1. Search Result
Search Result
Results for "

RNA oligonucleotides

" in MedChemExpress (MCE) Product Catalog:

40

Inhibitors & Agonists

4

Fluorescent Dye

2

Biochemical Assay Reagents

3

Natural
Products

31

Oligonucleotides

Cat. No. Product Name Target Research Areas Chemical Structure
  • HY-W115309

    5'-DMT-2'-F-ibu-dG

    Nucleoside Antimetabolite/Analog Others
    DMT-2'-F-iBu-G (5'-DMT-2'-F-ibu-dG) is a modified oligonucleotide. 2'-deoxy-2'-fluoro-modified oligonucleotides shows high nuclease resistant and retained exceptional binding affinity to the RNA targets .
    DMT-2'-F-iBu-G
  • HY-21997

    DNA/RNA Synthesis Others
    Dmt-2'fluoro-da(bz) amidite, an uniformly modified 2'-deoxy-2'-fluoro phosphorothioate oligonucleotide, is a nuclease-resistant antisense compound with high affinity and specificity for RNA targets. Dmt-2'fluoro-da(bz) amidite is also an intermediate for 5’-DMT-3’-phosphoramidite synthesis .
    DMT-2'fluoro-da(bz) amidite
  • HY-160230

    Toll-like Receptor (TLR) Infection
    ssRNA41 sodium is a 20-mer phosphothioate protected single-stranded RNA oligonucleotide. It derives from ssRNA40 by replacement of all U nucleotides with adenosine. ssRNA41 sodium is unable to induce the production of type IFNs, and therefore can be used as a negative control for ssRNA40 .
    ssRNA41 sodium
  • HY-157091

    Nucleoside Antimetabolite/Analog Others
    Uridine, 5'-(P,P',P'',P''-tetrahydrogen imidotriphosphate) is a non-hydrolyzable nucleotide that can synthesize RNA oligonucleotides .
    Uridine, 5'-(P,P',P'',P''-tetrahydrogen imidotriphosphate)
  • HY-D1409

    DMTr-4'-F-uridine-CED-TBDMS phosphoramidite

    DNA Stain Cardiovascular Disease
    DMTr-4'-F-U-CED-TBDMS phosphoramidite (DMTr-4'-F-uridine-CED-TBDMS phosphoramidite), a dye reagent for oligonucleotide labeling, can be used for the research of applications in RNA therapeutics, RNA aptamers, and ribozymes for elucidating RNA structure. DMTr-4'-F-U-CED-TBDMS phosphoramidite represents a probe with wide utility for elucidation of RNA structure .
    DMTr-4'-F-U-CED-TBDMS phosphoramidite
  • HY-D1408

    DMTr-4'-Methyluridine-CED-TBDMS phosphoramidite

    DNA Stain Cardiovascular Disease
    DMTr-4'-Me-U-CED-TBDMS phosphoramidite (DMTr-4'-Methyluridine-CED-TBDMS phosphoramidite), a dye reagent for oligonucleotide labeling, can be used for the research of applications in RNA therapeutics, RNA aptamers, and ribozymes for elucidating RNA structure. DMTr-4'-Me-U-CED-TBDMS phosphoramidite represents a probe with wide utility for elucidation of RNA structure .
    DMTr-4'-Me-U-CED-TBDMS phosphoramidite
  • HY-160231

    Toll-like Receptor (TLR) Inflammation/Immunology
    ssRNA42 (sodium) is a 20-mer phosphothioate protected single-stranded RNA oligonucleotide. ssRNA42 (sodium) derives from ssRNA40 by replacement of all G nucleotides with adenosine. ssRNA42 activated human PBMCs to secrete IFN-α, TNF-a, IL- 12p40, and IL-6, but ssRNA42 failed to stimulated murine pDCs and PBMCs.
    ssRNA42 sodium
  • HY-139099

    Gp3G

    Nucleoside Antimetabolite/Analog DNA/RNA Synthesis Cancer
    Diguanosine 5′-triphosphate (Gp3G) is a dinucleoside triphosphates. Diguanosine 5′-triphosphate also is a virus-specific oligonucleotide. Diguanosine 5′-triphosphate is needed for the synthesis of RNA during the transcription process .
    Diguanosine 5′-triphosphate
  • HY-139099A

    Gp3G lithium

    DNA/RNA Synthesis Nucleoside Antimetabolite/Analog Cancer
    Diguanosine 5′-triphosphate (Gp3G) lithium is a dinucleoside triphosphates. Diguanosine 5′-triphosphate lithium also is a virus-specific oligonucleotide. Diguanosine 5′-triphosphate lithium is needed for the synthesis of RNA during the transcription process .
    Diguanosine 5′-triphosphate lithium
  • HY-D1411

    DMTr-4'-CF3-5-Methyluridine-CED phosphoramidite

    DNA Stain Others
    DMTr-4'-CF3-5-Me-U-CED phosphoramidite (DMTr-4'-CF3-5-Methyluridine-CED phosphoramidite), the modified oligodeoxynucleotide (ODN), is a dye reagent for oligonucleotide labeling, can be used for the research of applications in RNA research .
    DMTr-4'-CF3-5-Me-U-CED phosphoramidite
  • HY-D0093
    Ethidium homodimer
    3 Publications Verification

    EthD-1

    DNA Stain Others
    Ethidium homodimer (EthD-1) is a high-affinity fluorescent nucleic acid dye commonly used to stain mammals, bacteria, yeast, and fungi. Ethidium homodimer binds to DNA or RNA, enhancing fluorescence more than 30 times. The Ethidium homodimer has a strong positive charge, so it cannot cross cell membranes and stain living cells; But the Ethidium homodimer can cross the disordered region of the dead cell membrane to reach the nucleus and embed the DNA double strand to produce red fluorescence. Therefore, Ethidium homodimer is a relatively sensitive nucleic acid stain that can accurately detect nucleic acids in solution or in decomposing cells. Ethidium homodimer binds DNA, Ex/Em=528/617 nm .
    Ethidium homodimer
  • HY-153836

    Factor Xa Others
    Anivamersen is an RNA aptamer to reverse the anticoagulant effect of the parenteral factor IXa inhibitor pegnivacogin. REG1 is a novel anticoagulation system consisting of pegnivacogin, an RNA aptamer inhibitor of coagulation factor IXa, and anivamersen, a complementary sequence reversal oligonucleotide.
    Anivamersen
  • HY-153836A

    Factor Xa Others
    Anivamersen sodium is an RNA aptamer to reverse the anticoagulant effect of the parenteral factor IXa inhibitor pegnivacogin. REG1 is a novel anticoagulation system consisting of pegnivacogin, an RNA aptamer inhibitor of coagulation factor IXa, and anivamersen, a complementary sequence reversal oligonucleotide.
    Anivamersen sodium
  • HY-147217

    ISIS 505358

    HBV Infection
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen
  • HY-147217A

    ISIS 505358 sodium

    HBV Infection
    Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen sodium
  • HY-112980A
    Nusinersen sodium
    1 Publications Verification

    DNA/RNA Synthesis Inflammation/Immunology
    Nusinersen sodium is an antisense oligonucleotide agent that modifies pre–messenger RNA splicing of the SMN2 gene and thus promotes increased production of full-length SMN protein .
    Nusinersen sodium
  • HY-112980
    Nusinersen
    1 Publications Verification

    DNA/RNA Synthesis Inflammation/Immunology
    Nusinersen is an antisense oligonucleotide agent that modifies pre–messenger RNA splicing of the SMN2 gene and thus promotes increased production of full-length SMN protein .
    Nusinersen
  • HY-12854

    GRN163L

    Telomerase Cancer
    Imetelstat is an 13‐mer oligonucleotide that binds with high affinity to the template region of the RNA component of human telomerase and acts as a competitive inhibitor of human telomerase enzymatic activity .
    Imetelstat
  • HY-145980

    Nucleoside Antimetabolite/Analog Others
    m7GpppUpG, an oligonucleotide, is an M 7GpppNpG trinucleotide cap analogue. m7GpppUpG can be used as a chemical tool enabling manufacturing of RNA featuring either cap 0 or cap 1 structures .
    m7GpppUpG
  • HY-145982

    Nucleoside Antimetabolite/Analog Others
    m7GpppCmpG, an oligonucleotide, is an M 7GpppNpG trinucleotide cap analogue. m7GpppCmpG can be used as a chemical tool enabling manufacturing of RNA featuring either cap 0 or cap 1 structures .
    m7GpppCmpG
  • HY-145979

    Nucleoside Antimetabolite/Analog Others
    m7GpppUmpG, an oligonucleotide, is an M 7GpppNpG trinucleotide cap analogue. m7GpppUmpG can be used as a chemical tool enabling manufacturing of RNA featuring either cap 0 or cap 1 structures .
    m7GpppUmpG
  • HY-145981

    Nucleoside Antimetabolite/Analog Others
    m7GpppCpG, an oligonucleotide, is an M 7GpppNpG trinucleotide cap analogue. m7GpppCpG can be used as a chemical tool enabling manufacturing of RNA featuring either cap 0 or cap 1 structures .
    m7GpppCpG
  • HY-148828

    iGluR Neurological Disease
    LSP-GR3 is a novel chemically-modified RNA oligonucleotides, called splice modulating oligomers (SMOs), which potently and specifically modulate GluR alternative splicing to GluR3-flip expression throughout the CNS.
    LSP-GR3
  • HY-148828A

    iGluR Neurological Disease
    LSP-GR3 sodium is a novel chemically-modified RNA oligonucleotides, called splice modulating oligomers (SMOs), which potently and specifically modulate GluR alternative splicing to GluR3-flip expression throughout the CNS.
    LSP-GR3 sodium
  • HY-160229

    R-1075 sodium

    Toll-like Receptor (TLR) Infection
    ssRNA40 (sodium) is a 20-mer phosphothioate protected single-stranded RNA oligonucleotide. ssRNA40 is a uridine-rich ssRNA derived from the HIV-1 long terminal repeat on activation of NK cells via TLR7/8 [1][2].
    ssRNA40 sodium
  • HY-132608

    ISIS-420915 sodium

    Transthyretin (TTR) Neurological Disease
    Inotersen (ISIS-420915) sodium is a 2′-O-methoxyethyl-modified antisense oligonucleotide. Inotersen sodium inhibits the production of transthyretin (TTR) protein by targeting the TTR RNA transcript and reduces the levels of the TTR transcript. Inotersen sodium can be used for the research of hereditary TTR amyloidosis polyneuropathy .
    Inotersen sodium
  • HY-78574

    Nucleoside Antimetabolite/Analog Others
    N-Benzoylcytidine is a substrate for uracil-cytidine kinase 1 (UCK1) and UCK2. N-Benzoylcytidine can be used to synthesize 2-OH protective groups for solid-phase RNA synthesis,as well as synthetic oligonucleotides for UV induction and targeted gene silencing in zebrafish embryos .
    N-Benzoylcytidine
  • HY-148100A

    NOX-E36 sodium

    CCR Cancer
    Emapticap pegol sodium is a inhibitor of pro-inflammatory chemokine C-C motif-ligand 2 (CCL2). Emapticap pegol sodium is a 40-nucleotide oligonucleotide aptamer, displays different Spiegelmers (L-RNA aptamer) isform in human (NOX-E36) and mouse (mNOX-E36) .
    Emapticap pegol sodium
  • HY-148100

    NOX-E36

    CCR Inflammation/Immunology Cancer
    Emapticap pegol is a inhibitor of pro-inflammatory chemokine C-C motif-ligand 2 (CCL2). Emapticap pegol is a 40-nucleotide oligonucleotide aptamer, displays different Spiegelmers (L-RNA aptamer) isform in human (NOX-E36) and mouse (mNOX-E36) .
    Emapticap pegol
  • HY-B0956
    Paromomycin sulfate
    3 Publications Verification

    Aminosidine sulfate

    Antibiotic Parasite Bacterial Infection
    Paromomycin (Aminosidine) sulfate, a neomycin (HY-B0470) derivative, is a broad spectrum aminoglycoside antibiotic with amebicidal and bactericidal effects. Paromomycin sulfate prematures termination of translation of mRNA and inhibits protein synthesis by specifically binds to the RNA oligonucleotide at the A site of bacterial 30S ribosomes. Paromomycin sulfate can be used for the research of bacterial and parasitic infections .
    Paromomycin sulfate
  • HY-W570888

    LNA-C(Bz)

    Nucleoside Antimetabolite/Analog Cancer
    2'-O,4'-C-Methylenecytidine (LNA-C(Bz)) is a bicyclic nucleoside analogue with fixed N-type conformation. 2'-O,4'-C-Methylenecytidine can be used to synthesize oligonucleotides. 2'-O,4'-C-Methylenecytidine forms duplexes with complementary DNA and RNA strands .
    2'-O,4'-C-Methylenecytidine
  • HY-138577

    DNA/RNA Synthesis Nucleoside Antimetabolite/Analog Others
    2'-F-Bz-dC Phosphoramidite can be used in the synthesis of oligoribonucleotide (such as DNA and RNA). 2'-F-Bz-dC Phosphoramidite also used for synthesis antiviral agent to inhibit the replication of virus. 2'-F-Bz-dC Phosphoramidite contains a phosphorothioate backbone, to synthesise antisense oligonucleotide analogs to induce apoptosis in cancer cells .
    2'-F-Bz-dC Phosphoramidite
  • HY-P0229

    RNAse T1

    DNA/RNA Synthesis Others
    Ribonulease T1, Aspergillus oryzae (Rnase T1), is commonly used in biochemical research. Ribonuclease T1 is an endonuclease that can specifically degrade single stranded RNA. Ribonuclease T1 can form nucleoside 2 ', 3 '-cyclic phosphoric acid intermediates to cut the phosphodiester bond between 3' -guanosine residues and adjacent nucleoside 5 '-OH groups to produce 3' -GMP terminal oligonucleotides .
    Ribonuclease T1, Aspergillus oryzae
  • HY-D0150
    Thiazole Orange
    1 Publications Verification

    Fluorescent Dye Others
    Thiazole Orange is an asymmetric anthocyanin dye that can be coupled with oligonucleotides (ONs) to prepare fluorescent hybridization probes. Thiazole Orange has been widely used in biomolecular detection and staining of DNA/ RNA in gels and can be used for reticulocyte analysis. Thiazole orange generates a significant fluorescence enhancement and high quantum yield when it binds with nucleic acids, especially RNA. Thiazole orange can permeate living cell membranes. Thiazole orange can use UV light for detection, but can also be detected with blue light. The excitation and emission of Thiazole orange are λex = 510 nm (488 nm and 470 nm also show strong excitation) and λem = 527 nm, respectively .
    Thiazole Orange
  • HY-147412

    QR-421a

    Nucleoside Antimetabolite/Analog Others
    Ultevursen (QR-421a) is a single-stranded RNA based oligonucleotide that is designed to skip exon 13 in the RNA with the aim to stop vision loss in people that have retinitis pigmentosa due to a mutation in exon 13 of the USH2A gene (encoding usherin). Ultevursen sequence: (P-thio)[2′-O-(2-methoxyethyl)](A-G-m 5C-m 5U-m 5U-m 5C-G-G-A-G-A-A-A-m 5U-m 5U-m 5U-A-A-A-m 5U-m 5C) .
    Ultevursen
  • HY-N0677AR

    Antibiotic Infection Inflammation/Immunology Cancer
    Paromomycin (sulfate) (Standard) is the analytical standard of Paromomycin (sulfate). This product is intended for research and analytical applications. Paromomycin (Aminosidine) sulfate, a neomycin (HY-B0470) derivative, is a broad spectrum aminoglycoside antibiotic with amebicidal and bactericidal effects. Paromomycin sulfate prematures termination of translation of mRNA and inhibits protein synthesis?by specifically binds to the RNA oligonucleotide at the A site of bacterial 30S ribosomes. Paromomycin sulfate can be used for the research of bacterial and parasitic infections .
    Kalii Dehydrographolidi Succinas (Standard)
  • HY-P0229A

    RNAse T1 (animal free)

    DNA/RNA Synthesis Others
    Ribonuclease T1 (animal free) (Rnase T1 (animal free)) (EC 4.6.1.24) is an endonuclease that specifically degrades single-stranded RNA. Ribonuclease T1 forms a nucleoside 2′, 3′-cyclic phosphate intermediate to cleave the phosphodiester bond between the 3′-guanosine residue and the 5′-OH group of the adjacent nucleoside to produce a 3′-GMP-terminated oligonucleotide. This product does not contain ingredients of animal origin .
    Ribonuclease T1 (animal free)
  • HY-B0956R

    Antibiotic Parasite Bacterial Infection
    Paromomycin (sulfate) (Standard) is the analytical standard of Paromomycin (sulfate). This product is intended for research and analytical applications. Paromomycin (Aminosidine) sulfate, a neomycin (HY-B0470) derivative, is a broad spectrum aminoglycoside antibiotic with amebicidal and bactericidal effects. Paromomycin sulfate prematures termination of translation of mRNA and inhibits protein synthesis?by specifically binds to the RNA oligonucleotide at the A site of bacterial 30S ribosomes. Paromomycin sulfate can be used for the research of bacterial and parasitic infections .
    Paromomycin (sulfate) (Standard)
  • HY-W039442

    Nucleoside Antimetabolite/Analog Cancer
    2′-Deoxy-2′-fluoroadenosine can be used for the synthesis of 2′-Deoxy-2′-fluoro-modified oligonucleotides hybridized with RNA. 2′-Deoxy-2′-fluoroadenosine can be cleaved efficiently by E. coli purine nucleoside phosphorylase (PNP) to the toxic agent 2-fluoroadenine (FAde). 2′-Deoxy-2′-fluoroadenosine shows excellent in vivo activity against tumors expressing E. coli PNP .
    2′-Deoxy-2′-fluoroadenosine
  • HY-160222

    HSV STING Infection Inflammation/Immunology
    HSV-60mer sodium is a 60 bp double-stranded oligonucleotide containing viral DNA motifs that derive from the herpes simplex virus 1 (HSV-1) genome . Transfected HSV-60 has been shown to potently induce IFN-β in a Toll-like receptor (TLR)-, DNA-dependent activator of IRFs (DAI)-, and RNA polymerase III (Pol III)-independent, but STING-, TBK1- and IFN regulatory factor 3 (IRF3)-dependent manner.
    HSV-60mer sodium

Inquiry Online

Your information is safe with us. * Required Fields.

Salutation

 

Country or Region *

Applicant Name *

 

Organization Name *

Department *

     

Email Address *

 

Product Name *

Cat. No.

 

Requested quantity *

Phone Number *

     

Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: