1. Search Result
Search Result
Results for "

RNA targets

" in MedChemExpress (MCE) Product Catalog:

82

Inhibitors & Agonists

6

Screening Libraries

2

Fluorescent Dye

2

Biochemical Assay Reagents

4

Peptides

1

Inhibitory Antibodies

7

Natural
Products

1

Click Chemistry

28

Oligonucleotides

Cat. No. Product Name Target Research Areas Chemical Structure
  • HY-132587A

    ALN-AT3SC sodium; SAR439774 sodium

    Factor Xa Others
    Fitusiran sodium, an small interfering RNA, specifically targets antithrombin (AT) messenger RNA to lower production of AT in the liver. Fitusiran sodium increases thrombin generation and has the potential for the research of the hemophilia .
    Fitusiran sodium
  • HY-133522

    Fluorescent Dye Others
    HBC525 is a HBC-like fluorophore and a fluorogenic RNA aptamer (Kd=3.8 nM). HBC525 can be directly used as fusion tags for the imaging and tracking of cellular RNAs of interest. Fluorogenic RNA aptamers have also been used to construct various interesting dynamic RNA nanodevices for cellular target detection and imaging .
    HBC525
  • HY-139682

    PROTACs Cancer
    Dovitinib RIBOTAC is a targeted RNA degrader that cleaves pre-miR-21 with enhanced potency and selectivity.
    Dovitinib-RIBOTAC
  • HY-D0971
    Pyronin Y
    3 Publications Verification

    Pyronine G; C.I. 45005

    DNA Stain Others
    Pyronin Y (Pyronine G) is a cationic dye that intercalates RNA and has been used to target cell structures including RNA, DNA and organelles. Pyronin Y forms fluorescent complexes with double-stranded nucleic acids (especially RNA) enabling semi-quantitative analysis of cellular RNA. Pyronin Y can be used to identify specific RNA subspecies of ribonuclear proteins complexes in live cells .
    Pyronin Y
  • HY-W115309

    5'-DMT-2'-F-ibu-dG

    Nucleoside Antimetabolite/Analog Others
    DMT-2'-F-iBu-G (5'-DMT-2'-F-ibu-dG) is a modified oligonucleotide. 2'-deoxy-2'-fluoro-modified oligonucleotides shows high nuclease resistant and retained exceptional binding affinity to the RNA targets .
    DMT-2'-F-iBu-G
  • HY-P2548

    EGFR Others
    pp60 (v-SRC) Autophosphorylation Site, Phosphorylated is the phosphorylated peptide of an EGFR substrate. pp60 (v-SRC) Autophosphorylation Site, Phosphorylated can be used for the screening of EGFR Kinase inhibitors via phosphorylated-substrate quantification .
    pp60 (v-SRC) Autophosphorylation Site, Phosphorylated
  • HY-N144101

    SARS-CoV Infection
    SARS-CoV MPro-IN-2 (compound 15) is a potent inhibitor of SARS-CoV-2 M pro with an IC50 value of 72.07 nM. The main protease (M pro) of the virus as the major enzyme processing viral polyproteins contributes to the replication and transcription of SARS-CoV-2 in host cells, and has been characterized as an attractive target in agent discovery. SARS-CoV MPro-IN-2 has the potential for the research of COVID-19 .
    SARS-CoV MPro-IN-2
  • HY-148904

    Others Others
    Allylic-SAM is an S-adenosyl methionine (SAM) analog for the enrichment and detection of methyltransferase target sites in RNA.
    Allylic-SAM
  • HY-162504

    SARS-CoV Infection
    2'-RIBOTAC-U is a ribonuclease (RNase) targeting chimeras (RIBOTACs) and SARS-CoV-2 replication inhibitor. 2'-RIBOTAC-U is composed of a metabolic handle (Blue), a linker (Black) and a RNase L recruiter (Pink). RIBOTACs recruits cellular RNases to specific RNA targets, thereby leading to the degradation of these RNAs .
    2'-RIBOTAC-U
  • HY-132587

    ALN-AT3SC; SAR439774

    Small Interfering RNA (siRNA) Factor Xa Others
    Fitusiran (ALN-AT3SC), an small interfering RNA, specifically targets antithrombin (AT) messenger RNA to lower production of AT in the liver. Fitusiran increases thrombin generation and has the potential for the research of the hemophilia .
    Fitusiran
  • HY-150224

    Small Interfering RNA (siRNA) Factor Xa Others
    GalNAc unconjugated/naked Fitusiran (sodium), an small interfering RNA without GalNAc conjugation, specifically targets antithrombin (AT) messenger RNA to lower production of AT in the liver. Fitusiran increases thrombin generation and has the potential for the research of the hemophilia .
    GalNAc unconjugated/naked Fitusiran sodium
  • HY-139682A

    PROTACs Cancer
    Dovitinib RIBOTAC TFA is a targeted RNA degrader that cleaves pre-miR-21 with enhanced potency and selectivity.
    Dovitinib-RIBOTAC TFA
  • HY-153483

    SYL040012

    Adrenergic Receptor Small Interfering RNA (siRNA) Others
    Bamosiran is a small interfering RNA targeting β-adrenergic receptor 2, and is used to lower intraocular pressure
    Bamosiran
  • HY-153483A

    SYL040012 sodium

    Adrenergic Receptor Small Interfering RNA (siRNA) Others
    Bamosiran sodium is a small interfering RNA targeting β-adrenergic receptor 2, and is used to lower intraocular pressure
    Bamosiran sodium
  • HY-15843

    MicroRNA Apoptosis Cancer
    MIR96-IN-1 targets the Drosha site in the miR-96 (miRNA-96, microRNA-96) hairpin precursor, inhibiting its biogenesis, derepressing downstream targets, and triggering apoptosis in breast cancer cells. MIR96-IN-1 binds to RNAs with Kds of 1.3, 9.4, 3.4, 1.3 and 7.4 μM for RNA1, RNA2, RNA3, RNA4 and RNA5, respectively . MIR96-IN-1 is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. It can also undergo strain-promoted alkyne-azide cycloaddition (SPAAC) reactions with molecules containing DBCO or BCN groups.
    MIR96-IN-1
  • HY-147217

    ISIS 505358

    HBV Infection
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen
  • HY-132609

    Small Interfering RNA (siRNA) Transthyretin (TTR) Neurological Disease
    Patisiran sodium is a double-stranded small interfering RNA that targets a sequence within the transthyretin (TTR) messenger RNA. Patisiran sodium specifically inhibits hepatic synthesis of mutant and wild-type TTR. Patisiran sodium can be used for the research of hereditary TTR amyloidosis .
    Patisiran sodium
  • HY-150014

    Others Others
    AMT-NHS is an RNA-protein crosslinker. AMT-NHS is composed of a psoralen derivative and an N-hydroxysuccinimide ester group which react with RNA bases and primary amines of protein, respectively. AMT-NHS can penetrate into living yeast cells and crosslink Cbf5 to H/ACA snoRNAs with high specificity. AMT-NHS induces different crosslinking patterns and targets both single- and double-stranded regions of RNA. AMT-NHS can be used for capturing diverse RNA-protein interactions in cells .
    AMT-NHS
  • HY-132607

    CEBPA-51

    MicroRNA Inflammation/Immunology Cancer
    MTL-CEPBA is a small activating RNA targeting for upregulation of C/EBPα. MTL-CEPBA has anti-inflammatory and anti-cancer activity .
    MTL-CEBPA
  • HY-147217A

    ISIS 505358 sodium

    HBV Infection
    Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen sodium
  • HY-132610A
    Givosiran sodium
    1 Publications Verification

    ALN-AS1 sodium

    Small Interfering RNA (siRNA) Neurological Disease Cancer
    Givosiran sodium is a small interfering RNA that targets hepatic aminolevulinate synthase 1 (ALAS1) messenger RNA. Givosiran sodium downregulates ALAS1 mRNA and prevents accumulation of neurotoxic δ-aminolevulinic acid and porphobilinogen levels. Givosiran sodium can be used for the research of acute intermittent porphyria .
    Givosiran sodium
  • HY-153609

    Transthyretin (TTR) Small Interfering RNA (siRNA) Neurological Disease
    AS-Patisiran sodium is an antisense strand of Patisiran. Patisiran is a double-stranded small interfering RNA that targets a sequence within the transthyretin (TTR) messenger RNA. Patisiran specifically inhibits hepatic synthesis of mutant and wild-type TTR. Patisiran can be used for the research of hereditary TTR amyloidosis .
    AS-Patisiran sodium
  • HY-132610

    ALN-AS1

    Small Interfering RNA (siRNA) Neurological Disease
    Givosiran (ALN-AS1) is a small interfering RNA that targets hepatic aminolevulinate synthase 1 (ALAS1) messenger RNA. Givosiran downregulates ALAS1 mRNA and prevents accumulation of neurotoxic δ-aminolevulinic acid and porphobilinogen levels. Givosiran can be used for the research of acute intermittent porphyria .
    Givosiran
  • HY-128718

    Influenza Virus Infection
    Carbodine (Carbocyclic cytidine) is a broad-spectrum antiviral agent active against DNA viruses, (+)RNA viruses, (-)RNA viruses, paramyxo, rhabdo and (+/-)RNA viruses, targets CTP synthetase that converts UTP to CTP. Carbodine (Carbocyclic cytidine) possesses significant antiviral activity against influenza virus types A0/PR-8/34 and A2/Aichi/2/68 in vitro .
    Carbodine
  • HY-145072

    CDK Cancer
    BSJ-01-175 is a potent and selective CDK12/13 covalent inhibitor. BSJ-01-175 demonstrates exquisite selectivity, potent inhibition of RNA polymerase II phosphorylation, and downregulation of CDK12-targeted genes in cancer cells .
    BSJ-01-175
  • HY-158028

    Influenza Virus Infection
    PAN endonuclease-IN-2 (compound T-31) is a PAN endonuclease inhibitor (IC50: 0.15 μM) and antiviral agent with broad-spectrum anti- Influenza activity. PAN is the N-terminal PA subunit of the polymerase-RNA complex and the dependent endonuclease (CEN) active site. PAN initiates RNA replication by promoting cleavage of the RNA strand and allowing the polymerase to begin synthesizing new RNA molecules. PAN endonuclease-IN-2 targets both the influenza HA and RdRp complexes, thereby interfering with viral entry into host cells and viral replication .
    PAN endonuclease-IN-2
  • HY-157611

    DNA/RNA Synthesis Cancer
    DHX9-IN-17 (186) is a RNA helicase DHX9 inhibitor, with an EC50 of 0.161 μM in DHX9 cellular target engagement. Used in cancer research .
    DHX9-IN-17
  • HY-157612

    DNA/RNA Synthesis Cancer
    DHX9-IN-16 (208) is a RNA helicase DHX9 inhibitor, with an EC50 of 0.125 μM in DHX9 cellular target engagement. Used in cancer research .
    DHX9-IN-16
  • HY-157605

    DNA/RNA Synthesis Cancer
    DHX9-IN-11 (469) is a RNA helicase DHX9 inhibitor, with an EC50 of 0.0838 μM in DHX9 cellular target engagement. Used in cancer research .
    DHX9-IN-11
  • HY-157606

    DNA/RNA Synthesis Cancer
    DHX9-IN-13 (389) is a RNA helicase DHX9 inhibitor, with an EC50 of 3.4 μM in DHX9 cellular target engagement. Used in cancer research .
    DHX9-IN-13
  • HY-157607

    DNA/RNA Synthesis Cancer
    DHX9-IN-15 (287) is a RNA helicase DHX9 inhibitor, with an EC50 of 0.232 μM in DHX9 cellular target engagement. Used in cancer research .
    DHX9-IN-15
  • HY-157604

    DNA/RNA Synthesis Cancer
    DHX9-IN-9 (509) is a RNA helicase DHX9 inhibitor, with an EC50 of 0.0177 μM in DHX9 cellular target engagement. Used in cancer research .
    DHX9-IN-9
  • HY-157610

    DNA/RNA Synthesis Cancer
    DHX9-IN-14 (161) is a RNA helicase DHX9 inhibitor, with an EC50 of 3.4 μM in DHX9 cellular target engagement. Used in cancer research .
    DHX9-IN-14
  • HY-157609

    DNA/RNA Synthesis Cancer
    DHX9-IN-12 (83) is a RNA helicase DHX9 inhibitor, with an EC50 of 0.917 μM in DHX9 cellular target engagement. Used in cancer research .
    DHX9-IN-12
  • HY-157608

    DNA/RNA Synthesis Cancer
    DHX9-IN-10 (49) is a RNA helicase DHX9 inhibitor, with an EC50 of 9.04 μM in DHX9 cellular target engagement. Used in cancer research .
    DHX9-IN-10
  • HY-157603

    DNA/RNA Synthesis Cancer
    DHX9-IN-7 (550) is a RNA helicase DHX9 inhibitor, with an EC50 of 0.105 μM in DHX9 cellular target engagement. Used in cancer research .
    DHX9-IN-7
  • HY-157602

    DNA/RNA Synthesis Cancer
    DHX9-IN-8 (Compound 6) is a RNA helicase DHX9 inhibitor, with an EC50 of 3.4 μM in DHX9 cellular target engagement. Used in cancer research .
    DHX9-IN-8
  • HY-107745

    Opioid Receptor Flavivirus Infection Neurological Disease
    SDM25N hydrochloride, a δ-opioid receptor antagonist, is a potent DENV inhibitor. SDM25N hydrochloride targets the viral NS4B protein and restricts genomic RNA replication .
    SDM25N hydrochloride
  • HY-155110

    Influenza Virus Infection
    Antiviral agent 34 is a potent and orally active antiviral agent against influenza A and B subtypes with an EC50 value of 0.8 nM for H1N1 proliferation. Antiviral agent 34 derivatives inhibited influenza virus proliferation by targeting influenza virus RNA-dependent RNA polymerase. Antiviral agent 34 can be used for influenza virus research .
    Antiviral agent 34
  • HY-163147

    Influenza Virus Infection
    PAN endonuclease-IN-1 (Compound 23) is a potent PAN endonuclease inhibitor, with Kd values of 277 μM, 384 μM and 328 μM for WT, I38T and E23K PAN endonucleases, respectively. The RNA-dependent RNA polymerase acidic N-terminal (PAN) endonuclease, a critical component of influenza viral replication machinery, is an antiviral target .
    PAN endonuclease-IN-1
  • HY-132607A

    CEBPA-51 sodium

    MicroRNA Inflammation/Immunology Cancer
    MTL-CEBPA (sodium) is the sodium form of MTL-CEBPA (HY-132607). MTL-CEBPA (sodium) is a small activating RNA targeting for upregulation of C/EBPα. MTL-CEBPA (sodium) has anti-inflammatory and anti-cancer activity .
    MTL-CEBPA sodium
  • HY-75800
    Lomibuvir
    2 Publications Verification

    VX-222

    DNA/RNA Synthesis HCV Infection
    Lomibuvir (VX-222), a selective, non-nucleoside polymerase inhibitor, targets thumb pocket 2 of the HCV NS5B polymerase (RdRp) with a Kd of 17 nM. Lomibuvir inhibits the 1b/Con1 HCV subgenomic replicon with an EC50 of 5.2 nM. Lomibuvir preferentially inhibits elongative RNA synthesis rather than de novo-initiated RNA synthesis .
    Lomibuvir
  • HY-132606

    DCR-PHXC

    Small Interfering RNA (siRNA) Metabolic Disease
    Nedosiran (DCR-PHXC) is an RNA interference (RNAi) targeting lactate dehydrogenase (LDH). Nedosiran represents an impactful potential therapeutic for primary hyperoxaluria (PH) with end-stage renal disease (ESRD). Nedosiran is a GalNAc-dsRNA conjugate .
    Nedosiran
  • HY-132613

    Small Interfering RNA (siRNA) Metabolic Disease
    Lumasiran sodium, an investigational RNA interference (RNAi) therapeutic agent, reduces hepatic oxalate production by targeting glycolate oxidase. Lumasiran sodium reduces urinary oxalate excretion, the cause of progressive kidney failure in primary hyperoxaluria type 1 (PH1) .
    Lumasiran sodium
  • HY-153238

    Parasite Infection
    AN15368 is an orally active small-molecule precursor that can be activated by parasite carboxypeptidase to produce a compound that targets the messenger RNA processing pathway in T. cruzi. cruzi. AN15368 has the potential to prevent and research Chagas disease potential .
    AN15368
  • HY-106312A

    LY122772

    Enterovirus Infection
    Enviroxime (LY122772) is an antiviral compound that inhibits the replication of rhinoviruses and enteroviruses. Enviroxime blocks the replication of plus-strand viral RNA by targeting the viral 3A coding region. Enviroxime can be a useful tool for investigating the natural function of the 3A protein .
    Enviroxime
  • HY-B0438
    Spectinomycin dihydrochloride
    3 Publications Verification

    Bacterial Antibiotic Infection
    Spectinomycin dihydrochloride is a broad-spectrum antibiotic and inhibits the growth of a variety of gram-positive and gram-negative organisms. Spectinomycin dihydrochloride acts by selectively targeting to the bacterial ribosome and interrupting protein synthesis. Spectinomycin dihydrochloride is also a noncompetitive inhibitor of td intron RNA with an Ki value of 7.2 mM - .
    Spectinomycin dihydrochloride
  • HY-B1828

    Antibiotic Bacterial Infection
    Spectinomycin is a broad-spectrum antibiotic and inhibits the growth of a variety of gram-positive and gram-negative organisms. Spectinomycin acts by selectively targeting to the bacterial ribosome and interrupting protein synthesis. Spectinomycin is also a noncompetitive inhibitor of td intron RNA .
    Spectinomycin
  • HY-156782

    DNA/RNA Synthesis Cancer
    DHX9-IN-1 (example 160) is an inhibitor of ATP-dependent RNA helicase A (DHX9), with an EC50 value of 6.94 μM in DHX9 cellular target engagement. DHX9-IN-1 has antitumor activity .
    DHX9-IN-1
  • HY-161946

    Apoptosis Cancer
    GBM CSCs-IN-1 (Compound (−)-20), a derivative of rocaglate, is a potent inhibitor of glioblastoma stem cells (GBM CSCs) with an EC50 of 45 nM, functioning by targeting the RNA helicase DDX3. Furthermore, GBM CSCs-IN-1 is also capable of inducing apoptosis .
    GBM CSCs-IN-1

Inquiry Online

Your information is safe with us. * Required Fields.

Salutation

 

Country or Region *

Applicant Name *

 

Organization Name *

Department *

     

Email Address *

 

Product Name *

Cat. No.

 

Requested quantity *

Phone Number *

     

Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: