From 11:00 pm to 12:00 pm EST ( 8:00 pm to 9:00 pm PST ) on January 6th, the website will be under maintenance. We are sorry for the inconvenience. Please arrange your schedule properly.
Yhhu6669 is an anti-HBV agent. Yhhu6669 inhibits HBVDNA. Yhhu6669 inhibits HBV replication by inducing the formation of DNA-free capsids. Yhhu6669 decreases HBVDNA and HBcAg in AAV/HBV-infected mice. Yhhu6669 has favorable PK properties .
Oxynitidine is an HBV inhibitor (ID50=30.8 µg/mL), which can effectively inhibit the DNA replication activity of HBV. Oxynitidine can be used in the study of viral infections .
HBV-IN-16 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-16 is a quinoline derivative. HBV-IN-16 has the potential for the research of HBV infection (extracted from patent WO2019121357A1, compound 1) .
HBV-IN-14 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-14 is a pyridinopyrimidinones compound. HBV-IN-14 has the potential for the research of HBV infection (extracted from patent WO2021190502A1, compound 5) .
HBV-IN-15 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-15 is a flavone derivative. HBV-IN-16 has the potential for the research of HBV infection (extracted from patent WO2020052774A1, compound 2) .
Junceellolide C is a transcription inhibitor of cccDNA. Junceellolide C inhibits HBVDNA replication and significantly decreases the level of supernatant HBV RNA with EC50 values of 5.19, 3.52 μM respectively in HepAD38 cells. Junceellolide C is a potent anti-HBV agent .
HBV-IN-30 (ex44), a flavone derivative, is a potent covalently closed circular DNA (cccDNA) inhibitor. cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-30 has the potential for the research of HBV infection .
HBV-IN-29 (ex8), a flavone derivative, is a potent covalently closed circular DNA (cccDNA) inhibitor. cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-29 has the potential for the research of HBV infection .
HBV-IN-23 (Compound 5k) is an inhibitor of HBVDNA replication with an IC50 of 0.58 μM. HBV-IN-23 inhibits HBVDNA replication in both agent sensitive and resistant HBV strains. HBV-IN-23 shows anti-hepatocellular carcinoma cell (HCC) activities. HBV-IN-23 induces HepG2 cells apoptosis .
HBV-IN-48 is an HBV inhibitor. HBV-IN-48 has antiviral activity against HBV in HepDE19 cells, with an EC50 value of 0.005 μM. HBV-IN-48 can reduce serum HBVDNA levels in mouse models of HBV infection .
HBV-IN-4, a phthalazinone derivative, is a potent and orally active HBVDNA replication inhibitor with an IC50 of 14 nM. HBV-IN-4 induces the formation of genome-free capsids and has potent anti-HBV potencies .
HBV-IN-31 is a potent cccDNA (covalently closed circular DNA) inhibitor. HBV-IN-31 shows anti-HBV activity with an IC50 value of 0.13 µM for HBsAg. HBV-IN-31 inhibits cell growth .
HBV-IN-32 is a potent cccDNA (covalently closed circular DNA) inhibitor. HBV-IN-32 shows anti-HBV activity with an IC50 value of 0.14 µM for HBsAg. HBV-IN-32 inhibits cell growth .
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBVDNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
HBV-IN-34 (compound 17i) is a potent HBsAg production inhibitor. HBV-IN-34 exhibits excellent in vitro anti-HBV potency, with an EC50 of 0.018 μM and 0.044 μM for HBVDNA and HBsAg, respectively .
HBV-IN-21 (Compound II-8b) is an HBVDNA replication inhibitor with an IC50 of 2.2 µM. HBV-IN-21 can interact HBV 4 capsid protein with good affinity (KD = 60.0 μM) .
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBVDNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .
HBV-IN-22 (Compound LC5f) is an inhibitor of HBVDNA replication with IC50 values of 0.71 μM and 0.84 μM against wild-type and agent resistant HBV strains, respectively .
RG7834 (RO 7020322) is a highly selective and orally bioavailable HBV inhibitor, potently inhibits HBV antigens (both HBsAg and HBeAg) and HBVDNA, with IC50s of 2.8, 2.6, and 3.2 nM, respectively, in dHepaRG Cells .
HBV-IN-24 (compound (2ʹS, 6S)-1a) is a potent HBV inhibitor. HBV-IN-24 exhibits potent inhibition activity against HBVDNA, HBsAg, and HBeAg, with EC50 values of 0.6, 0.6, and 4.6 nM, respectively. HBV-IN-24 shows excellent antiviral activity, could have improved neurotoxicity .
HBV-IN-9 is a potent HBsAg (HBV Surface antigen) inhibitor (IC50=10 nM) and HBVDNA production inhibitor (IC50=0.15 nM in HepG2.2.15 cells) . From patent WO2018001952A1, example 20.
AT-130, a phenylpropenamide derivative, is a potent hepatitis B virus (HBV) replication non-nucleoside inhibitor. AT-130 inhibits the viral DNA synthesis with an EC50 of 0.13 μM. AT-130 inhibits both wt and mutant HBVs. AT-130 has anti-HBV activity in hepatoma cells .
SAG-524 is a potent oral small molecule HBV viral replication inhibitor. SAG-524 decreased HBV-DNA and HbsAg levels in supernatant of HepG2.2.15 cells, IC50 0.92 and 1.4 nM, respectively .
Adefovir (GS-0393) is an adenosine monophosphate analog antiviral agent that after intracellular conversion to Adefovir diphosphate inhibits HBVDNA polymerase. Adefovir has an IC50 of 0.7 μM against HBV in the HepG2.2.15 cell line. Adefovir has good antiviral activity against several viruses, including HBV and herpesviruses .
HBF-0259 is a potent and selective inhibitor of hepatitis B virus (HBV) surface antigen (HBsAg) secretion, with an EC50 of 1.5 μM in HepG2.2.15 cells. HBF-0259 has no effect on HBVDNA synthesis .
Adefovir-d4 is the deuterium labeled Adefovir. Adefovir (GS-0393) is an adenosine monophosphate analog antiviral agent that after intracellular conversion to Adefovir diphosphate inhibits HBVDNA polymerase. Adefovir has an IC50 of 0.7 μM against HBV in the HepG2.2.15 cell line. Adefovir has good antiviral activity against several viruses, including HBV and herpesviruses[1][2][3].
BAY38-7690 is a non-nucleoside inhibitor that inhibits HBV replication. BAY38-7690 inhibits viral DNA replication by preventing the formation of viral core particles (nucleocapsids). The IC50 value of BAY38-7690 against HBV in stably transfected HepG2.2.15 cells is 0.15 μM .
BAY39-5493 is a non-nucleoside inhibitor that inhibits HBV replication. BAY39-5493 inhibits viral DNA replication by preventing the formation of viral core particles (nucleocapsids). The IC50 value of BAY39-5493 against HBV in stably transfected HepG2.2.15 cells is 0.03 μM .
HEC72702 is a potent and orally active hepatitis B virus capsid inhibitor with an EC50 values of 0.039 µM. HEC72702 dose-dependently reduced HBVDNA in both the plasma and livers .
LB80317 is an active metabolite of LB80380 and suppresses the DNA synthesis of HBV with an EC50 of 0.5 μM. LB80317 has antiviral effect and has the potential for chronic hepatitis B treatment .
cis-ccc_R08 (compound 1) is a flavonoid derivative that can be used in the study of hepatitis B virus(HBV) infection. cis-ccc_R08 is a cccDNA (covalently closed circular DNA) inhibitor .
Besifovir Dipivoxil maleate (LB80380 maleate) is an oral proagent of LB80317. Besifovir Dipivoxil maleate (LB80380 maleate) is effective in hepatitis B virus (HBV) DNA suppression for both treatment-naive and lamivudine-resistant chronic hepatitis B (CHB) patients in preliminary studies [2]
GLP-26 is a HBV capsid assembly modulators (CAM), inhibits HBVDNA replication in Hep AD38 system (IC50=3 nM), and reduces cccDNA by >90% at 1 μM.
GLP-26 disrupts the encapsidation of pre-genomic RNA, causes nucleocapsid disassembly and reduces cccDNA pools . GLP-26 is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.
Inarigivir (ORI-9020) is a dinucleotide antiviral drug that can significantly reduce liver HBVDNA in transgenic mice expressing hepatitis B virus. Inarigivir (ORI-9020) act as a RIG-I agonist to activate cellular innate immune responses .
Oleana-2,12-dien-28-oic acid is an HBV-DNA inhibitor, HBsAg and HBeAg inhibitor. Oleana-2,12-dien-28-oic acid can be used in hepatitis B virus infection disease research .
Mulberrofuran G protects ischemic injury-induced cell death via inhibition of NOX4-mediated ROS generation and ER stress . Mulberrofuran G shows moderate inhibiting activity of hepatitis B virus (HBV) DNA replication with IC50 of 3.99 μM .
Clevudine (L-FMAU), a nucleoside analog of the unnatural L-configuration, has potent anti-HBV activity with long half-life, low toxicity. Clevudine is a non-competitive inhibitor that is not incorporated into the viral DNA but rather binds to the polymerase. Clevudine is active against cowpox virus respiratory infection in mice .
Inarigivir (ORI-9020) ammonium is a dinucleotide antiviral drug that can significantly reduce liver HBVDNA in transgenic mice expressing hepatitis B virus. Inarigivir (ORI-9020) ammonium acts as a RIG-I (Retinoic acid-inducible gene-I) agonist to activate cellular innate immune responses .
HBV-IN-10 is an enantiomer of compound 6 (WO2021204258A1). Compound 6 is a hepatitis B surface antigen (HBsAg) inhibitor (0.001 μM< EC50 ≤0.05 μM). From patent WO2021204258A1, compound 6 .
(5S,8R)-HBV-IN-10 is an enantiomer of compound 6 (WO2021204258A1). Compound 6 is a hepatitis B surface antigen (HBsAg) inhibitor (0.001 μM< EC50 ≤0.05 μM). From patent WO2021204258A1, compound 6 .
AZT triphosphate (3'-Azido-3'-deoxythymidine-5'-triphosphate) is a active triphosphate metabolite of Zidovudine (AZT). AZT triphosphate exhibits antiretroviral activity and inhibits replication of HIV. AZT triphosphate also inhibits the DNA polymerase of HBV. AZT triphosphate activates the mitochondria-mediated apoptosis pathway .
Vebicorvir (ABI-H0731) is a first-generation hepatitis B virus (HBV) core protein inhibitor. Vebicorvir (ABI-H0731) suppresses covalently closed circular DNA (cccDNA) formation in two de novo infection models with EC50s from 1.84 μM to 7.3 μM .
AZT triphosphate (3'-Azido-3'-deoxythymidine-5'-triphosphate) TEA is a active triphosphate metabolite of Zidovudine (AZT). AZT triphosphate TEA exhibits antiretroviral activity and inhibits replication of HIV. AZT triphosphate TEA also inhibits the DNA polymerase of HBV. AZT triphosphate TEA activates the mitochondria-mediated apoptosis pathway .
AZT triphosphate (3'-Azido-3'-deoxythymidine-5'-triphosphate) tetraammonium is an active triphosphate metabolite of Zidovudine (AZT). AZT triphosphate tetraammonium exhibits antiretroviral activity and inhibits replication of HIV. AZT triphosphate tetraammonium also inhibits the DNA polymerase of HBV. AZT triphosphate tetraammonium activates the mitochondria-mediated apoptosis pathway .
Mulberrofuran G protects ischemic injury-induced cell death via inhibition of NOX4-mediated ROS generation and ER stress . Mulberrofuran G shows moderate inhibiting activity of hepatitis B virus (HBV) DNA replication with IC50 of 3.99 μM .
Oxynitidine is an HBV inhibitor (ID50=30.8 µg/mL), which can effectively inhibit the DNA replication activity of HBV. Oxynitidine can be used in the study of viral infections .
Junceellolide C is a transcription inhibitor of cccDNA. Junceellolide C inhibits HBVDNA replication and significantly decreases the level of supernatant HBV RNA with EC50 values of 5.19, 3.52 μM respectively in HepAD38 cells. Junceellolide C is a potent anti-HBV agent .
Protein cereblon; CRBN; AD-006; DNA damage-binding protein 1; DDB p127 subunit; XAP1; UV-damaged DNA-binding factor; HBV X-associated protein 1 (XAP-1); Damage-specific DNA-binding protein 1; DDBa
Protein cereblon; CRBN; AD-006; DNA damage-binding protein 1; DDB p127 subunit; XAP1; UV-damaged DNA-binding factor; HBV X-associated protein 1 (XAP-1); Damage-specific DNA-binding protein 1; DDBa
Protein cereblon; CRBN; AD-006; DNA damage-binding protein 1; DDB p127 subunit; XAP1; UV-damaged DNA-binding factor; HBV X-associated protein 1 (XAP-1); Damage-specific DNA-binding protein 1; DDBa
Adefovir-d4 is the deuterium labeled Adefovir. Adefovir (GS-0393) is an adenosine monophosphate analog antiviral agent that after intracellular conversion to Adefovir diphosphate inhibits HBVDNA polymerase. Adefovir has an IC50 of 0.7 μM against HBV in the HepG2.2.15 cell line. Adefovir has good antiviral activity against several viruses, including HBV and herpesviruses[1][2][3].
GLP-26 is a HBV capsid assembly modulators (CAM), inhibits HBVDNA replication in Hep AD38 system (IC50=3 nM), and reduces cccDNA by >90% at 1 μM.
GLP-26 disrupts the encapsidation of pre-genomic RNA, causes nucleocapsid disassembly and reduces cccDNA pools . GLP-26 is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBVDNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .
Clevudine (L-FMAU), a nucleoside analog of the unnatural L-configuration, has potent anti-HBV activity with long half-life, low toxicity. Clevudine is a non-competitive inhibitor that is not incorporated into the viral DNA but rather binds to the polymerase. Clevudine is active against cowpox virus respiratory infection in mice .
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBVDNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
Inquiry Online
Your information is safe with us. * Required Fields.
