2. Search Result
Search Result
Results for "

ASO

" in MedChemExpress (MCE) Product Catalog:

22

Inhibitors & Agonists

1

Peptides

24

Oligonucleotides

Cat. No. Product Name Target Research Areas Chemical Structure
  • HY-P2742
    Ascorbate oxidase

    ASO

    		 Endogenous Metabolite Metabolic Disease
    Ascorbate oxidase, also known as vitamin C oxidase, is a REDOX enzyme involved in the regulation of extracellular matrix. Ascorbate oxidase catalyzes the reaction of ascorbic acid and oxygen to produce dehydroascorbic acid .
    Ascorbate oxidase
  • HY-132582A
    Tau ASO-12 (murine) (sodium)

    		Tau Protein Cancer
    Tau ASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (Tau ASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )
    Tau ASO-12 (murine) (sodium)
  • HY-W570887
    LNA-A(Bz) amidite

    		DNA/RNA Synthesis Others
    LNA-A(Bz) amidite can be used for synthesis of ASOs (antisense oligonucleotides) .
    LNA-A(Bz) amidite
  • HY-137501
    306-O12B-3

    		Liposome Others
    306-O12B-3 is a lipidoid that can efficiently deliver ASO both in vitro and in vivo. 306-O12B-3 is used to transport small molecule drugs across the blood-brain barrier (BBB) .
    306-O12B-3
  • HY-148687A
    SPC5001 sodium

    		PCSK9 Cardiovascular Disease
    SPC5001 sodium is a locked nucleic acid (LNA)-modifed antisense oligonucleotide (ASO) complementary to human PCSK9 (proprotein convertase subtilisin/kexin type 9) mRNA. SPC5001 sodium can be used for the research of hypercholesterolemia. SPC5001 sequence: 5′-TGmCTACAAAACmCmCA-3′ .
    SPC5001 sodium
  • HY-157261
    UNC2383

    		Others Others
    UNC2383 is an oligonucleotide enhancing compound that can enhance effects of antisense oligonucleotides (ASOs), and splice switching oligonucleotides (SSOs) .
    UNC2383
  • HY-132582C
    IONIS-MAPTRx sodium

    BIIB080 sodium; ISIS 814907 sodium

    		 Tau Protein Neurological Disease
    IONIS-MAPTRx sodium is the first Tau-lowering antisense oligonucleotide (ASO). IONIS-MAPTRx sodium has the potential for the research of Alzheimer Disease .
    IONIS-MAPTRx sodium
  • HY-148687
    SPC5001

    		PCSK9 Cardiovascular Disease
    SPC5001 is a locked nucleic acid (LNA)-modifed antisense oligonucleotide (ASO) complementary to human PCSK9 (proprotein convertase subtilisin/kexin type 9) mRNA. SPC5001 can be used for the research of hypercholesterolemia. SPC5001 sequence: 5′-TGmCTACAAAACmCmCA-3′ .
    SPC5001
  • HY-132582
    IONIS-MAPTRx

    BIIB080; ISIS 814907

    		 Tau Protein Neurological Disease
    IONIS-MAPTRx (BIIB080) is the first Tau-lowering antisense oligonucleotide (ASO). IONIS-MAPTRx has the potential for the research of Alzheimer Disease .
    IONIS-MAPTRx
  • HY-158825
    Cepadacursen sodium

    CIVI007 sodium

    		 PCSK9 Metabolic Disease
    Cepadacursen sodium is a liver-targeting antisense oligonucleotide (ASO), inhibits proprotein convertase subtilisin/kexin type 9 (PCSK9) protein synthesis. Cepadacursen sodium can be used for hypercholesterolemia treatment and the prevention of atherosclerotic cardiovascular disease (ASCVD).
    Cepadacursen sodium
  • HY-148370A
    IONIS-FB-LRx sodium

    RG6299 sodium

    		 Complement System Others
    IONIS-FB-LRx sodium is a specific antisense oligonucleotide (ASO) targeting complement factor B (CFB). IONIS-FB-LRx sodium effectively reduces circulating levels of CFB, and can be used for geographic atrophy (GA) research .
    IONIS-FB-LRx sodium
  • HY-148370
    IONIS-FB-LRx

    RG6299

    		 Complement System Others
    IONIS-FB-LRx is a specific antisense oligonucleotide (ASO) targeting complement factor B (CFB). IONIS-FB-LRx effectively reduces circulating levels of CFB. IONIS-FB-LRx can be used for geographic atrophy (GA) research .
    IONIS-FB-LRx
  • HY-158827A
    AZD8233 sodium

    		PCSK9 Metabolic Disease
    AZD8233 sodium, a liver-targeting antisense oligonucleotide (ASO), inhibits subtilisin/kexin type 9 (PCSK9) protein synthesis. AZD8233 sodium increases the available LDL receptors by reducing PCSK9 levels, thereby clearing LDL from the blood and decreasing LDL-C levels.
    AZD8233 sodium
  • HY-158827
    AZD8233

    		PCSK9 Metabolic Disease
    AZD8233, a liver-targeting antisense oligonucleotide (ASO), inhibits proprotein convertase subtilisin/kexin type 9 (PCSK9) protein synthesis. AZD8233 increases the available LDL receptors by reducing PCSK9 levels, thereby clearing LDL from the blood and decreasing LDL-C levels.
    AZD8233
  • HY-148130A
    Rugonersen sodium

    RG6091 sodium; RO7248824 sodium

    		 E1/E2/E3 Enzyme Others
    Rugonersen sodium is a locked-nucleic acid (LNA)- modified antisense oligonucleotides (ASOs), and results in reduction of ubiquitin-protein ligase E3A (UBE3A) silencing. Angelman syndrome (AS) sodium is a severe neurodevelopmental disorder caused by the loss of neuronal E3 ligase UBE3A, Rugonersen has been used for AS reasearch .
    Rugonersen sodium
  • HY-W570885
    2'-O-MOE-rC

    		DNA/RNA Synthesis Others
    2'-O-MOE-rC is a 2'-O-MOE modified nucleoside. 2'-O-MOE-rC can be used for synthesis of DNA .
    2'-O-MOE-rC
  • HY-148130
    Rugonersen

    RG6091; RO7248824

    		 E1/E2/E3 Enzyme Others
    Rugonersen (RG6091; RO7248824) is a locked-nucleic acid (LNA)- modified antisense oligonucleotides (ASOs), and results in reduction of ubiquitin-protein ligase E3A (UBE3A) silencing. Angelman syndrome (AS) is a severe neurodevelopmental disorder caused by the loss of neuronal E3 ligase UBE3A, Rugonersen has been used for AS reasearch .
    Rugonersen
  • HY-158820
    Cosdosiran

    QPI-1007

    		 Small Interfering RNA (siRNA) Caspase Cardiovascular Disease
    Cosdosiran is a chemically modified siRNA designed to temporarily inhibit expression of the caspase 2 protein and can be used for the study of nonarteritic anterior ischemic optic neuropathy and other optic neuropathies such as glaucoma that result in the death of retinal ganglion cells.?
    Cosdosiran
  • HY-158820A
    Cosdosiran sodium

    QPI-1007 sodium

    		 Small Interfering RNA (siRNA) Caspase Cardiovascular Disease
    Cosdosiran sodium is a chemically modified siRNA designed to temporarily inhibit expression of the caspase 2 protein and can be used for the study of nonarteritic anterior ischemic optic neuropathy and other optic neuropathies such as glaucoma that result in the death of retinal ganglion cells.?
    Cosdosiran sodium
  • HY-E70364
    IgdE protease

    		Biochemical Assay Reagents Inflammation/Immunology
    IgdE protease is a cysteine protease, which is initially isolated from Streptococcus agalactiae. IgdE protease digests monoclonal antibodies (mAbs) of the IgG1 type specifically at their upper hinge region, produces Fc/2, hinge peptide dimers, and Fab fragment. IgdE protease can be used in disulfide bonds and free thiol analysis, as it requires no reducing agents for cleavage .
    IgdE protease
  • HY-136151
    UNC10217938A
    1 Publications Verification

    		 Others Others
    UNC10217938A is a 3-deazapteridine analog with strong oligonucleotide enhancing effects. UNC10217938A enhances oligonucleotides effects by modulating their intracellular trafficking and release from endosomes. UNC10217938A also enhances the effects of antisense and siRNA oligonucleotides .
    UNC10217938A
  • HY-108764
    Mipomersen sodium

    ISIS 301012

    		 HCV Metabolic Disease
    Mipomersen sodium (ISIS 301012) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has anti-HCV effect and reduces the infectivity of the HCV. Mipomersen sodium can be used for the research of homozygous familial hypercholesterolemia (HoFH) .
    Mipomersen sodium

Inquiry Online

Your information is safe with us. * Required Fields.

Salutation

  

Country or Region *

Applicant Name *

 

Organization Name *

Department *

     

Email Address *

 

Product Name *

Cat. No.

  

Requested quantity *

Phone Number *

     

Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: