Search Result

Results for "

Tau

" in MedChemExpress (MCE) Product Catalog:

By Targets:	Tau Protein (63) AAK1 (1) Adenosine Receptor (1) Amyloid-β (22) Androgen Receptor (2) Apoptosis (11) Autophagy (5) Bacterial (1) Beclin1 (1) Beta-secretase (1) Caspase (1) CDK (4) Cholinesterase (ChE) (12) Dengue virus (1) Deubiquitinase (2) Dopamine Receptor (1) DYRK (6) Ferroptosis (2) Flavivirus (1) Fungal (1) GLUT (1) GSK-3 (15) Guanylate Cyclase (4) HDAC (6) Histamine Receptor (2) HSP (3) Ligands for E3 Ligase (1) Ligands for Target Protein for PROTAC (1) MARK (1) MicroRNA (1) Microtubule/Tubulin (14) Monoamine Oxidase (5) Necroptosis (1) NO Synthase (4) OGA (1) Orexin Receptor (OX Receptor) (1) Phosphatase (4) Pim (1) PKC (2) PPAR (3) PROTACs (2) Proteasome (2) Ras (1) Reactive Oxygen Species (2) RIP kinase (2) Sodium Channel (1) Somatostatin Receptor (1) TGF-β Receptor (1) TNF Receptor (2) α-synuclein (4)
By Research Areas:	Cancer (24) Cardiovascular Disease (1) Infection (6) Inflammation/Immunology (12) Metabolic Disease (3) Neurological Disease (128)
Click Chemistry:	Alkynes (1)
Oligonucleotides:	Antisense Oligonucleotides (2)

147

Inhibitors & Agonists

Screening Libraries

Fluorescent Dye

Biochemical Assay Reagents

Peptides

Inhibitory Antibodies

Natural
Products

Recombinant Proteins

Antibodies

Click Chemistry

Oligonucleotides

Tau Peptide (275-305) (Repeat 2 domain)	Tau Protein	Neurological Disease
Tau Peptide (275-305) (Repeat 2 domain) is the Alzheimer's tau fragment R2, corresponding to the second repeat unit of the microtubule-binding domain, which is believed to be pivotal to the biochemical properties of full tau protein .

Tau-aggregation and neuroinflammation-IN-1	Microtubule/Tubulin	Neurological Disease Inflammation/Immunology
Tau-aggregation and neuroinflammation-IN-1 is a potent *tau-aggregation* and neuroinflammation inhibitor. Tau-aggregation and neuroinflammation-IN-1 exhibits remarkable inhibitory activities against AcPHF6 and full-length tau aggregation. Tau-aggregation and neuroinflammation-IN-1 has a low cytotoxicity and reduced NO release in LPS-stimulated BV2 cells. Tau-aggregation and neuroinflammation-IN-1 can reverse okadaic acid-induced memory impairment in rats .

Tau protein (592-597), human TFA	Tau Protein	Neurological Disease
Tau protein (592-597), human TFA is a peptide fragment of human Tau protein. The dysfunction of Tau protein is involved in neurodegeneration and dementia .

Tau tracer 2 Pl-2620	Microtubule/Tubulin	Neurological Disease
Tau tracer 2 (Pl-2620) is a Tau tracer used for imaging Tau protein aggregates. Tau tracer 2 can be used to diagnose neurodegenerative diseases .

TAU-IN-1	Tau Protein	Neurological Disease
TAU-IN-1 (compound 051) is a *TAU* protein inhibitor with an EC₅₀ value of 325 nM. TAU-IN-1 can be used in the study of neurodegenerative diseases .

TAU-IN-2	Tau Protein	Neurological Disease
TAU-IN-2 (Example 25) is a *TAU* inhibitor with an EC₅₀ value of 7.7 nM. TAU-IN-2 can be used in the study of neurodegenerative diseases .

tau protein/α-synuclein-IN-1	α-synuclein	Neurological Disease
tau protein/α-synuclein-IN-1 is a dual inhibitor of tau protein and α-synuclein. tau protein/α-synuclein-IN-1 reduces α-syn inclusions development in M17D neuroblastoma cells. tau protein/α-synuclein-IN-1 can be used in study Alzheimer’s disease .

Tau protein aggregation-IN-1	Tau Protein	Neurological Disease
Tau protein aggregation-IN-1 (Compound 0c) is a Tau protein aggregation inhibitor. Tau protein aggregation-IN-1 can be used in the study of protein folding disorders such as Alzheimer's disease, dementia, Parkinson's disease, Huntington's disease and prion-based spongiform encephalopathies .

Tau tracer 1	Microtubule/Tubulin	Neurological Disease
Tau tracer 1 is a Tau tracer used for imaging Tau protein aggregates. Tau tracer 1 can be used to diagnose neurodegenerative diseases .

Tau-aggregation-IN-3	Tau Protein	Neurological Disease
Tau-aggregation-IN-3 (compound 9) a *Tau* protein aggregation inhibitor (TAI). Tau-aggregation-IN-3 shows activity in cell-based aggregation inhibition experiments (EC₅₀=4.816 μM). Tau-aggregation-IN-3 can be used in Alzheimer's disease research .

Tau ASO-12 (murine) (sodium)	Tau Protein	Cancer
Tau ^ASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (Tau ^ASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )

Tau-aggregation-IN-1	Microtubule/Tubulin Dopamine Receptor	Neurological Disease
Tau-aggregation-IN-1 (Compound D-519) is a *tau441* protein aggregation inhibitor with an IC₅₀ of 21 µM. Tau-aggregation-IN-1 is also a dopamine D₂ and D₃ receptor agonist .

Tau Peptide (273-284)	Tau Protein	Neurological Disease
Tau Peptide (273-284) is aTau fragment.

Tau Peptide (379-408)	Tau Protein	Neurological Disease
Tau Peptide (379-408) is aTau fragment.

Tau conotoxin CnVA	Somatostatin Receptor	Cancer
Tau conotoxin CnVA is a small peptide found in the venom of the Conus consors pit viper, belonging to the T1 pit viper peptide superfamily. Tau conotoxin CnVA shows a highly selective interaction with the somatostatin sst3 receptor (K_i=1.5 µM) and is the only toxin known to interact with this subfamily of G protein-coupled receptors (GPCRs). Tau conotoxin CnVA can be used in the study of diseases associated with the sst3 receptor, such as pancreatic cancer or pituitary adenomas .

Tau Peptide (1-16) (human)	Tau Protein	Neurological Disease
Tau Peptide (1-16) (human) is aTau fragment.

Tau Peptide (294-305) (human)	Tau Protein	Neurological Disease
Tau Peptide (294-305) (human) is aTau fragment.

tau/Aβ40 aggregation-IN-1	Tau Protein Amyloid-β Cholinesterase (ChE)	Neurological Disease
tau/Aβ40 aggregation-IN-1 (Compound 20) is a *tau* and Aβ₄₀ aggregation inhibitor with IC₅₀s of 1.8 μM and 1.3 μM, respectively .

Tau Peptide (244-274) (Repeat 1 Domain)	Tau Protein	Neurological Disease
Tau Peptide (244-274) (Repeat 1 Domain) is aTau fragment.

Tau Peptide (245-274) (Repeat 1 Domain)	Tau Protein	Neurological Disease
Tau Peptide (245-274) (Repeat 1 Domain) is aTau fragment.

Tau Peptide (306-336) (Repeat 3 Domain)	Tau Protein	Neurological Disease
Tau Peptide (306-336) (Repeat 3 Domain) is aTau fragment.

Tau Peptide (45-73) (Exon 2/Insert 1 Domain)	Tau Protein	Neurological Disease
Tau Peptide (45-73) (Exon 2/Insert 1 Domain) is aTau fragment.

Tau Peptide (74-102) (Exon 3/Insert 2 Domain)	Tau Protein	Neurological Disease
Tau Peptide (74-102) (Exon 3/Insert 2 Domain) is aTau fragment.

Tau Peptide (255-314) (Repeat 2 Domain) (human)	Tau Protein	Others
Tau Peptide (255-314) (Repeat 2 Domain) (human) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .

*Aberrant tau* ligand 1**	Ligands for Target Protein for PROTAC	Neurological Disease
Aberrant tau ligand 1 is a ligand for tau proteins with abnormal forms. Aberrant tau ligand 1 can be used for synthesis of PROTAC aberrant Tau degrader QC-01-175 (HY-134850) .

*Aβ/tau* aggregation-IN-1**	Amyloid-β	Neurological Disease
Aβ/tau aggregation-IN-1 is a potent Aβ_1-42 β-sheets formation and *tau* aggregation inhibitor. The K_D values of Aβ/tau aggregation-IN-1 with Aβ_1-42 and *tau* are 160 μM and 337 μM, respectively. Aβ/tau aggregation-IN-1 can permeate the blood-brain barrier .

*Acetyl-Tau* Peptide (273-284) amide**	Amyloid-β	Neurological Disease
Acetyl-Tau Peptide (273-284) amide is an acetylated Tau peptide fragment. Acetyl-Tau Peptide (273-284) amide limits the substantial aggregation of Ac-Aβ(25–35)-NH2 and can be used as an inhibitor of Ac-Aβ(25–35)-NH2. Acetyl-Tau Peptide (273-284) amide can be used as an experimental model to investigate the Aβ/Tau cross-interaction .

THK-523	Amyloid-β	Neurological Disease
THK-523 has demonstrated its high affinity and selectivity for *tau* pathology both in vitro and in vivo. ¹⁸F-THK523 is a potent tau imaging radiotracer.? ¹⁸F-THK523 is a potent in vivo tau imaging ligand for Alzheimer's disease .

*Aβ/tau* aggregation-IN-3**	Amyloid-β	Neurological Disease
Aβ/tau aggregation-IN-3 is a potent amyloid protein aggregation inhibitor with an IC₅₀ of 0.85 μM by Aβ-Thioflavin T (Aβ-ThT) functional aggregation assay. Aβ/tau aggregation-IN-3 has anti-amyloid activity .

THK-5105	Microtubule/Tubulin	Neurological Disease
THK-5105, an arylquinoline derivative, displays high binding affinity to tau fibrils. THK-5105 has high binding affinity to tau protein aggregates and tau-rich Alzheimer disease (AD) brain homogenates. 18F-THK-5105 has the potential to act as a tau imaging PET probe .

THK-5117	Microtubule/Tubulin	Neurological Disease
THK-5117, an arylquinoline derivative, displays high binding affinity to tau fibrils with a K_i of 10.5 nM. THK-5117 has high binding affinity to tau protein aggregates and tau-rich Alzheimer disease (AD) brain homogenates. 18F-THK-5117 has the potential to act as a tau imaging PET probe .

JG-48	HSP	Neurological Disease
JG-48 is a Hsp70 inhibitor that can reduce tau levels in models of tauopathy .

*Microtubule-associated protein tau* (26-44)**	Tau Protein	Neurological Disease
Microtubule-associated protein tau (26-44) is a synthetic peptide chain with an amine group attached to glutamine and an carboxyl group attached to lysine.

Hydromethylthionine dihydrobromide Leukomethylene blue dihydrobromide; LMTM dihydrobromide	Tau Protein	Neurological Disease
Hydromethylthionine dihydrobromide (Leukomethylene blue dihydrobromide) is a potent inhibitor of *TAU* protein aggregation. Hydromethylthionine dihydrobromide reduces neurodegeneration by interacting with *TAU* proteins and preventing them from forming neurotoxic aggregates. Hydromethylthionine dihydrobromide can be used in the study of Alzheimer's disease and other *TAU* related disorders .

PHF6	Amyloid-β Autophagy	Neurological Disease
PHF6 (VQIVYK) is a self-assembly sequence capable of initiating the full-length tau protein aggregation and is mapped to the third microtubule-binding repeat region of the tau protein .

PHF6 TFA	Amyloid-β Autophagy	Neurological Disease
PHF6 (VQIVYK) TFA is a self-assembly sequence capable of initiating the full-length tau protein aggregation. PHF6 TFA is mapped to the third microtubule-binding repeat region of the tau protein .

DN5355	Amyloid-β	Neurological Disease
DN5355 is a small molecule compound that targets amyloid β protein (Aβ) and hyperphosphorylated *tau* protein. DN5355 can inhibit the aggregation of Aβ and *tau* protein and disaggregate the formed Aβ and *tau* protein fibers. DN5355 can be used in the study of Alzheimer's disease .

Cl-NQTrp	Amyloid-β	Neurological Disease
Cl-NQTrp signifcantly disrupts the preformed fbrillar aggregates of Tau-derived PHF6 (VQIVYK) peptide and full-length tau protein .

Posdinemab JNJ-63733657	Tau Protein	Cancer
Posdinemab is a humanized IgG1κ antibody, targeting to microtubule-associated protein tau (MAPT) .

ARN25068	GSK-3 DYRK	Neurological Disease
ARN25068 is a sub-micromolar inhibitor of the three protein kinases, GSK-3β, FYN and DYRK1A to tackle tau hyperphosphorylation .

IONIS-MAPTRx sodium BIIB080 sodium; ISIS 814907 sodium	Tau Protein	Neurological Disease
IONIS-MAPTRx sodium is the first Tau-lowering antisense oligonucleotide (ASO). IONIS-MAPTRx sodium has the potential for the research of Alzheimer Disease .

3,3'-Diethyl-9-methylthiacarbocyanine iodide	Microtubule/Tubulin	Neurological Disease
3,3'-Diethyl-9-methylthiacarbocyanine iodide is a cyanine dye, also a tau aggregation inhibitor, with an IC₅₀ value of 0.28 μM for tau. 3,3'-Diethyl-9-methylthiacarbocyanine iodide can cause misfunction of the microtubule cytoskeleton. 3,3'-Diethyl-9-methylthiacarbocyanine iodide can be used for researching Alzheimer’s disease .

hAChE-IN-2	Cholinesterase (ChE) Tau Protein	Neurological Disease
hAChE-IN-2 is a potent hAChE inhibitor, with an IC₅₀ of 0.71 μM. hAChE-IN-2 can also inhibits tau-oligomerization, with an EC₅₀ of 2.21 μM. hAChE-IN-2 exhibits neuroprotective activity .

IONIS-MAPTRx BIIB080; ISIS 814907	Tau Protein	Neurological Disease
IONIS-MAPTRx (BIIB080) is the first Tau-lowering antisense oligonucleotide (ASO). IONIS-MAPTRx has the potential for the research of Alzheimer Disease .

Leucomethylene blue mesylate 5+ Cited Publications TRx0237 mesylate; Methylene blue leuco base mesylate	Amyloid-β	Neurological Disease
Leucomethylene blue (TRx0237) mesylate, an orally active second-generation *tau* protein aggregation inhibitor (K_i of 0.12 μM), could be used for the study of Alzheimer's Disease. Leucomethylene blue mesylate is a common reduced form of Methylene Blue, Methylene Blue is a member of the thiazine class of dyes .

Aha1/Hsp90-IN-1	Microtubule/Tubulin	Neurological Disease Inflammation/Immunology
Aha1/Hsp90-IN-1 (Compound 17) is an Aha1/Hsp90 complex inhibitor. Aha1/Hsp90-IN-1 disrupts Aha1/Hsp90 interactions with an IC₅₀ of 3.32 μM. Aha1/Hsp90-IN-1 inhibits tau aggregation .

Cat. No.	Product Name

HY-L069

Anti-Alzheimer's Disease Compound Library

1,476 compounds

Alzheimer’s Disease (AD) is a progressive degenerative brain disease which causes mental and physical decline, gradually resulting in death. Despite the significant public health issue that it poses, only few medical treatments have been approved for Alzheimer’s Disease (AD) and these act to control symptoms rather than alter the course of the disease. Discovery of new therapeutic approaches depends on the study of pathology of AD. Recent research findings have led to greater understanding of disease neurobiology in Alzheimer's Disease (AD) and identification of unique targets for drug development. Several important mechanisms have been proposed to explain the underlying pathology of AD, such as Amyloid cascade hypothesis, Tau hypothesis and Cholinergic hypothesis, etc.

MCE offers a unique collection of 1,476 compounds with anti-Alzheimer’s Disease activities or targeting the unique targets of AD. MCE Anti-Alzheimer’s Disease Compound Library is a useful tool for exploring the mechanism of AD and discovering new drugs for AD.

Cat. No.	Product Name	Type

HY-19948

Leucomethylene blue mesylate 5+ Cited Publications TRx0237 mesylate; Methylene blue leuco base mesylate	Chromogenic Assays
Leucomethylene blue (TRx0237) mesylate, an orally active second-generation *tau* protein aggregation inhibitor (K_i of 0.12 μM), could be used for the study of Alzheimer's Disease. Leucomethylene blue mesylate is a common reduced form of Methylene Blue, Methylene Blue is a member of the thiazine class of dyes .

HY-14536

Methylene Blue

10+ Cited Publications

Basic Blue 9; CI-52015; Methylthioninium chloride

Chromogenic Assays

Methylene blue (Basic Blue 9) is a guanylyl cyclase (sGC), monoamine oxidase A (MAO-A) and NO synthase (NOS) inhibitor. Methylene blue is a vasopressor and is often used as a dye in several medical procedures. Methylene blue through the nitric oxide syntase/guanylate cyclase signalling pathway to reduce prepulse inhibition. Methylene blue is a REDOX cycling compound and able to cross the blood-brain barrier. Methylene blue is a Tau aggregation inhibitor. Methylene blue reduces cerebral edema, attenuated microglial activation and reduced neuroinflammation .

HY-D1494

FSB	Fluorescent Dyes/Probes
FSB is a fluorescent dye that can be used to detect filamentous tau and to label human amyloid lesions with high sensitivity and specificity (excitation: 390 nm, emission: 520 nm) .

HY-13506G

M344 (GMP) D 237 (GMP); MS 344 (GMP)	Fluorescent Dye
M344 (GMP) (D 237) (GMP) is the GMP level of M344 (HY-13506). GMP level of small molecules can be used as auxiliary reagents in cell therapy. M344 is a kind of histone acetylation enzyme inhibitor .

HY-14536A

Methylene blue (purity≥70%)

Basic Blue 9 (purity≥70%); CI-52015 (purity≥70%); Methylthioninium chloride (purity≥70%)

Chromogenic Assays

Methylene blue (purity≥70%) is a guanylyl cyclase (sGC), monoamine oxidase A (MAO-A) and NO synthase (NOS) inhibitor. Methylene blue (purity≥70%) is a vasopressor and is often used as a dye in several medical procedures. Methylene blue (purity≥70%) through the nitric oxide syntase/guanylate cyclase signalling pathway to reduce prepulse inhibition. Methylene blue (purity≥70%) is a REDOX cycling compound and able to cross the blood-brain barrier. Methylene blue (purity≥70%) is a Tau aggregation inhibitor. Methylene blue reduces cerebral edema, attenuated microglial activation and reduced neuroinflammation .

Cat. No.	Product Name	Type

HY-101183

THK5351	Indicators
THK5351 can be radiolabeled and used as a radiotracer for in vivo imaging of *tau* pathology in the brain.

HY-13506G

M344 (GMP) D 237 (GMP); MS 344 (GMP)	Biochemical Assay Reagents
M344 (GMP) (D 237) (GMP) is the GMP level of M344 (HY-13506). GMP level of small molecules can be used as auxiliary reagents in cell therapy. M344 is a kind of histone acetylation enzyme inhibitor .

Cat. No.	Product Name	Target	Research Area

HY-P2516

Tau Peptide (275-305) (Repeat 2 domain)	Tau Protein	Neurological Disease
Tau Peptide (275-305) (Repeat 2 domain) is the Alzheimer's tau fragment R2, corresponding to the second repeat unit of the microtubule-binding domain, which is believed to be pivotal to the biochemical properties of full tau protein .

HY-P1707A

Tau protein (592-597), human TFA	Tau Protein	Neurological Disease
Tau protein (592-597), human TFA is a peptide fragment of human Tau protein. The dysfunction of Tau protein is involved in neurodegeneration and dementia .

HY-P4943

Tau Peptide (273-284)	Tau Protein	Neurological Disease
Tau Peptide (273-284) is aTau fragment.

HY-P4969

Tau Peptide (379-408)	Tau Protein	Neurological Disease
Tau Peptide (379-408) is aTau fragment.

HY-P10505

Tau conotoxin CnVA	Somatostatin Receptor	Cancer
Tau conotoxin CnVA is a small peptide found in the venom of the Conus consors pit viper, belonging to the T1 pit viper peptide superfamily. Tau conotoxin CnVA shows a highly selective interaction with the somatostatin sst3 receptor (K_i=1.5 µM) and is the only toxin known to interact with this subfamily of G protein-coupled receptors (GPCRs). Tau conotoxin CnVA can be used in the study of diseases associated with the sst3 receptor, such as pancreatic cancer or pituitary adenomas .

HY-P4923

Tau Peptide (1-16) (human)	Tau Protein	Neurological Disease
Tau Peptide (1-16) (human) is aTau fragment.

HY-P4960

Tau Peptide (294-305) (human)	Tau Protein	Neurological Disease
Tau Peptide (294-305) (human) is aTau fragment.

HY-P4924

Tau Peptide (244-274) (Repeat 1 Domain)	Tau Protein	Neurological Disease
Tau Peptide (244-274) (Repeat 1 Domain) is aTau fragment.

HY-P4927

Tau Peptide (245-274) (Repeat 1 Domain)	Tau Protein	Neurological Disease
Tau Peptide (245-274) (Repeat 1 Domain) is aTau fragment.

HY-P4966

Tau Peptide (306-336) (Repeat 3 Domain)	Tau Protein	Neurological Disease
Tau Peptide (306-336) (Repeat 3 Domain) is aTau fragment.

HY-P4935

Tau Peptide (268-282)	Peptides	Others
Tau Peptide (268-282) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .

HY-P4949

Tau Peptide (274-288)	Peptides	Others
Tau Peptide (274-288) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .

HY-P4959

Tau Peptide (277-291)	Peptides	Others
Tau Peptide (277-291) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .

HY-P4961

Tau Peptide (295-309)	Peptides	Others
Tau Peptide (295-309) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .

HY-P4962

Tau Peptide (298-312)	Peptides	Others
Tau Peptide (298-312) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .

HY-P4963

Tau Peptide (301-315)	Peptides	Others
Tau Peptide (301-315) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .

HY-P4964

Tau Peptide (304-318)	Peptides	Others
Tau Peptide (304-318) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .

HY-P4965

Tau Peptide (306-317)	Peptides	Others
Tau Peptide (306-317) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .

HY-P4967

Tau Peptide (307-321)	Peptides	Others
Tau Peptide (307-321) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .

HY-P4974

Tau Peptide (512-525) amide	Peptides	Others
Tau Peptide (512-525) amide is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .

HY-P4972

Tau Peptide (45-73) (Exon 2/Insert 1 Domain)	Tau Protein	Neurological Disease
Tau Peptide (45-73) (Exon 2/Insert 1 Domain) is aTau fragment.

HY-P4977

Tau Peptide (74-102) (Exon 3/Insert 2 Domain)	Tau Protein	Neurological Disease
Tau Peptide (74-102) (Exon 3/Insert 2 Domain) is aTau fragment.

HY-P4968

Tau Peptide (337-368) (Repeat 4 Domain)	Peptides	Others
Tau Peptide (337-368) (Repeat 4 Domain) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .

HY-P4933

Tau Peptide (255-314) (Repeat 2 Domain) (human)	Tau Protein	Others
Tau Peptide (255-314) (Repeat 2 Domain) (human) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .

HY-P4832

*Acetyl-Tau* Peptide (273-284) amide**	Amyloid-β	Neurological Disease
Acetyl-Tau Peptide (273-284) amide is an acetylated Tau peptide fragment. Acetyl-Tau Peptide (273-284) amide limits the substantial aggregation of Ac-Aβ(25–35)-NH2 and can be used as an inhibitor of Ac-Aβ(25–35)-NH2. Acetyl-Tau Peptide (273-284) amide can be used as an experimental model to investigate the Aβ/Tau cross-interaction .

HY-P4695

*(Thr(PO3H2)231)-Tau* Peptide (225-237)**	Peptides	Neurological Disease
(Thr(PO3H2)231)-Tau Peptide (225-237) is a fragment of tau peptide .

HY-P0181

*Microtubule-associated protein tau* (26-44)**	Tau Protein	Neurological Disease
Microtubule-associated protein tau (26-44) is a synthetic peptide chain with an amine group attached to glutamine and an carboxyl group attached to lysine.

HY-P4808

PHF6	Amyloid-β Autophagy	Neurological Disease
PHF6 (VQIVYK) is a self-assembly sequence capable of initiating the full-length tau protein aggregation and is mapped to the third microtubule-binding repeat region of the tau protein .

HY-P4808A

PHF6 TFA	Amyloid-β Autophagy	Neurological Disease
PHF6 (VQIVYK) TFA is a self-assembly sequence capable of initiating the full-length tau protein aggregation. PHF6 TFA is mapped to the third microtubule-binding repeat region of the tau protein .

HY-P4691

*(Ser(PO3H2)396,404)-Tau* Peptide (379-408)**	Peptides	Others
(Ser(PO3H2)396,404)-Tau Peptide (379-408) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .

HY-P4686

*(Ser(PO3H2)202,Thr(PO3H2)205)-Tau* Peptide (194-213)**	Peptides	Others
(Ser(PO3H2)202,Thr(PO3H2)205)-Tau Peptide (194-213) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .

HY-P4830

*Acetyl-Tau* Peptide (244-274) (Repeat 1 Domain)**	Peptides	Others
Acetyl-Tau Peptide (244-274) (Repeat 1 Domain) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .

HY-P5334

AADvac 1	Peptides	Neurological Disease
AADvac 1 is an active tau peptide vaccine for Alzheimer's disease research. AADvac 1 is composed of a regulatory peptide ²⁹⁴KDNIKHVPGGGS ³⁰⁵ that drives tau oligomerization conjugated to Aplysia hemocyanin (KLH) and formulated with aluminum hydroxide .

HY-P5334A

AADvac 1 TFA	Peptides	Neurological Disease
AADvac 1 TFA is an active tau peptide vaccine for Alzheimer's disease research. AADvac 1 TFA is composed of a regulatory peptide ²⁹⁴KDNIKHVPGGGS ³⁰⁵ that drives tau oligomerization conjugated to Aplysia hemocyanin (KLH) and formulated with aluminum hydroxide .

HY-P1675A

Acetyl-PHF6 amide TFA 1 Publications Verification AcPHF6 TFA; Ac-VQIVYK-NH2 TFA	Tau Protein	Neurological Disease
Acetyl-PHF6 amide TFA (AcPHF6 TFA) is a tau derived hexapeptide.

HY-P4822

Acetyl-PHF5 amide	Tau Protein	Others
Acetyl-PHF5 amide is an amyloidogenic protein tau peptide. Acetyl-PHF5 amide can polymerization into filamentous structures .

HY-P3307

Ac-Val-Gln-aIle-Val-aTyr-Lys-NH2	Tau Protein	Neurological Disease
Ac-Val-Gln-aIle-Val-aTyr-Lys-NH2 is serum stable, non-toxic to neuronal cells, and selectivity inhibits the fibrilization of tau over Aβ₄₂.

Cat. No.	Product Name	Target	Research Area

HY-P9995

Posdinemab JNJ-63733657	Tau Protein	Cancer
Posdinemab is a humanized IgG1κ antibody, targeting to microtubule-associated protein tau (MAPT) .

HY-P99471

Bepranemab UCB 0107	Tau Protein	Neurological Disease
Bepranemab (UCB 0107) is a humanized, full-length IgG4 monoclonal antibody that binds to a central tau epitope (amino acids 235-250). Bepranemab can be used for Alzheimer’s disease (AD) research .

HY-P99163

Tilavonemab ABBV-8E12; C2N-8E12	Tau Protein	Neurological Disease
Tilavonemab (ABBV-8E12) is a humanized anti-tau antibody that targets the extracellular form of pathological *tau* protein aggregates by binding to the N-terminal 25-30 amino acid residues of *tau* protein. Tilavonemab blocks the ability of human and mouse neurons to take up *tau* aggregates, reduces the loss of brain volume, slows the progression of *tau* pathology, and improves cognitive abilities in transgenic mice expressing mutant human *tau*. Tilavonemab is used in Alzheimer's disease research .

HY-P99399

Semorinemab RG 6100; RO7105705; MTau-9937A	Tau Protein	Neurological Disease
Semorinemab (RG 6100) is an anti-Tau humanized IgG4 monoclonal antibody, targets the N-terminal portion of the Tau protein (amino acid residues 6-23). Semorinemab binds with human Tau with a K_d value of 3.8 nM. Semorinemab can be used for the research of Alzheimer's Disease .

HY-P99164

Zagotenemab LY33003560	Microtubule/Tubulin	Neurological Disease
Zagotenemab (LY3303560) is a humanised anti-tau antibody that selectively binds and neutralises *tau* deposits in the brain. Zagotenemab can be used in Alzheimer's disease research .

HY-P99648

Gosuranemab BMS-986168; IPN007; BIIB092	Tau Protein	Neurological Disease
Gosuranemab (BMS-986168) is a humanised IgG4 anti-tau monoclonal antibody. Gosuranemab binds to human N-terminal tau residues 15-22. Gosuranemab has the potential for the research of alzheimer’s disease (AD) .

Species:	Human (9) Rhesus Macaque (1) Mouse (3) Rat (2) Bovine (1)
Tag:	His (13) Tag Free (1) GST (4) Flag (2)
Source:	HEK293 (4) P. pastoris (3) Sf9 insect cells (4) E. coli (5)

Cat. No.	Compare	Product Name	Species	Source

HY-P73618A

	*Fetal-tau/0N3R Protein, Human (His)* MAPT; Mtapt; Tau; Microtubule-associated protein Tau; PHF-Tau	Human	E. coli
	Tau/0N3R protein is encoded by the Tau/0N3R gene and undergoes regulated alternative splicing to produce different mRNA species.Its expression varies in the nervous system according to the maturation and type of neurons.Fetal-tau/0N3R Protein, Human (His) is the recombinant human-derived Fetal-tau/0N3R protein, expressed by E.coli , with N-6*His labeled tag.

HY-P73618

	*Fetal-tau/0N3R Protein, Human (His, solution)* MAPT; Mtapt; Tau; Microtubule-associated protein Tau; PHF-Tau	Human	E. coli
	Tau/0N3R protein is encoded by the Tau/0N3R gene and undergoes regulated alternative splicing to produce different mRNA species. Its expression varies in the nervous system according to the maturation and type of neurons. Tau/0N3R Protein, Human (His, solution) is the recombinant human-derived Tau/0N3R protein, expressed by E. coli , with N-His labeled tag.

HY-P71752

	*PNS-Tau/MAPT Protein, Mouse (P.pastoris, His)* Mapt; Mtapt; Tau; Microtubule-associated protein Tau; Neurofibrillary tangle protein; Paired helical filament-Tau; PHF-Tau	Mouse	P. pastoris
	Microtubule-associated protein tau (MAPT) plays a key role in promoting microtubule assembly and stability, suggesting its potential contribution to the establishment of neuronal polarity.The C terminus binds to axonal microtubules, whereas the N terminus interacts with neuroplasmic membrane components, serving as a key linker protein between these structures.PNS-Tau/MAPT Protein, Mouse (P.pastoris, His) is the recombinant mouse-derived Microtubule-associated protein tau protein, expressed by P.pastoris , with N-6*His labeled tag.

HY-P71102

	Tau-D/0N4R Protein, Human (133a.a, His) Microtubule-Associated Protein Tau; Neurofibrillary Tangle Protein; Paired Helical Filament-Tau; PHF-Tau; MAPT; MAPTL; MTBT1; Tau	Human	E. coli
	Microtubule-associated protein tau is a microtubule-associated protein found in large numbers in neurons of the central nervous system (CNS). MAPT promotes microtubule assembly and stability and may be involved in the establishment and maintenance of neuronal polarity. Overexpression of MAPT is associated with a poor prognosis of prostate cancer. MAPT has been linked to neurological disorders such as Alzheimer's and Parkinson's disease. Tau-D/0N4R Protein, Human (133a.a, His) is the recombinant human-derived Tau-D/0N4R protein, expressed by E. coli , with C-6*His labeled tag. The total length of Tau-D/0N4R Protein, Human (133a.a, His) is 133 a.a., with molecular weight of ~16.0 kDa.

HY-P700421

	Tau-F/2N4R Protein, Human (HEK293, His) MAPT; Tau; MSTD; PPND; DDPAC; MAPTL; MTBT1; MTBT2; FTDP-17; microtubule-associated protein Tau; microtubule-associated protein Tau; PHF-Tau; paired helical filament-Tau; neurofibrillary tangle protein; microtubule-associated protein Tau, isoform 4; G protein beta1/gamma2 subunit-interacting factor 1	Human	HEK293
	Microtubule-associated protein tau is a microtubule-associated protein found in large numbers in neurons of the central nervous system (CNS). MAPT promotes microtubule assembly and stability and may be involved in the establishment and maintenance of neuronal polarity. Overexpression of MAPT is associated with a poor prognosis of prostate cancer. MAPT has been linked to neurological disorders such as Alzheimer's and Parkinson's disease. Tau-F/2N4R Protein, Human (HEK293, His) is the recombinant human-derived Tau-F/2N4R protein, expressed by HEK293 , with N-10*His labeled tag.

HY-P70589

	Tau-F/2N4R Protein, Human DDPAC; FLJ31424; FTDP-17; G protein beta1/gamma2 subunit-interacting factor 1; MAPT; MGC138549; microtubule-associated protein Tau; MSTD; MSTDMAPTL; MTBT1; MTBT1Neurofibrillary tangle protein; MTBT2; Neurofibrillary tangle protein; PHF-Tau; PPND; Tau; TauPaired helical filament-Tau	Human	E. coli
	Microtubule-associated protein tau is a microtubule-associated protein found in large numbers in neurons of the central nervous system (CNS). MAPT promotes microtubule assembly and stability and may be involved in the establishment and maintenance of neuronal polarity. Overexpression of MAPT is associated with a poor prognosis of prostate cancer. MAPT has been linked to neurological disorders such as Alzheimer's and Parkinson's disease. Tau-F/2N4R Protein, Human is the recombinant human-derived Tau-F/2N4R protein, expressed by E. coli , with tag free.

HY-P700422

	*PNS-Tau/MAPT Protein, Mouse (HEK293, His)* MAPT; Tau; MSTD; PPND; DDPAC; MAPTL; MTBT1; MTBT2; FTDP-17; microtubule-associated protein Tau; microtubule-associated protein Tau; PHF-Tau; paired helical filament-Tau; neurofibrillary tangle protein; microtubule-associated protein Tau, isoform 4; G protein beta1/gamma2 subunit-interacting factor 1	Mouse	HEK293
	Microtubule-associated protein tau (MAPT) plays a key role in promoting microtubule assembly and stability, suggesting its potential contribution to the establishment of neuronal polarity.The C terminus binds to axonal microtubules, whereas the N terminus interacts with neuroplasmic membrane components, serving as a key linker protein between these structures.PNS-Tau/MAPT Protein, Mouse (HEK293, His) is the recombinant mouse-derived PNS-Tau/MAPT protein, expressed by HEK293 , with N-10*His labeled tag.

HY-P71753

	Tau-A/SC1 Protein, Rat (P.pastoris, His) Mapt; Mtapt; Tau; Microtubule-associated protein Tau; Neurofibrillary tangle protein; Paired helical filament-Tau; PHF-Tau	Rat	P. pastoris
	Microtubule-associated protein tau (MAPT) critically promotes microtubule assembly and stability, influencing neuronal polarity by acting as an important junction protein. Its dual role involves C-terminal binding to axonal microtubules and N-terminal binding to neuroplasmic membrane components. Tau-A/SC1 Protein, Rat (P.pastoris, His) is the recombinant rat-derived Microtubule-associated protein tau protein, expressed by P. pastoris , with N-His labeled tag.

HY-P700423

	Tau-A/MAPT Protein, Macaca mulatta (HEK293, His) MAPT; Tau; MSTD; PPND; DDPAC; MAPTL; MTBT1; MTBT2; FTDP-17; microtubule-associated protein Tau; microtubule-associated protein Tau; PHF-Tau; paired helical filament-Tau; neurofibrillary tangle protein; microtubule-associated protein Tau, isoform 4; G protein beta1/gamma2 subunit-interacting factor 1	Rhesus Macaque	HEK293
	Tau/MAPT proteins crucially promote microtubule assembly and stability, which are critical for neuronal polarity. Structurally, its C terminus binds to axonal microtubules and its N terminus binds to neuroplasmic membrane components, suggesting its role as a connexin connecting microtubules to the plasma membrane. Tau-A/MAPT Protein, Macaca mulatta (HEK293, His) is the recombinant Rhesus Macaque-derived Tau-A/MAPT protein, expressed by HEK293 , with N-10*His labeled tag.

HY-P700424

	Tau-A/SC1 Protein, Rat (HEK293, His) MAPT; Tau; MSTD; PPND; DDPAC; MAPTL; MTBT1; MTBT2; FTDP-17; microtubule-associated protein Tau; microtubule-associated protein Tau; PHF-Tau; paired helical filament-Tau; neurofibrillary tangle protein; microtubule-associated protein Tau, isoform 4; G protein beta1/gamma2 subunit-interacting factor 1	Rat	HEK293
	Microtubule-associated protein tau (MAPT) critically promotes microtubule assembly and stability, influencing neuronal polarity by acting as an important junction protein. Its dual role involves C-terminal binding to axonal microtubules and N-terminal binding to neuroplasmic membrane components. Tau-A/SC1 Protein, Rat (HEK293, His) is the recombinant rat-derived Tau-A/SC1 protein, expressed by HEK293 , with N-10*His labeled tag.

HY-P701658

	CK1d Protein, Human (Sf9, GST) CSNK1D; Casein kinase I isoform delta; CKI-delta; CKId; Tau-protein kinase CSNK1D	Human	Sf9 insect cells
	The CK1d protein is an important serine/threonine protein kinase that complexly controls cellular processes such as Wnt signaling, DNA repair, and circadian rhythms. Its versatility is evident in phosphorylating a variety of proteins, including connexin-43/GJA1, MAP1A, p53/TP53, and YAP1. CK1d Protein, Human (Sf9, GST) is the recombinant human-derived CK1d protein, expressed by Sf9 insect cells , with N-GST labeled tag. The total length of CK1d Protein, Human (Sf9, GST) is 414 a.a., .

HY-P702685

	CDK5-p25 Protein, Human (sf9, GST, His, Flag) CDK5; cyclin-dependent kinase 5; PSSALRE; TPKII catalytic subunit; protein kinase CDK5 splicing; cell division protein kinase 5; serine/threonine-protein kinase PSSALRE; Tau protein kinase II catalytic subunit	Human	Sf9 insect cells
	CDK5 is a proline-directed serine/threonine protein kinase that critically regulates neuronal cell cycle, differentiation and potential apoptosis in neuronal diseases by preventing cell cycle re-entry. It interacts with numerous proteins involved in neuronal development and coordinates processes such as survival, migration, differentiation, axonal growth, synaptogenesis, and neurotransmission. CDK5-p25 Protein, Human (sf9, GST, His, Flag) is the recombinant human-derived CDK5-p25, expressed by Sf9 insect cells , with N-GST, N-His, N-Flag labeled tag. ,

HY-P702686

	CDK5-p35 Protein, Human (sf9, GST, His, Flag) CDK5; cyclin-dependent kinase 5; PSSALRE; TPKII catalytic subunit; protein kinase CDK5 splicing; cell division protein kinase 5; serine/threonine-protein kinase PSSALRE; Tau protein kinase II catalytic subunit	Human	Sf9 insect cells
	CDK5 is a proline-directed serine/threonine protein kinase that critically regulates neuronal cell cycle, differentiation and potential apoptosis in neuronal diseases by preventing cell cycle re-entry. It interacts with numerous proteins involved in neuronal development and coordinates processes such as survival, migration, differentiation, axonal growth, synaptogenesis, and neurotransmission. CDK5-p35 Protein, Human (sf9, GST, His, Flag) is the recombinant human-derived CDK5-p35, expressed by Sf9 insect cells , with N-His, N-GST, N-Flag labeled tag. ,

HY-P71798

	*Interferon tau-1/IFNT1 Protein, Bovine (P.pastoris, His)* IFNT1; Interferon Tau-1; IFN-Tau-1; Antiluteolysin; Trophoblast antiluteolytic protein; Trophoblast protein 1; TP-1; Trophoblastin	Bovine	P. pastoris
	Interferon tau-1 (IFNT1) serves as an important paracrine hormone that initiates maternal recognition of pregnancy. After interacting with endometrial receptors, possibly type I interferon receptors, IFNT1 blocks estrogen receptor expression and prevents estrogen-induced upregulation of oxytocin receptor expression. Interferon tau-1/IFNT1 Protein, Bovine (P.pastoris, His) is the recombinant bovine-derived Interferon tau-1/IFNT1 protein, expressed by P. pastoris , with N-His labeled tag.

HY-P703012

	14-3-3 theta Protein, Mouse (sf9, His) 14-3-3 protein theta; 14-3-3 protein Tau; Ywhaq	Mouse	Sf9 insect cells

HY-P75548

	14-3-3 theta Protein, Human (GST) 14-3-3 protein theta; 14-3-3 protein Tau; Protein HS1; YWHAQ	Human	E. coli
	14-3-3 theta proteins are adapters in multiple signaling pathways that recognize phosphoserine or phosphothreonine motifs and modulate chaperone activity upon binding. It negatively regulates PDPK1 kinase activity, forms homodimers, and interacts with CDK16, phosphorylated RGS7, SSH1, phosphorylated CDKN1B, GAB2, phosphorylated PDPK1, and phosphorylated DAPK2. 14-3-3 theta Protein, Human (GST) is the recombinant human-derived 14-3-3 theta protein, expressed by E. coli , with N-GST labeled tag. The total length of 14-3-3 theta Protein, Human (GST) is 245 a.a., with molecular weight of ~53 kDa.

Compare Products


Products	In-stock - + Add to Cart
Cat. No.
Species
Source
Tag
Accession
Gene ID
Molecular Weight
Purity
Endotoxin Level
Biological Activity
Appearance
Formulation
Storage & Stability
Shipping
Free Sample	Yes No
Size	* This product has been "discontinued". Optimized version of product available: / In-stock - + Add to Cart Get quote

Cat. No.	Compare	Product Name	Application	Reactivity

HY-P80861

	*Phospho-Tau* (Thr181) Antibody** MAPT; MAPTL; MTBT1; Tau; Microtubule-associated protein Tau; Neurofibrillary tangle protein; Paired helical filament-Tau; PHF-Tau	WB, IP	Human
	Phospho-Tau (Thr181) Antibody is a non-conjugated and Rabbit origined monoclonal antibody about 79 kDa, targeting to Phospho-Tau (Thr181). It can be used for WB,IP assays with tag free, in the background of Human.

HY-P80909

	Tau Antibody MAPT; MAPTL; MTBT1; Tau; Microtubule-associated protein Tau; Neurofibrillary tangle protein; Paired helical filament-Tau; PHF-Tau	WB	Human, Mouse, Rat
	Tau Antibody is a non-conjugated and Rabbit origined monoclonal antibody about 79 kDa, targeting to Tau. It can be used for WB assays with tag free, in the background of Human, Mouse, Rat.

HY-P80539

	AMPK alpha 1 Antibody PRKAA1; AMPK1; 5'-AMP-activated protein kinase catalytic subunit alpha-1; AMPK subunit alpha-1; Acetyl-CoA carboxylase kinase; ACACA kinase; Hydroxymethylglutaryl-CoA reductase kinase; HMGCR kinase; Tau-protein kinase PRKAA1	WB, IHC-P, ICC/IF, IP, FC	Human, Mouse, Rat
	AMPK alpha 1 Antibody is a non-conjugated and Rabbit origined polyclonal antibody about 64 kDa, targeting to AMPK alpha 1. It can be used for WB,IHC-P,ICC/IF,IP,FC assays with tag free, in the background of Human, Mouse, Rat.

HY-P80790

	Phospho-AMPK alpha 1 (Ser496) Antibody PRKAA1; AMPK1; 5'-AMP-activated protein kinase catalytic subunit alpha-1; AMPK subunit alpha-1; Acetyl-CoA carboxylase kinase; ACACA kinase; Hydroxymethylglutaryl-CoA reductase kinase; HMGCR kinase; Tau-protein kinase PRKAA1	WB, IHC-P, ICC/IF	Human, Mouse, Rat
	Phospho-AMPK alpha 1 (Ser496) Antibody is a non-conjugated and Rabbit origined polyclonal antibody about 64 kDa, targeting to Phospho-AMPK alpha 1 (Ser496). It can be used for WB,IHC-P,ICC/IF assays with tag free, in the background of Human, Mouse, Rat.

HY-P80613

	CDK5 Antibody (YA796) Cdk 5; Cdk5; CDK5_HUMAN; Cell division protein kinase 5; Crk6; Cyclin dependent kinase 5; Cyclin-dependent kinase 5; Protein kinase CDK5 splicing; PSSALRE; Serine threonine protein kinase PSSALRE; Serine/threonine-protein kinase PSSALRE; Tau protein kinas	WB, ICC/IF	Human, Mouse, Rat, Monkey
	CDK5 Antibody (YA796) is a non-conjugated and Mouse origined monoclonal antibody about 33 kDa, targeting to CDK5 (2E8). It can be used for WB,ICC/IF assays with tag free, in the background of Human, Mouse, Rat, Monkey.

HY-P80480

	*Phospho-Tau* (Ser396) Antibody**	WB, ICC/IF, IHC-P	Mouse, Rat, Human
	Phospho-Tau (Ser396) Antibody is a non-conjugated and Rabbit origined monoclonal antibody about 79 kDa, targeting to Phospho-Tau(S396). It can be used for WB,ICC/IF,IHC-P assays with tag free, in the background of Mouse, Rat, Human.

HY-P80860

	*Phospho-Tau* (Ser404) Antibody** MAPT; MAPTL; MTBT1; Tau; Microtubule-associated protein Tau; Neurofibrillary tangle protein; Paired helical filament-Tau; PHF-Tau	WB	Human, Rat
	Phospho-Tau (Ser404) Antibody is a non-conjugated and Rabbit origined monoclonal antibody about 79 kDa, targeting to Phospho-Tau (Ser404). It can be used for WB assays with tag free, in the background of Human, Rat.

HY-P80859

	*Phospho-Tau* (Ser198) Antibody** MAPT; MAPTL; MTBT1; Tau; Microtubule-associated protein Tau; Neurofibrillary tangle protein; Paired helical filament-Tau; PHF-Tau	WB, IP	Human
	Phospho-Tau (Ser198) Antibody is a non-conjugated and Rabbit origined monoclonal antibody about 79 kDa, targeting to Phospho-Tau (Ser198). It can be used for WB,IP assays with tag free, in the background of Human.

HY-P83700

	*Phospho-Tau* (Ser202/Thr205) Antibody**	WB, IP	Human
	Phospho-Tau (Ser202/Thr205) Antibody is a non-conjugated and Rabbit origined monoclonal antibody about 79 kDa, targeting to Phospho-Tau(S396). It can be used for WB,ICC/IF,IHC-P assays with tag free, in the background of Mouse, Rat, Human.

HY-P82210

	14-3-3 theta Antibody (YA1955) YWHAQ; 14-3-3 protein theta; 14-3-3 protein T-cell; 14-3-3 protein Tau; Protein HS1	WB	Human, Mouse, Rat
	14-3-3 theta Antibody (YA1955) is a biotin-conjugated non-conjugated IgG antibody, targeting 14-3-3 theta, with a predicted molecular weight of 28 kDa (observed band size: 28 kDa). 14-3-3 theta Antibody (YA1955) can be used for WB experiment in human, mouse, rat background.

Compare Products


Products	In-stock - + Add to Cart
Cat. No.
Host
Reactivity
Application
Dilution Ratio
Molecular Weight
Conjugation
Clonality
Immunogen
Appearance
Isotype
Gene ID
SwissProt ID
Purity
Formulation
Free Sample	Yes No
Size	* This product has been "discontinued". Optimized version of product available: / In-stock - + Add to Cart Get quote

Cat. No.	Product Name		Classification

HY-16361A

Omigapil maleate CGP3466B; CGP3446 maleate; TCH346 maleate		Alkynes
Omigapil maleate, an orally bioavailable GAPDH nitrosylation inhibitor, abrogates Aβ_1-42-induced tau acetylation, memory impairment, and locomotor dysfunction in mice. Omigapil maleate has the potential for the research of Alzheimer's disease . Omigapil maleate (CGP3446B maleate) is a apoptosis inhibitor. Omigapil maleate can be used for the research of congenital muscular dystrophy (CMD) . Omigapil (maleate) is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.

Cat. No.	Product Name		Classification

HY-132582A

Tau ASO-12 (murine) (sodium)		Antisense Oligonucleotides
Tau ^ASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (Tau ^ASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )

HY-132582

IONIS-MAPTRx BIIB080; ISIS 814907		Antisense Oligonucleotides
IONIS-MAPTRx (BIIB080) is the first Tau-lowering antisense oligonucleotide (ASO). IONIS-MAPTRx has the potential for the research of Alzheimer Disease .

Inquiry Online

Your information is safe with us. * Required Fields.

MCE Japan Authorized Agent ナミキ商事株式会社コスモ・バイオ株式会社
Salutation			Country or Region *
Applicant Name *			Organization Name *
Department *
Email Address *			Product Name *
Cat. No.			Requested quantity *
Phone Number *
Remarks