 Antisense Oligonucleotides
    IONIS-FB-LRx sodium is a specific antisense oligonucleotide (ASO) targeting complement factor B (CFB). IONIS-FB-LRx sodium effectively reduces circulating levels of CFB, and can be used for geographic atrophy (GA) research .
  • HY-148370
    IONIS-FB-LRx

    RG6299

    		 Antisense Oligonucleotides
    IONIS-FB-LRx is a specific antisense oligonucleotide (ASO) targeting complement factor B (CFB). IONIS-FB-LRx effectively reduces circulating levels of CFB. IONIS-FB-LRx can be used for geographic atrophy (GA) research .
  • HY-158827A
    AZD8233 sodium

    		Antisense Oligonucleotides
    AZD8233 sodium, a liver-targeting antisense oligonucleotide (ASO), inhibits subtilisin/kexin type 9 (PCSK9) protein synthesis. AZD8233 sodium increases the available LDL receptors by reducing PCSK9 levels, thereby clearing LDL from the blood and decreasing LDL-C levels.
  • HY-158827
    AZD8233

    		Antisense Oligonucleotides
    AZD8233, a liver-targeting antisense oligonucleotide (ASO), inhibits proprotein convertase subtilisin/kexin type 9 (PCSK9) protein synthesis. AZD8233 increases the available LDL receptors by reducing PCSK9 levels, thereby clearing LDL from the blood and decreasing LDL-C levels.
  • HY-148130A
    Rugonersen sodium

    RG6091 sodium; RO7248824 sodium

    		 Antisense Oligonucleotides
    Rugonersen sodium is a locked-nucleic acid (LNA)- modified antisense oligonucleotides (ASOs), and results in reduction of ubiquitin-protein ligase E3A (UBE3A) silencing. Angelman syndrome (AS) sodium is a severe neurodevelopmental disorder caused by the loss of neuronal E3 ligase UBE3A, Rugonersen has been used for AS reasearch .
  • HY-W570885
    2'-O-MOE-rC

    		Nucleoside Phosphoramidites
    2'-O-MOE-rC is a 2'-O-MOE modified nucleoside. 2'-O-MOE-rC can be used for synthesis of DNA .
  • HY-148130
    Rugonersen

    RG6091; RO7248824

    		 Antisense Oligonucleotides
    Rugonersen (RG6091; RO7248824) is a locked-nucleic acid (LNA)- modified antisense oligonucleotides (ASOs), and results in reduction of ubiquitin-protein ligase E3A (UBE3A) silencing. Angelman syndrome (AS) is a severe neurodevelopmental disorder caused by the loss of neuronal E3 ligase UBE3A, Rugonersen has been used for AS reasearch .
  • HY-108764
    Mipomersen sodium

    ISIS 301012

    		 Antisense Oligonucleotides
    Mipomersen sodium (ISIS 301012) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has anti-HCV effect and reduces the infectivity of the HCV. Mipomersen sodium can be used for the research of homozygous familial hypercholesterolemia (HoFH) .

Inquiry Online

Your information is safe with us. * Required Fields.

Salutation

  

Country or Region *

Applicant Name *

 

Organization Name *

Department *

     

Email Address *

 

Product Name *

Cat. No.

  

Requested quantity *

Phone Number *

     

Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: