Search Result

Results for "

protein sequence

" in MedChemExpress (MCE) Product Catalog:

By Targets:	15-PGDH (1) Akt (1) Amino Acid Derivatives (1) Amylin Receptor (1) Amyloid-β (3) Apoptosis (3) Autophagy (2) Bacterial (1) Bcl-2 Family (1) Biochemical Assay Reagents (2) c-Myc (1) DNA/RNA Synthesis (1) DYRK (1) EBV (1) Endogenous Metabolite (1) Eukaryotic Initiation Factor (eIF) (1) Fluorescent Dye (2) GABA Receptor (1) HBV (2) HIV (1) Influenza Virus (1) Integrin (1) Lipocalin Family (1) MARCKS (3) MDM-2/p53 (4) MyD88 (2) Notch (1) Parasite (1) PD-1/PD-L1 (2) PKC (6) PSMA (1) Reverse Transcriptase (1) SARS-CoV (1) Ser/Thr Kinase (1) TGF-β Receptor (1) Thrombin (5) Transmembrane Glycoprotein (1) TRP Channel (1) VEGFR (2) Virus Protease (1)
By Research Areas:	Cancer (20) Cardiovascular Disease (7) Infection (6) Inflammation/Immunology (9) Neurological Disease (13)
Oligonucleotides:	Aptamers (1) Antisense Oligonucleotides (2)

Inhibitors & Agonists

Screening Libraries

Fluorescent Dye

Biochemical Assay Reagents

Peptides

Inhibitory Antibodies

Natural
Products

Recombinant Proteins

Antibodies

Oligonucleotides

Cat. No.	Product Name	Target	Research Areas	Chemical Structure

HY-130533

ReAsH-EDT2	Fluorescent Dye	Others
ReAsH-EDT2 is a red fluorescent dye that marks proteins. ReAsH-EDT2 is a membrane-permeable biarsenical compound that binds covalently to tetracysteine sequences which allows the protein to be imaged. ReAsH-EDT2 can be used for protein localization and trafficking. (λ_ex=530 nm, λ_em=592 nm) .

HY-P0315

Crosstide 2 Publications Verification	Akt	Others
Crosstide is a peptide analog of glycogen synthase kinase α/β fusion protein sequence which is a substrate for Akt.

HY-P4808A

PHF6 TFA	Amyloid-β Autophagy	Neurological Disease
PHF6 (VQIVYK) TFA is a self-assembly sequence capable of initiating the full-length tau protein aggregation. PHF6 TFA is mapped to the third microtubule-binding repeat region of the tau protein .

HY-P1849A

JAG-1, scrambled TFA scJag-1 TFA	Notch	Cardiovascular Disease
JAG-1, scrambled (scJag-1) TFA is a scrambled sequence of JAG-1 (Jagged-1 protein). JAG-1, scrambled TFA has a random sequence of the amino acids that are the same as the active fragment. JAG-1, scrambled TFA is usually used as a negative control .

HY-P3732

RGD-4C	Integrin	Cancer
RGD-4C is a arginine-glycine-aspartic acid peptide (ACDCRGDCFC) with integrin binding activity. The Arg-Gly-Asp (RGD) sequence serves as the primary integrin recognition site in extracellular matrix proteins, and peptides containing this sequence can mimic the recognition specificity of the matrix proteins. RGD-4C is a αv-integrin ligand, can conjugate with bioactive molecule to exert antitumor effects in animal models .

HY-P5430

DYRKtide	DYRK	Others
DYRKtide is a biological active peptide. (Dyrktide is designed as the optimal substrate sequence efficiently phosphorylated by DYRK1A, which is a dual-specificity protein kinase that is thought to be involved in brain development.)

HY-P3935

Arg-Gly-Tyr-Ser-Leu-Gly	Ser/Thr Kinase	Cancer
Arg-Gly-Tyr-Ser-Leu-Gly is corresponding to the sequence of residues from 21 through 26 in lysozyme. Arg-Gly-Tyr-Ser-Leu-Gly can be used as a substrate for the protein kinase, and phosphorylated at serine residue by protein kinase .

HY-157881

2-Mercaptoethanesulfonic acid (ampule,3.0M±0.1M in H2O) β-Mercaptoethanesulfonic acid (ampule,3.0M±0.1M in H2O)	Biochemical Assay Reagents	Others
2-Mercaptoethanesulfonic acid (ampule,3.0M±0.1M in H2O) is a biochemical reagent that can be used for protein sequence analysis .

HY-P1734

Ac-MBP (1-11)	PKC	Neurological Disease
Ac-MBP 1-11, a short peptide sequence, is the major encephalitogenic epitope in myelin basic protein (MBP) .

HY-P4808

PHF6	Amyloid-β Autophagy	Neurological Disease
PHF6 (VQIVYK) is a self-assembly sequence capable of initiating the full-length tau protein aggregation and is mapped to the third microtubule-binding repeat region of the tau protein .

HY-P10719

Pepinh-MYD	MyD88	Infection Inflammation/Immunology
Pepinh-MYD is a MyD88 inhibitor that contains a domain sequence from MyD88 TIR and a protein transduction sequence, enabling it to penetrate the cell membrane. Pepinh-MYD interferes with MyD88-mediated TLR signaling pathways, thereby inhibiting related immune responses. It holds potential for studying the role of MyD88 in viral infections .

HY-114164D

Rat Thrombin	Thrombin	Cardiovascular Disease
Rat Thrombin is a Na ⁺-activated, allosteric serine protease that plays opposing functional roles in blood coagulation. Thrombin recognition sequence and can be used to digest GST-tagged proteins .

HY-114164F

Canine Thrombin	Thrombin	Cardiovascular Disease
Canine Thrombin is a Na ⁺-activated, allosteric serine protease that plays opposing functional roles in blood coagulation. Thrombin recognition sequence and can be used to digest GST-tagged proteins .

HY-114164E

Rabbit Thrombin	Thrombin	Cardiovascular Disease
Rabbit Thrombin is a Na ⁺-activated, allosteric serine protease that plays opposing functional roles in blood coagulation. Thrombin recognition sequence and can be used to digest GST-tagged proteins .

HY-114164G

Murine Thrombin	Thrombin	Cardiovascular Disease
Murine Thrombin is a Na ⁺-activated, allosteric serine protease that plays opposing functional roles in blood coagulation. Thrombin recognition sequence and can be used to digest GST-tagged proteins .

HY-114164

Thrombin (MW 37kDa) 5+ Cited Publications	Thrombin	Neurological Disease
Thrombin (MW 37kDa) is a Na ⁺-activated, allosteric serine protease that plays opposing functional roles in blood coagulation. Thrombin recognition sequence and can be used to digest GST-tagged proteins.

HY-P10719A

Pepinh-MYD TFA	MyD88	Infection Inflammation/Immunology
Pepinh-MYD TFA is a MyD88 inhibitor that contains a domain sequence from MyD88 TIR and a protein transduction sequence, enabling it to penetrate the cell membrane. Pepinh-MYD TFA interferes with MyD88-mediated TLR signaling pathways, thereby inhibiting related immune responses. Pepinh-MYD TFA holds potential for studying the role of MyD88 in viral infections .

HY-121039

Avenin	Others	Inflammation/Immunology
Avenin is a storage protein derived from oats, containing peptide sequences that can be specifically recognized by T cells and activate immune responses, potentially triggering celiac disease (CD). Avenin can be utilized in research related to autoimmune diseases .

HY-P10510

R5 peptide	Biochemical Assay Reagents	Others
R5 peptide is one of the repeating peptide sequences that form the protein diatom in Cylindrotheca fusiformis. R5 peptide can be used as a template for the synthesis of Pd (palladium) nanoparticles (NPs). R5 peptide forms complexes with metal ions through the amine groups in its sequence, and the self-assembled structure of the peptide provides a confined spatial environment for the reduction of metal ions and the nucleation of nanoparticles. R5 peptide can be used in the research of biomimetic nanomaterials .

HY-P10532

Myelin basic protein, MBP (68-86)	PKC	Others Inflammation/Immunology
Myelin basic protein, MBP (68-86) is the portion of the 68th to 86th amino acid residues in the MBP protein sequence. Myelin basic protein, MBP (68-86) can act as an autoantigen, triggering the immune system to attack its own myelin. Myelin basic protein, MBP (68-86) is used as one of the immunogens in the experimental autoimmune encephalomyelitis (EAE) animal model to study immune responses associated with multiple sclerosis (MS) .

HY-P1924

IRBP(651-670) human, mouse	Lipocalin Family	Inflammation/Immunology
IRBP(651-670) human, mouse represents the amino acid sequence from positions 651 to 670 of the interphotoreceptor retinoid binding protein (IRBP). IRBP(651-670) human, mouse can be used to induce experimental autoimmune uveitis .

HY-147217

Bepirovirsen ISIS 505358	HBV	Infection
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-100758

FUBP1-IN-1 2 Publications Verification	DNA/RNA Synthesis	Cancer
FUBP1-IN-1 is a potent *FUSE binding protein* 1 (FUBP1)** inhibitor which interferes with the binding of FUBP1 to its single stranded target DNA FUSE sequence , with an IC₅₀ value of 11.0 μM .

HY-117695

AQC 3 Publications Verification 6-Aminoquinolyl-N-hydroxysccinimidyl carbamate	Fluorescent Dye	Others
AQC (6-Aminoquinolyl-N-hydroxysccinimidyl carbamate) is a reagent used for amino acid or protein sequence analysis by HPLC with fluorescence detection. AQC reacts with primary and secondary amino acids to yield fluorescent derivates, allowing amino acid detection at under-picomolar levels .

HY-P3509A

PNC-28 acetate	MDM-2/p53	Cancer
PNC-28 acetate is a peptide from the mdm-2-binding domain (residues 17–26) of the p53 protein which contains a membrane crossing-penetratin sequence. PNC-28 acetate can be used for pancreatic cancer research .

HY-P1924A

IRBP(651-670) human, mouse TFA	Transmembrane Glycoprotein	Inflammation/Immunology
IRBP(651-670) human, mouse (TFA) represents the amino acid sequence from positions 651 to 670 of the interphotoreceptor retinoid binding protein (IRBP). IRBP(651-670) human, mouse (TFA) can be used to induce experimental autoimmune uveitis .

HY-P3509

PNC-28	MDM-2/p53	Cancer
PNC-28 is a peptide from the mdm-2-binding domain (residues 17–26) of the p53 protein which contains a membrane crossing-penetratin sequence. PNC-28 can be used for pancreatic cancer research .

HY-P10778

me4 Peptide	Amino Acid Derivatives	Neurological Disease
me4 Peptide is a synthetic peptide designed based on the microexon me4 sequence of neuronal CPEB4 protein. me4 Peptide inhibits CPEB4 aggregation. me4 Peptide can be used in the study of disorders associated with autism spectrum disorders .

HY-147217A

Bepirovirsen sodium ISIS 505358 sodium	HBV	Infection
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-P1610

Asudemotide	PD-1/PD-L1	Cancer
Asudemotide (S-588410) is a peptide of human DEP domain-containing protein 1A. Asudemotide is an immunostimulant. Asudemotide has a sequence of H-Glu-Tyr-Tyr-Glu-Leu-Phe-Val-Asn-Ile-OH. Asudemotide induces a tumor immune response in esophageal cancer. .

HY-E70370

hrv 3c Protease	Virus Protease	Others
hrv 3c Protease is a protease originated from human rhinoviruses. hrv 3c Protease recognizes the sequence LEVLFQGP and cleaves precisely between the Q and GP residues. hrv 3c Protease can be used to remove additional tags from the target proteins .

HY-P5344

Dabcyl-LNKRLLHETQ-Edans Fluorigenic PEXEL peptide	Parasite	Others
Dabcyl-LNKRLLHETQ-Edans (Fluorigenic PEXEL peptide) is a biological active peptide. (This FRET substrate peptide for Plasmepsin V (PMV) is derived from the conserved Plasmodium Export Element (PEXEL) motif of Histidine-Rich Protein II (HRPII). PMV is an ER aspartic protease that recognizes and cleaves the RXL sequence within the PEXEL motif of proteins exported by human malaria parasite Plasmodium falciparum, allowing them to translocate into host erythrocytes.)

HY-P10471

MPSD MARCKS-ED	MARCKS PKC	Others
MPSD (MARCKS-ED) is a 25-amino acid peptide based on the effector domain sequence of the intracellular membrane protein myristoylated alanine-rich C-kinase substrate (MARCKS). MPSD can sense membrane curvature and recognize phosphatidylserine. MPSD can be utilized as biological probe to study membrane shape and lipid composition .

HY-P3051

CKS-17	Reverse Transcriptase	Inflammation/Immunology
CKS-17 is a synthetic retroviral envelope peptide. CKS-17 has the highly conserved amino acid sequences occurring within the transmembrane envelope protein of many animal and human retroviruses. CKS-17 acts as an immunomodulatory epitope and exhibits suppressive properties for numerous immune functions .

HY-149489

JH-131e-153	PKC	Neurological Disease
JH-131e-153, a diacylglycerol (DAG)-lactone, is a small molecule activator of Munc13-1, targeting the C1 domain. The activation sequence of JH-131e-153 on Munc13-1 is WT>I590≈R592A≈W588A. The C1 domain of Munc13-1 and protein kinase C (PKC) are homologous in sequence and structure. The activation sequence of JH-131e-153 on Munc13-1 and PKC was PKCα>Munc13-1>PKCε. JH-131e-153 regulates neuronal processes through Munc13-1 and can be further used in the study of neurodegenerative diseases .

HY-P5370

Scrambled β-amyloid (1-40)	Amyloid-β	Others
Scrambled β-amyloid (1-40) is a biological active peptide. (Aβ (1-40) together with Aβ (1-42) are two major C-terminal variants of the Aβ protein constituting the majority of Aβs. These undergo post-secretory aggregation and deposition in the Alzheimer’s disease brain. This peptide is the scrambled sequence of Abeta 1-40 HY-P0265)

HY-P10464

Tat-AKAP79 (326-336)	TRP Channel	Neurological Disease Inflammation/Immunology
TAT-AKAP79 326-336 is a cytoosmotic peptide. TAT-AKAP79 326-336 mimics a specific region on the AKAP79 protein that binds to TRPV1 ion channels (amino acid sequence 326-336). TAT-AKAP79 326-336 inhibits the sensitization of TRPV1 and reduce the overresponse of TRPV1 channels to stimuli caused by the activation of cellular kinases such as protein kinase A (PKA) and protein kinase C (PKC) by inflammatory mediators. TAT-AKAP79 326-336 can be used to study the mechanism of pain transduction and inflammatory hyperalgesia .

HY-P4873

Amylin (20-29) (human)	Amylin Receptor	Neurological Disease
Amylin (20-29) (human) is the fragment of human islet amyloid polypeptide (hIAPP) or Amylin. Amylin is a 37-residue hormone. Amylin (20-29) (human) is responsible for the amyloidogenic propensities of the full length protein. Amylin (20-29) (human) can be transformed into its corresponding peptoid and retropeptoid sequences, to obtain beta-sheet breaker peptides as amyloid inhibitors .

HY-101931

hVEGF-IN-1	VEGFR	Cancer
hVEGF-IN-1, a quinazoline derivative, could specifically bind to the G-rich sequence in the internal ribosome entry site A (IRES-A) and destabilize the G-quadruplex structure. hVEGF-IN-1 binds to the IRES-A (WT) with a K_d of 0.928 μM in SPR experiments. hVEGF-IN-1 could hinder tumor cells migration and repress tumor growth by decreasing VEGF-A protein expression .

HY-P991158

Rinvatercept	TGF-β Receptor	Neurological Disease
Rinvatercept, a fusion protein, is a glycyl (1)-chimeric N-terminal (1-108)-peptide (2-109) combined from the sequences of the extracellular domains of the human ACVR2A/B, and is fused via a G3 peptide linker (110-112) to an immunoglobulin G1 (IgG1) Fc fragment. Rinvatercept can be used for research of neuromuscular disease .

HY-P10457

15-Hydroxy prostaglandin dehydrogenase blocking peptide 15-PGDH (92-105)	15-PGDH	Others
5-Hydroxy prostaglandin dehydrogenase blocking peptide (15-PGDH (92-105)) is a blocking peptide that corresponds to the amino acids (AGVNNEKNWEKTLQ) located at positions 92-105 of the 15-hydroxy prostaglandin dehydrogenase (15-PGDH) sequence. 5-Hydroxy prostaglandin dehydrogenase blocking peptide can block the formation of protein-antibody complexes during immunohistochemical analysis of 15-PGDH .

HY-168886

Anticancer agent 263	c-Myc	Cancer
Anticancer agent 263 (compound 7) is a potent anticancer agent. Anticancer agent 263 binds to the G-quadruplex DNA (G4) sequence 22-mer Pu22, a mimic of c-Myc DNA. Anticancer agent 263 is a structure modulator, showcasing a significant enhancement in protein α-helix formation and the capability to form supramolecular network. Anticancer agent 263 shows no cytotoxicity .

HY-155991

RUNX-IN-2	Apoptosis	Cancer
RUNX-IN-2 (Compound Conjugate 3) covalently binds to the RUNX-binding sequences, and inhibits the binding of RUNX proteins to their target sites. RUNX-IN-2 induces the p53-dependent apoptosis and inhibits cancer cell growth. RUNX-IN-2 inhibits tumor growth in PANC-1 xenograft mice. RUNX-IN-2 has high alkylation efficiency and specificity .

HY-P10471A

MPSD TFA MARCKS-ED TFA	MARCKS PKC	Others
MPSD TFA (MARCKS-ED TFA) is the TFA salt form of MPSD (HY-P10471). MPSD TFA is a 25-amino acid peptide based on the effector domain sequence of the intracellular membrane protein myristoylated alanine-rich C-kinase substrate (MARCKS). MPSD TFA can sense membrane curvature and recognize phosphatidylserine. MPSD TFA can be utilized as biological probe to study membrane shape and lipid composition .

HY-P5483

Retro-indolicidin	Bacterial	Others
Retro-indolicidin is a biological active peptide. (Reverse peptide of indolicidin (Rev4) is a 13-amino acid residue peptide based on the sequence of indolicidin. Indolicidin, a member of the cathelicidin protein family, is a 13-amino acid residue cationic, antimicrobial peptide-amide isolated from the cytoplasmic granules of bovine neutrophils. The synthetic peptide Rev4 has been shown to possess strong antimicrobial as well as protease inhibitory activities in vitro.)

HY-P10295

p53 (232-240)	MDM-2/p53	Cancer
p53 (232-240) is a peptide segment of the 232-240 amino acid sequence of the human tumor suppressor protein p53. p53 (232-240) enhances its binding affinity to the Major histocompatibility complex (MHC), thereby enhancing the immunogenicity of this peptide to enhance the immune system's response to tumor antigens. p53 (232-240) can be used in the development of cancer vaccines and in the study of tumor cell recognition and clearance by the immune system .

HY-130670

CGP 54626A free base	GABA Receptor	Neurological Disease
CGP 54626A (free base) is a GABAB receptor modulator, which is essential in the central and peripheral nervous systems. It is used as a tool to identify and characterize GABAB receptor agonists and antagonists, which will aid in the development of drugs targeting diseases related to these systems. This discovery involves purified GABAB receptors, receptor proteins and their encoding nucleic acids, facilitating the study of new members of the GABAB receptor family through DNA cloning technology and sequence-derived probes .

HY-P10055

PSMA targeting peptide PSMA-1	PSMA	Cancer
PSMA-1 is a PSMA targeting peptide (GRFLTGGTGRLLRIS) and can be used for for targeted delivery of glucose-regulated protein (GRP)-silencing siRNAs in PCa cells. PSMA-1 is selected and polyarginine sequences R6 or R9 were added at the C terminus to generate the CTPs. FITC labeling of the peptide with an aminohexanoic acid (Ahx) linker at the N terminus produced FITC-PSMA-1，to track PSMA binding on PCa cells .

HY-P10607

IALYLQQNW	EBV	Cancer
IALYLQQNW is a specific nonapeptide sequence derived from the tumor-associated antigen latent membrane protein 1 (LMP1) encoded by Epstein-Barr virus (EBV). As a latent T-cell epitope, IALYLQQNW is able to activate EBV-specific cytotoxic T lymphocytes (CTLs), which are able to recognize and kill EBV-infected cells expressing LMP1. IALYLQQNW plays an important role in the immune response against EBV-associated tumors and can be used in the study of Hodgkin's disease and nasopharyngeal carcinoma .

HY-112163

Zotatifin Maximum Cited Publications 7 Publications Verification eFT226	Eukaryotic Initiation Factor (eIF) SARS-CoV Apoptosis	Infection Cancer
Zotatifin (eFT226) is a potent, selective, and well-tolerated eIF4A inhibitor. Zotatifin promotes eIF4A binding to specific mRNA sequences with recognition motifs in the 5’-UTRs (IC₅₀=2 nM) and interferes with the assembly of the eIF4F initiation complex . Zotatifin shows robust antiviral effects, it effectively reduces viral infectivity by inhibiting SARS-CoV-2 NP protein biogenesis (IC₉₀=37 nM) . Zotatifin induces cell apoptosis .

Cat. No.	Product Name

HY-L005

Epigenetics Compound Library

1,546 compounds

Epigenetics refers to changes in phenotype that are not rooted in DNA sequence. Many types of epigenetic processes have been identified, including DNA methylation, alteration in the structure of histone proteins and gene regulation by small noncoding microRNAs. Modification of DNA, protein, or RNA, resulting in changes to the function and/or regulation of these molecules, without altering their primary sequences, reveals the complexities of cellular differentiation, embryology, the regulation of gene expression, aging, cancer, and other diseases.

MCE provide a unique collection of 1,546 epigenetics-related compounds that can be used in the research of the related diseases.

Cat. No.	Product Name	Type

HY-130533

ReAsH-EDT2	Protein Labeling
ReAsH-EDT2 is a red fluorescent dye that marks proteins. ReAsH-EDT2 is a membrane-permeable biarsenical compound that binds covalently to tetracysteine sequences which allows the protein to be imaged. ReAsH-EDT2 can be used for protein localization and trafficking. (λ_ex=530 nm, λ_em=592 nm) .

HY-117695

AQC 3 Publications Verification 6-Aminoquinolyl-N-hydroxysccinimidyl carbamate	Fluorescent Dyes/Probes
AQC (6-Aminoquinolyl-N-hydroxysccinimidyl carbamate) is a reagent used for amino acid or protein sequence analysis by HPLC with fluorescence detection. AQC reacts with primary and secondary amino acids to yield fluorescent derivates, allowing amino acid detection at under-picomolar levels .

Cat. No.	Product Name	Target	Research Area

HY-P0315

Crosstide 2 Publications Verification	Akt	Others
Crosstide is a peptide analog of glycogen synthase kinase α/β fusion protein sequence which is a substrate for Akt.

HY-P0329

X-press Tag Peptide	Peptides	Others
X-press Tag Peptide is a tag peptide used for protein purification. X-press Tag is also an N-terminal leader peptide; this N-terminal peptide contains a polyhistidine sequence, the Xpress epitope (part of bacteriophage T7 gene 10 protein) and an enterokinase cleavage site. Anti-Xpress antibodies recognize the Xpress epitope sequence found in this leader peptide.

HY-P4808A

PHF6 TFA	Amyloid-β Autophagy	Neurological Disease
PHF6 (VQIVYK) TFA is a self-assembly sequence capable of initiating the full-length tau protein aggregation. PHF6 TFA is mapped to the third microtubule-binding repeat region of the tau protein .

HY-P1849A

JAG-1, scrambled TFA scJag-1 TFA	Notch	Cardiovascular Disease
JAG-1, scrambled (scJag-1) TFA is a scrambled sequence of JAG-1 (Jagged-1 protein). JAG-1, scrambled TFA has a random sequence of the amino acids that are the same as the active fragment. JAG-1, scrambled TFA is usually used as a negative control .

HY-P3732

RGD-4C	Integrin	Cancer
RGD-4C is a arginine-glycine-aspartic acid peptide (ACDCRGDCFC) with integrin binding activity. The Arg-Gly-Asp (RGD) sequence serves as the primary integrin recognition site in extracellular matrix proteins, and peptides containing this sequence can mimic the recognition specificity of the matrix proteins. RGD-4C is a αv-integrin ligand, can conjugate with bioactive molecule to exert antitumor effects in animal models .

HY-P5430

DYRKtide	DYRK	Others
DYRKtide is a biological active peptide. (Dyrktide is designed as the optimal substrate sequence efficiently phosphorylated by DYRK1A, which is a dual-specificity protein kinase that is thought to be involved in brain development.)

HY-P4749

Prion Protein (106-126) (human) (scrambled)	Peptides	Neurological Disease
Prion Protein (106-126) (human) (scrambled) is a scrambled sequence of Prion Protein (106-126). Prion Protein (106-126) (human) (scrambled) with a random sequence of the amino acids that are the same as the active fragment. Prion Protein (106-126) (human) (scrambled) usually used as a negative control .

HY-P1734

Ac-MBP (1-11)	PKC	Neurological Disease
Ac-MBP 1-11, a short peptide sequence, is the major encephalitogenic epitope in myelin basic protein (MBP) .

HY-P4808

PHF6	Amyloid-β Autophagy	Neurological Disease
PHF6 (VQIVYK) is a self-assembly sequence capable of initiating the full-length tau protein aggregation and is mapped to the third microtubule-binding repeat region of the tau protein .

HY-P1849

JAG-1, scrambled scJag-1	Peptides	Cardiovascular Disease
JAG-1, scrambled (scJag-1) is a scrambled sequence of JAG-1 (Jagged-1 protein). JAG-1, scrambled has a random sequence of the amino acids that are the same as the active fragment. JAG-1, scrambled is usually used as a negative control .

HY-P3935

Arg-Gly-Tyr-Ser-Leu-Gly	Ser/Thr Kinase	Cancer
Arg-Gly-Tyr-Ser-Leu-Gly is corresponding to the sequence of residues from 21 through 26 in lysozyme. Arg-Gly-Tyr-Ser-Leu-Gly can be used as a substrate for the protein kinase, and phosphorylated at serine residue by protein kinase .

HY-P10719

Pepinh-MYD	MyD88	Infection Inflammation/Immunology
Pepinh-MYD is a MyD88 inhibitor that contains a domain sequence from MyD88 TIR and a protein transduction sequence, enabling it to penetrate the cell membrane. Pepinh-MYD interferes with MyD88-mediated TLR signaling pathways, thereby inhibiting related immune responses. It holds potential for studying the role of MyD88 in viral infections .

HY-P10719A

Pepinh-MYD TFA	MyD88	Infection Inflammation/Immunology
Pepinh-MYD TFA is a MyD88 inhibitor that contains a domain sequence from MyD88 TIR and a protein transduction sequence, enabling it to penetrate the cell membrane. Pepinh-MYD TFA interferes with MyD88-mediated TLR signaling pathways, thereby inhibiting related immune responses. Pepinh-MYD TFA holds potential for studying the role of MyD88 in viral infections .

HY-P3541

Dirucotide MBP8298	Peptides	Neurological Disease Inflammation/Immunology
Dirucotide (MBP8298) is a synthetic peptide that consists of 17 amino acids linked in a sequence identical to that of a portion of human myelin basic protein. Dirucotide can be used for the research in autoimmune disorder of the central nervous system, such as Multiple sclerosis (MS) .

HY-P10510

R5 peptide	Biochemical Assay Reagents	Others
R5 peptide is one of the repeating peptide sequences that form the protein diatom in Cylindrotheca fusiformis. R5 peptide can be used as a template for the synthesis of Pd (palladium) nanoparticles (NPs). R5 peptide forms complexes with metal ions through the amine groups in its sequence, and the self-assembled structure of the peptide provides a confined spatial environment for the reduction of metal ions and the nucleation of nanoparticles. R5 peptide can be used in the research of biomimetic nanomaterials .

HY-P10532

Myelin basic protein, MBP (68-86)	PKC	Others Inflammation/Immunology
Myelin basic protein, MBP (68-86) is the portion of the 68th to 86th amino acid residues in the MBP protein sequence. Myelin basic protein, MBP (68-86) can act as an autoantigen, triggering the immune system to attack its own myelin. Myelin basic protein, MBP (68-86) is used as one of the immunogens in the experimental autoimmune encephalomyelitis (EAE) animal model to study immune responses associated with multiple sclerosis (MS) .

HY-P1924

IRBP(651-670) human, mouse	Lipocalin Family	Inflammation/Immunology
IRBP(651-670) human, mouse represents the amino acid sequence from positions 651 to 670 of the interphotoreceptor retinoid binding protein (IRBP). IRBP(651-670) human, mouse can be used to induce experimental autoimmune uveitis .

HY-P3817

Des-[Gly77,His78] Myelin Basic Protein (68-84), bovine	Peptides	Neurological Disease
Des-[Gly77,His78] Myelin Basic Protein (68-84) is a 68-84 sequence fragment of guinea pig myelin basic protein (GPMBP). Des-[Gly77,His78] Myelin Basic Protein (68-84) regulates functionally diverse encephalitogenic and proliferative activities of experimental autoimmune encephalomyelitis (EAE)-associated T cells .

HY-P3509A

PNC-28 acetate	MDM-2/p53	Cancer
PNC-28 acetate is a peptide from the mdm-2-binding domain (residues 17–26) of the p53 protein which contains a membrane crossing-penetratin sequence. PNC-28 acetate can be used for pancreatic cancer research .

HY-P1924A

IRBP(651-670) human, mouse TFA	Transmembrane Glycoprotein	Inflammation/Immunology
IRBP(651-670) human, mouse (TFA) represents the amino acid sequence from positions 651 to 670 of the interphotoreceptor retinoid binding protein (IRBP). IRBP(651-670) human, mouse (TFA) can be used to induce experimental autoimmune uveitis .

HY-P3509

PNC-28	MDM-2/p53	Cancer
PNC-28 is a peptide from the mdm-2-binding domain (residues 17–26) of the p53 protein which contains a membrane crossing-penetratin sequence. PNC-28 can be used for pancreatic cancer research .

HY-P10778

me4 Peptide	Amino Acid Derivatives	Neurological Disease
me4 Peptide is a synthetic peptide designed based on the microexon me4 sequence of neuronal CPEB4 protein. me4 Peptide inhibits CPEB4 aggregation. me4 Peptide can be used in the study of disorders associated with autism spectrum disorders .

HY-P1610

Asudemotide	PD-1/PD-L1	Cancer
Asudemotide (S-588410) is a peptide of human DEP domain-containing protein 1A. Asudemotide is an immunostimulant. Asudemotide has a sequence of H-Glu-Tyr-Tyr-Glu-Leu-Phe-Val-Asn-Ile-OH. Asudemotide induces a tumor immune response in esophageal cancer. .

HY-115379

Latromotide	Peptides	Cancer
Latromotide is a synthetic peptide with antineoplastic activity. It consists of 10 amino acids corresponding to amino acid residues 66-75 of the human kinesin-like protein KIF20A. Latromotide has a sequence of H-Lys-Val-Tyr-Leu-Arg-Val-Arg-Pro Leu-Leu-OH .

HY-P5344

Dabcyl-LNKRLLHETQ-Edans Fluorigenic PEXEL peptide	Parasite	Others
Dabcyl-LNKRLLHETQ-Edans (Fluorigenic PEXEL peptide) is a biological active peptide. (This FRET substrate peptide for Plasmepsin V (PMV) is derived from the conserved Plasmodium Export Element (PEXEL) motif of Histidine-Rich Protein II (HRPII). PMV is an ER aspartic protease that recognizes and cleaves the RXL sequence within the PEXEL motif of proteins exported by human malaria parasite Plasmodium falciparum, allowing them to translocate into host erythrocytes.)

HY-P10471

MPSD MARCKS-ED	MARCKS PKC	Others
MPSD (MARCKS-ED) is a 25-amino acid peptide based on the effector domain sequence of the intracellular membrane protein myristoylated alanine-rich C-kinase substrate (MARCKS). MPSD can sense membrane curvature and recognize phosphatidylserine. MPSD can be utilized as biological probe to study membrane shape and lipid composition .

HY-P3051

CKS-17	Reverse Transcriptase	Inflammation/Immunology
CKS-17 is a synthetic retroviral envelope peptide. CKS-17 has the highly conserved amino acid sequences occurring within the transmembrane envelope protein of many animal and human retroviruses. CKS-17 acts as an immunomodulatory epitope and exhibits suppressive properties for numerous immune functions .

HY-P5370

Scrambled β-amyloid (1-40)	Amyloid-β	Others
Scrambled β-amyloid (1-40) is a biological active peptide. (Aβ (1-40) together with Aβ (1-42) are two major C-terminal variants of the Aβ protein constituting the majority of Aβs. These undergo post-secretory aggregation and deposition in the Alzheimer’s disease brain. This peptide is the scrambled sequence of Abeta 1-40 HY-P0265)

HY-P10477

CT-08	Peptides	Cancer
CT-08 (CT8, Compound 3) is a macrocyclic Sec61 modulator, blocks protein secretion in a signal sequence-dependent manner. CT-08 blocks Sec61-mediated translocation of VCAMss-GLuc into the ER, resulting in a loss of luciferase activity. CT-08 inhibits VCAM expression in transfected cells .

HY-P10464

Tat-AKAP79 (326-336)	TRP Channel	Neurological Disease Inflammation/Immunology
TAT-AKAP79 326-336 is a cytoosmotic peptide. TAT-AKAP79 326-336 mimics a specific region on the AKAP79 protein that binds to TRPV1 ion channels (amino acid sequence 326-336). TAT-AKAP79 326-336 inhibits the sensitization of TRPV1 and reduce the overresponse of TRPV1 channels to stimuli caused by the activation of cellular kinases such as protein kinase A (PKA) and protein kinase C (PKC) by inflammatory mediators. TAT-AKAP79 326-336 can be used to study the mechanism of pain transduction and inflammatory hyperalgesia .

HY-P4873

Amylin (20-29) (human)	Amylin Receptor	Neurological Disease
Amylin (20-29) (human) is the fragment of human islet amyloid polypeptide (hIAPP) or Amylin. Amylin is a 37-residue hormone. Amylin (20-29) (human) is responsible for the amyloidogenic propensities of the full length protein. Amylin (20-29) (human) can be transformed into its corresponding peptoid and retropeptoid sequences, to obtain beta-sheet breaker peptides as amyloid inhibitors .

HY-P10491

MAGE A4 (230-239)	Peptides	Cancer
MAGE A4 (230-239) is a peptide sequence derived from the MAGE-A4 protein. MAGE A4 (230-239) is an immunogenic epitope that can activate T cells and trigger the killing of tumor cells expressing MAGE-A4. MAGE A4 (230-239) is used in the development of next-generation T cell-based immunotherapies .

HY-P10457

15-Hydroxy prostaglandin dehydrogenase blocking peptide 15-PGDH (92-105)	15-PGDH	Others
5-Hydroxy prostaglandin dehydrogenase blocking peptide (15-PGDH (92-105)) is a blocking peptide that corresponds to the amino acids (AGVNNEKNWEKTLQ) located at positions 92-105 of the 15-hydroxy prostaglandin dehydrogenase (15-PGDH) sequence. 5-Hydroxy prostaglandin dehydrogenase blocking peptide can block the formation of protein-antibody complexes during immunohistochemical analysis of 15-PGDH .

HY-P10471A

MPSD TFA MARCKS-ED TFA	MARCKS PKC	Others
MPSD TFA (MARCKS-ED TFA) is the TFA salt form of MPSD (HY-P10471). MPSD TFA is a 25-amino acid peptide based on the effector domain sequence of the intracellular membrane protein myristoylated alanine-rich C-kinase substrate (MARCKS). MPSD TFA can sense membrane curvature and recognize phosphatidylserine. MPSD TFA can be utilized as biological probe to study membrane shape and lipid composition .

HY-P5483

Retro-indolicidin	Bacterial	Others
Retro-indolicidin is a biological active peptide. (Reverse peptide of indolicidin (Rev4) is a 13-amino acid residue peptide based on the sequence of indolicidin. Indolicidin, a member of the cathelicidin protein family, is a 13-amino acid residue cationic, antimicrobial peptide-amide isolated from the cytoplasmic granules of bovine neutrophils. The synthetic peptide Rev4 has been shown to possess strong antimicrobial as well as protease inhibitory activities in vitro.)

HY-P10295

p53 (232-240)	MDM-2/p53	Cancer
p53 (232-240) is a peptide segment of the 232-240 amino acid sequence of the human tumor suppressor protein p53. p53 (232-240) enhances its binding affinity to the Major histocompatibility complex (MHC), thereby enhancing the immunogenicity of this peptide to enhance the immune system's response to tumor antigens. p53 (232-240) can be used in the development of cancer vaccines and in the study of tumor cell recognition and clearance by the immune system .

HY-P10055

PSMA targeting peptide PSMA-1	PSMA	Cancer
PSMA-1 is a PSMA targeting peptide (GRFLTGGTGRLLRIS) and can be used for for targeted delivery of glucose-regulated protein (GRP)-silencing siRNAs in PCa cells. PSMA-1 is selected and polyarginine sequences R6 or R9 were added at the C terminus to generate the CTPs. FITC labeling of the peptide with an aminohexanoic acid (Ahx) linker at the N terminus produced FITC-PSMA-1，to track PSMA binding on PCa cells .

HY-P10607

IALYLQQNW	EBV	Cancer
IALYLQQNW is a specific nonapeptide sequence derived from the tumor-associated antigen latent membrane protein 1 (LMP1) encoded by Epstein-Barr virus (EBV). As a latent T-cell epitope, IALYLQQNW is able to activate EBV-specific cytotoxic T lymphocytes (CTLs), which are able to recognize and kill EBV-infected cells expressing LMP1. IALYLQQNW plays an important role in the immune response against EBV-associated tumors and can be used in the study of Hodgkin's disease and nasopharyngeal carcinoma .

HY-P10553

ARF(26–44), cell-permeable	Apoptosis	Cancer
ARF(26–44), cell-permeable is a cell-penetrating peptide derived from a specific amino acid sequence of the p14ARF tumor suppressor protein. As a functional inhibitor of FoxM1, ARF(26–44) cell-permeable shows significant anti-tumor activity in the treatment of mouse hepatocellular carcinoma (HCC), significantly increasing tumor cell apoptosis and reducing tumor cell proliferation and angiogenesis. ARF(26–44), cell-permeable can be used in research on tumor therapy .

HY-P10496

MAGE-A1-derived peptide	Peptides	Cancer
MAGE-A1-derived peptide is a short peptide sequence derived from MAGE-A1 protein. As a tumor-specific antigen, MAGE-A1-derived peptide can be recognized and activated by cytotoxic T lymphocytes (CTLs), thereby generating an immune response to tumor cells expressing MAGE-A1. This immune response can lead to the lysis and death of tumor cells. MAGE-A1-derived peptide can be used in the study of tumor immunity .

HY-P10496A

MAGE-A1-derived peptide acetate	Peptides	Cancer
MAGE-A1-derived peptide acetate is a short peptide sequence derived from MAGE-A1 protein. As a tumor-specific antigen, MAGE-A1-derived peptide acetate can be recognized and activated by cytotoxic T lymphocytes (CTLs), thereby generating an immune response to tumor cells expressing MAGE-A1. This immune response can lead to the lysis and death of tumor cells. MAGE-A1-derived peptide acetate can be used in the study of tumor immunity .

HY-P5395

TAT-GluR23A Fusion Peptide	HIV	Others
TAT-GluR23A Fusion Peptide is a biological active peptide. (This is the GluR23A sequence, a control inactive peptide used as a mutant counterpart to glutamate receptor endocytosis inhibitor (GluR23Y), connected to an 11 amino acid cell permeable HIV Trans-Activator of Transcription (TAT) protein transduction domain (PTD). GluR23A is derived from GluR23Y amino acids 869 to 877, with Ala substituted for Tyr, and thus lacking essential phosphorylation sites.Control peptide of HY-P2259)

HY-P5439

Epsilon-V1-2, Cys-conjugated	PKC MARCKS	Others
Epsilon-V1-2, Cys-conjugated is a biological active peptide. (This peptide is the εPKC specific inhibitor. Its inhibitory activity is based on εPKC translocation and MARCKS phosphorylation. This peptide interferes with εPKC interaction with the anchoring protein εRACK. This peptide contains a cysteine residue added to the C-terminus for potential S-S bond formation with a carrier protein.Pyroglutamyl (pGlu) peptides may spontaneously form when either Glutamine (Q) or Glutamic acid (E) is located at the sequence N-terminus. The conversion of Q or E to pGlu is a natural occurrence and in general it is believed that the hydrophobic γ-lactam ring of pGlu may play a role in peptide stability against gastrointestinal proteases. Pyroglutamyl peptides are therefore considered a normal subset of such peptides and are included as part of the peptide purity during HPLC analysis.)

HY-P5429

DNA-PK Substrate	Peptides	Others
DNA-PK Substrate is a biological active peptide. (A substrate for DNA-dependent protein kinase (DNA-PK), phosphorylation. DNA-PK is essential for the repair of DNA double-strand breaks. This peptide corresponding to 11–24 amino acids of human p53 with threonine 18 and serine 20 changed to alanine is used as a substrate for the assay of DNA-PK activityPyroglutamyl (pGlu) peptides may spontaneously form when either Glutamine (Q) or Glutamic acid (E) is located at the sequence N-terminus. The conversion of Q or E to pGlu is a natural occurrence and in general it is believed that the hydrophobic γ-lactam ring of pGlu may play a role in peptide stability against gastrointestinal proteases. Pyroglutamyl peptides are therefore considered a normal subset of such peptides and are included as part of the peptide purity during HPLC analysis.)

HY-P5325

Bid BH3 (80-99)	Bcl-2 Family	Others
Bid BH3 (80-99) is a biological active peptide. (BID is a pro-apoptotic member of the 'BH3-only' (BOPS) subset of the BCL-2 family of proteins that constitute a critical control point in apoptosis. Bid is the first of the BOPs reported to bind and activate Bcl-2, Bax, and Bak. Bid serves as a death-inducing ligand that moves from the cytosol to the mitochondrial membrane to inactivate Bcl-2 or to activate Bax.Pyroglutamyl (pGlu) peptides may spontaneously form when either Glutamine (Q) or Glutamic acid (E) is located at the sequence N-terminus. The conversion of Q or E to pGlu is a natural occurrence and in general it is believed that the hydrophobic γ-lactam ring of pGlu may play a role in peptide stability against gastrointestinal proteases. Pyroglutamyl peptides are therefore considered a normal subset of such peptides and are included as part of the peptide purity during HPLC analysis.)

Cat. No.	Product Name	Target	Research Area

HY-P991158

Rinvatercept	TGF-β Receptor	Neurological Disease
Rinvatercept, a fusion protein, is a glycyl (1)-chimeric N-terminal (1-108)-peptide (2-109) combined from the sequences of the extracellular domains of the human ACVR2A/B, and is fused via a G3 peptide linker (110-112) to an immunoglobulin G1 (IgG1) Fc fragment. Rinvatercept can be used for research of neuromuscular disease .

HY-P990088

Sotiburafusp alfa	VEGFR PD-1/PD-L1	Cardiovascular Disease
Sotiburafusp alfa is a bispecific fusion protein, which is a humanized VEGFR-1 extracellular domain fragment (129-228, 1-100 in the current sequence) fused via the peptide linker ¹⁰¹GGSGGSGGSGGSGGS ¹¹⁵ to the N-terminus of the heavy chain (116-564) of a humanized IgG1-kappa anti-human PD-L1 heavy chain variant L352>A, L353>A. Sotiburafusp alfa is also an angiogenesis inhibitor .

Cat. No.	Product Name	Category	Target	Chemical Structure

HY-N0086R

N6-Methyladenosine (Standard)	Structural Classification Natural Products Microorganisms Source classification Endogenous metabolite	Influenza Virus Endogenous Metabolite
N6-Methyladenosine (Standard) is the analytical standard of N6-Methyladenosine. This product is intended for research and analytical applications. N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities. In Vitro: N6-methyladenosine (m6A) is selectively recognized by the human YTH domain family 2 (YTHDF2) protein to regulate mRNA degradation. N6-methyladenosine (m6A), a prevalent internal modification in the messenger RNA of all eukaryotes, is post-transcriptionally installed by m6A methyltransferase (e.g., MT-A70) within the consensus sequence of G(m6A)C (70%) or A(m6A)C (30%). N6-methyladenosine (m6A)-containing RNAs are greatly enriched in the YTHDF-bound portion and diminished in the flow-through portion . N6-methyladenosine (m6A), the most abundant internal RNA modification, functions in diverse biological processes, including regulation of embryonic stem cell self-renewal and differentiation. N6-methyladenosine (m6A) is a large protein complex, consisting in part of methyltransferase-like 3 (METTL3) and methyltransferase-like 14 (METTL14) catalytic subunits .

Species:	Human (19) Mouse (2) Cynomolgus (1)
Tag:	His (13) T7 (1) Tag Free (2) Avi (1) Myc (3) GST (3) Fc (4)
Source:	HEK293 (12) Sf9 insect cells (1) P. pastoris (1) E. coli (8)

Cat. No.	Compare	Product Name	Species	Source

HY-P70157

	MICA Protein, Human (HEK293, His) rHuMHC class I polypeptide-related sequence A/MICA, His ; MHC Class I Polypeptide-Related sequence A; MIC-A; MICA; PERB11.1	Human	HEK293
	MICA is a ligand for the stress signaling protein and natural killer (NK) cell activating receptor KLRK1/NKG2D. Tumor cells shed the expressed MICA protein and undergo immune evasion. MICA Protein, Human (HEK293, His) is the recombinant human-derived MICA protein, expressed by HEK293 , with C-6*His labeled tag.

HY-P76686

	TSPAN31 Protein, Human (HEK293, Fc) Tetraspanin-31; Tspan-31; Sarcoma-amplified sequence; SAS	Human	HEK293
	TSPAN31 is a member of the tetraspanin protein family, which has four hydrophobic domains. TSPAN31 mediates signal transduction events and plays a role in the regulation of cell development, activation, growth, and movement. TSPAN31 is also associated with tumorigenesis and osteosarcoma. TSPAN31 Protein, Human (HEK293, Fc) is the recombinant human-derived TSPAN31 protein, expressed by HEK293 , with N-mFc labeled tag. The total length of TSPAN31 Protein, Human (HEK293, Fc) is 80 a.a., with molecular weight of 40-46 kDa.

HY-P700271

	BCAS2 Protein, Human (N-GST) rHuBCAS2, His, N-T7; Pre-mRNA-Splicing Factor SPF27; Breast Carcinoma-Amplified sequence 2; Spliceosome-Associated protein SPF 27; BCAS2	Human	E. coli
	BCAS2 is essential for pre-mRNA splicing and is critical for spliceosome activation as a key component of the activated spliceosome and the PRP19-CDC5L complex. It may act as a scaffold in spliceosome assembly, forming contacts with core components. BCAS2 Protein, Human (N-GST) is the recombinant human-derived BCAS2 protein, expressed by E. coli , with N-GST labeled tag. The total length of BCAS2 Protein, Human (N-GST) is 224 a.a., with molecular weight of ~53 kDa.

HY-P7649

	BCAS2 Protein, Human (His, T7) rHuBCAS2, His, N-T7; Pre-mRNA-Splicing Factor SPF27; Breast Carcinoma-Amplified sequence 2; Spliceosome-Associated protein SPF 27; BCAS2	Human	E. coli
	BCAS2 Protein, Human (His, T7) plays crucial roles in pre-mRNA splicing and androgen receptor transcription. BCAS2 helps repair radiation-induced DSBs efficiently in both human PCa cells and Drosophila.

HY-P73294

	MICB Protein, Human (HEK293, His) MHC class I polypeptide-related sequence B; MIC-B; PERB11.2	Human	HEK293
	MICB Protein, a heavily glycosylated ligand for NKG2D receptor, triggers cytolytic response in immune cells. It resembles MHC class I molecules but lacks association with beta-2-microglobulin or peptide binding. Alternative splicing leads to multiple transcript variants. MICB is widely expressed, especially in lymph nodes and bone marrow, highlighting its immune response role in diverse physiological contexts. MICB Protein, Human (HEK293, His) is the recombinant human-derived MICB protein, expressed by HEK293 , with C-His, C-6*His labeled tag. The total length of MICB Protein, Human (HEK293, His) is 276 a.a., with molecular weight of ~45 kDa.

HY-P75928

	MICA Protein, Cynomolgus (HEK293, His) MHC class I polypeptide-related sequence A; MIC-A; PERB11.1	Cynomolgus	HEK293
	MICA Protein, Cynomolgus (HEK293, His) is the recombinant cynomolgus-derived MICA, expressed by HEK293 , with C-His labeled tag. ,

HY-P70579

	MICA Protein, Human (HEK293, Fc) MHC Class I Polypeptide-Related sequence A; MIC-A; MICA; PERB11.1	Human	HEK293
	MICA is a ligand for the stress signaling protein and natural killer (NK) cell activating receptor KLRK1/NKG2D. Tumor cells shed the expressed MICA protein and undergo immune evasion. MICA Protein, Human (HEK293, Fc) is the recombinant human-derived MICA protein, expressed by HEK293 , with C-hFc labeled tag. The total length of MICA Protein, Human (HEK293, Fc) is 285 a.a., with molecular weight of 85-110 kDa.

HY-P73293

	MICB Protein, Human (HEK293, His-Fc) MHC class I polypeptide-related sequence B; MIC-B; PERB11.2	Human	HEK293
	In contrast to antigen presentation, MICB proteins serve as stress-induced autoantigens and are recognized by γδ T cells. As a ligand for the KLRK1/NKG2D receptor, binding of MICB results in cell lysis. MICB Protein, Human (HEK293, His-Fc) is the recombinant human-derived MICB protein, expressed by HEK293 , with C-hFc, C-His labeled tag.

HY-P700585

	AXL Protein, Human (D266N, HEK293, His) AXL receptor tyrosine kinase; tyrosine-protein kinase receptor UFO; JTK11; UFO; AXL oncogene; oncogene AXL; AXL transforming sequence/gene	Human	HEK293
	AXL protein is a receptor tyrosine kinase that mediates signals by binding to GAS6 and regulates cell survival, proliferation, migration and differentiation. After ligand binding, AXL dimerizes and autophosphorylates, activating downstream molecules, such as PI3 kinase subunits, GRB2, PLCG1, etc. AXL Protein, Human (D266N, HEK293, His) is the recombinant human-derived AXL protein, expressed by HEK293 , with C-10*His labeled tag and D266N, , , , mutation. The total length of AXL Protein, Human (D266N, HEK293, His) is 426 a.a., with molecular weight of 48.9 kDa.

HY-P700586

	AXL Protein, Human (D266N, HEK293, hFc) AXL receptor tyrosine kinase; tyrosine-protein kinase receptor UFO; JTK11; UFO; AXL oncogene; oncogene AXL; AXL transforming sequence/gene	Human	HEK293
	AXL protein is a receptor tyrosine kinase that mediates signals by binding to GAS6 and regulates cell survival, proliferation, migration and differentiation. After ligand binding, AXL dimerizes and autophosphorylates, activating downstream molecules, such as PI3 kinase subunits, GRB2, PLCG1, etc. AXL Protein, Human (D266N, HEK293, hFc) is the recombinant human-derived AXL protein, expressed by HEK293 , with C-hFc labeled tag and D266N, , , , mutation. The total length of AXL Protein, Human (D266N, HEK293, hFc) is 426 a.a., with molecular weight of 75.1 kDa.

HY-P702703

	AXL Protein, Human (Biotinylated, sf9, GST, Avi) AXL; AXL receptor tyrosine kinase; tyrosine-protein kinase receptor UFO; JTK11; UFO; AXL oncogene; oncogene AXL; AXL transforming sequence/gene;	Human	Sf9 insect cells
	AXL protein is a receptor tyrosine kinase that mediates signals by binding to GAS6 and regulates cell survival, proliferation, migration and differentiation. After ligand binding, AXL dimerizes and autophosphorylates, activating downstream molecules, such as PI3 kinase subunits, GRB2, PLCG1, etc. AXL Protein, Human (Biotinylated, sf9, GST, Avi) is the recombinant human-derived AXL, expressed by Sf9 insect cells , with GST, Avi labeled tag. The total length of AXL Protein, Human (Biotinylated, sf9, GST, Avi) is 422 a.a.,

HY-P71639

	CORS26 Protein, Mouse (Myc, His) C1qtnf3; Cors26; Ctrp3; Complement C1q tumor necrosis factor-related protein 3; Collagenous repeat-containing sequence 26kDa protein; CORS26; Secretory protein CORS26	Mouse	E. coli
	CORS26 Protein is a secreted protein of the C1q/ TNF-associated protein (CTRPs) family. CORS26 Protein involved in the LAMP1-STAT3, SIRT1/NF-魏B/p53, NF-魏B and TGF-尾1/Smad3 pathways play anti-inflammatory effects. CORS26 Protein also inhibited the expression of antimicrobial peptide (CAMP) in adipocytes induced by toll-like receptors (TLR). CORS26 Protein, Mouse (Myc, His) is the recombinant mouse-derived CORS26 protein, expressed by E. coli , with N-His, C-Myc labeled tag. The total length of CORS26 Protein, Mouse (Myc, His) is 224 a.a., with molecular weight of ~31.1 kDa.

HY-P71677

	FAM20C Protein, Human (HEK293, Myc, His) C76981; Dentin matrix protein 4; Family with sequence similarity 20 member C; GEF CK; Golgi enriched fraction casein kinase; protein FAM20C; RNS	Human	HEK293
	The FAM20C protein is a Golgi kinase that phosphorylates secretory pathway proteins and contributes to the biomineralization of bones and teeth. FAM20C phosphorylates caseins and proteins involved in biomineralization and also affects lipid homeostasis, wound healing, and cell migration and adhesion. FAM20C Protein, Human (HEK293, Myc, His) is the recombinant human-derived FAM20C protein, expressed by HEK293 , with N-His, C-Myc labeled tag.

HY-P79169

	TAFA1/FAM19A1 Protein, Human TAFA Chemokine Like Family Member 1; FAM19A1; TAFA-1; Family With sequence Similarity 19 Member A1, C-C Motif Chemokine Like; Chemokine-Like protein TAFA-1; Family With sequence Similarity 19 (Chemokine (C-C Motif)-Like), Member A1; protein FAM19A1; Famil	Human	E. coli
	The Dll3 protein is a transmembrane ligand that plays a critical role in regulating cell differentiation and patterning during embryonic development. It participates in the Notch signaling pathway and helps determine cell fate. TAFA1/FAM19A1 Protein, Human is the recombinant human-derived TAFA1/FAM19A1 protein, expressed by E. coli , with tag free.

HY-P700616

	ANO1/Anoctamin-1 Protein, Human (N-His, C-Myc) anoctamin 1, calcium activated chloride channel; oral cancer overexpressed 2, ORAOV2, TMEM16A, transmembrane protein 16A; anoctamin-1; DOG1; FLJ10261; TAOS2; oral cancer overexpressed 2; tumor-amplified and overexpressed sequence 2; discovered on gastrointestinal stromal tumors protein 1; transmembrane protein 16A (eight membrane-spanning domains); ORAOV2; TMEM16A	Human	E. coli
	ANO1/Anoctamin-1 protein, a calcium-activated chloride channel (CaCC), is involved in ion transport, smooth muscle contraction, and mucus secretion. ANO1/Anoctamin-1 Protein, Human (N-His, C-Myc) is the recombinant human-derived ANO1/Anoctamin-1 protein, expressed by E. coli , with C-Myc, N-10*His labeled tag.

HY-P71350

	TAFA4 Protein, Human (His) protein FAM19A4; Chemokine-like protein TAFA-4; TAFA4; family with sequence similarity 19 (chemokine (C-C motif)-like); member A4; FAM19A4; chemokine-like protein TAFA-4	Human	E. coli
	TAFA4 protein, a modulator of injury-induced and chemical pain hypersensitivity, influences pain responses. It serves as a ligand for FPR1, chemoattracting macrophages, enhancing phagocytosis, and elevating reactive oxygen species (ROS) release. TAFA4's multifaceted role indicates involvement in immune responses and cellular processes related to inflammation and injury. TAFA4 Protein, Human (His) is the recombinant human-derived TAFA4 protein, expressed by E. coli , with N-6*His labeled tag. The total length of TAFA4 Protein, Human (His) is 106 a.a., with molecular weight of ~16.0 kDa.

HY-P701118

	NIP30 Protein, Human (HEK293, His) FAM192A; CDA10; NIP30; CDA018; C16orf94; family with sequence similarity 192, member A; protein FAM192A; NEFA-interacting nuclear protein NIP30	Human	HEK293
	The NIP30 protein negatively regulates proteasomal protein catabolism and protein binding activity. It is located in the nucleus and is expressed in various tissues including the brain and testis. NIP30 Protein, Human (HEK293, His) is the recombinant human-derived NIP30 protein, expressed by HEK293 , with C-His labeled tag. The total length of NIP30 Protein, Human (HEK293, His) is 254 a.a., with molecular weight (glycosylation form) of ~35-43 kDa.

HY-P700509

	TFF1 Protein, Human (P. pastoris, N-His) TFF1; BCEI; D21S21; HP1.A; HPS2; pNR-2; pS2; trefoil factor 1; gastrointestinal trefoil protein pS2; breast cancer estrogen-inducible sequence; Breast cancer estrogen-inducible protein; breast cancer, estrogen-inducible sequence expressed in gastrointestinal trefoil protein pS2; pS2 protein; trefoil factor, BCE1, human pS2 induced by estrogen from human breast cancer cell line M	Human	P. pastoris
	TFF1 protein functions as a mucous gel stabilizer, vital for fortifying the gastrointestinal mucosa against noxious agents. It contributes to the mucous layer's integrity, providing a crucial physical barrier for the gastrointestinal tract, safeguarding it from potential harm. TFF1's stabilizing role emphasizes its significance in preserving the mucosal barrier, essential for overall gastrointestinal health and protection. TFF1 Protein, Human (P. pastoris, N-His) is the recombinant human-derived TFF1 protein, expressed by P. pastoris , with N-6*His labeled tag. The total length of TFF1 Protein, Human (P. pastoris, N-His) is 60 a.a., with molecular weight of 8.7 kDa.

HY-P70161

	LYVE-1 Protein, Human (HEK293, His) rHuLymphatic vessel endothelial hyaluronic acid receptor 1/LYVE-1, His; Lymphatic Vessel Endothelial Hyaluronic Acid Receptor 1; LYVE-1; Cell Surface Retention sequence-Binding protein 1; CRSBP-1; Extracellular Link Domain-Containing protein 1; Hyaluronic Acid Receptor; LYVE1; CRSBP1; HAR; XLKD1	Human	HEK293
	The LYVE-1 protein is a ligand-specific transporter that regulates molecular transport between the trans-Golgi network (TGN) and the plasma membrane. It plays a key role in autocrine cell growth regulation, mediating the uptake and catabolism of growth regulators through cell surface retention sequences. LYVE-1 Protein, Human (HEK293, His) is the recombinant human-derived LYVE-1 protein, expressed by HEK293 , with C-6*His labeled tag. The total length of LYVE-1 Protein, Human (HEK293, His) is 219 a.a., with molecular weight of 40-60 kDa.

HY-P71928

	TFF1 Protein, Human BCEI; Breast cancer estrogen inducible protein; Breast cancer estrogen inducible sequence; Breast cancer estrogen-inducible protein; D21S21; Gastrointestinal trefoil protein; Gastrointestinal trefoil protein pS2; hP1.A; HP1A; HPS 2; HPS2; pNR 2; PNR-2; pNR2; Polypeptide P1.A; protein pS2; PS 2; pS2; pS2 protein; TFF 1; TFF1; TFF1_HUMAN; Trefoil factor 1	Human	E. coli
	TFF1 protein functions as a mucous gel stabilizer, vital for fortifying the gastrointestinal mucosa against noxious agents. It contributes to the mucous layer's integrity, providing a crucial physical barrier for the gastrointestinal tract, safeguarding it from potential harm. TFF1's stabilizing role emphasizes its significance in preserving the mucosal barrier, essential for overall gastrointestinal health and protection. TFF1 Protein, Human is the recombinant human-derived TFF1 protein, expressed by E. coli , with tag free. The total length of TFF1 Protein, Human is 60 a.a..

HY-P72171

	DEFA1 Protein, Human (GST) alpha 1; DEF1; DEF1_HUMAN; DEFA1; DEFA1B; DEFA2; Defensin 1; Defensin; Defensin; alpha 1; Defensin; alpha 1; myeloid related sequence; Defensin; alpha 2; HNP-1; HNP-2; HNP1; HP-1; HP-2; HP1; HP2; MRS; Myeloid related sequence; Neutrophil defensin 1; Neutrophil defensin 2	Human	E. coli
	The DEFA1 protein is a multifunctional effector in innate immunity that exhibits antibiotic-like properties against bacteria, fungi, and viruses. It promotes immune defense by activating antigen-presenting cells (APCs) and inhibiting bacterial cell wall synthesis by interacting with lipid II. DEFA1 Protein, Human (GST) is the recombinant human-derived DEFA1 protein, expressed by E. coli , with N-GST labeled tag.

HY-P702542

	RET Protein, Mouse (HEK293, His) CDHF12MTC1; CDHR16; EC 2.7.10; Hirschsprung disease 1; Hirschsprung disease); MEN2A; MEN2B; multiple endocrine neoplasia and medullary thyroid carcinoma 1; ret proto-oncogene; RET transforming sequence; Ret	Mouse	HEK293
	RET protein is an important receptor tyrosine protein kinase that drives a variety of cellular processes such as proliferation, migration, and differentiation when bound to GDNF ligand. It coordinates organogenesis, shapes the enteric nervous system and promotes kidney development. RET Protein, Mouse (HEK293, His) is the recombinant mouse-derived RET protein, expressed by HEK293 , with C-6*His labeled tag and F174S mutation. The total length of RET Protein, Mouse (HEK293, His) is 609 a.a.

Compare Products


Products	In-stock - + Add to Cart
Cat. No.
Species
Source
Tag
Accession
Gene ID
Molecular Weight
Purity
Endotoxin Level
Biological Activity
Appearance
Formulation
Storage & Stability
Shipping
Free Sample	Yes No
Size	* This product has been "discontinued". Optimized version of product available: / In-stock - + Add to Cart Get quote

Cat. No.	Compare	Product Name	Application	Reactivity

HY-P83515

	TATA Box Binding Protein Antibody (YA3260) TBP; GTF2D1; TF2D; TFIID; TATA-box-binding protein; TATA sequence-binding protein; TATA-binding factor; TATA-box factor; Transcription initiation factor TFIID TBP subunit	WB, IHC-F, IHC-P, ICC/IF, IP	Human, Mouse
	TATA Box Binding Protein Antibody (YA3260) is a rabbit-derived non-conjugated IgG antibody (Clone NO.: YA3260), targeting TATA Box Binding Protein, with a predicted molecular weight of 38 kDa (observed band size: 38 kDa). TATA Box Binding Protein Antibody (YA3260) can be used for WB, IHC-F, IHC-P, ICC/IF, IP experiment in human, mouse background.

HY-P81198

	AXL Antibody Adhesion related kinase; AI323647; Ark; Axl; AXL oncogene; AXL receptor tyrosine kinase; AXL transforming gene; AXL transforming sequence/gene; EC 2.7.10.1; JTK11; Oncogene AXL; Tyro7; Tyrosine protein kinase receptor UFO; Tyrosine-protein kinase receptor UFO; UFO; UFO_HUMAN.	WB, ELISA, IHC-P, IHC-F, ICC/IF	Human, Mouse
	AXL Antibody is an unconjugated, approximately 95 kDa, rabbit-derived, anti-AXL polyclonal antibody. AXL Antibody can be used for: WB, ELISA, IHC-P, IHC-F, IF expriments in human, mouse, and predicted: rat, dog, horse, rabbit background without labeling.

HY-P81083

	ADGRE1 (F4/80) Antibody (YA920) F4/80 (mouse); Adhesion G protein-coupled receptor E1; Cell surface glycoprotein EMR1; Cell surface glycoprotein F4/80; DD7A5 7; Egf like module containing mucin like hormone receptor like 1; Egf like module containing mucin like hormone receptor like sequence 1; EGF like module receptor 1; EGF TM7; EGF-like module receptor 1; EGF-like module-containing mucin-like hormone receptor-like 1; EGFTM7; EMR 1; EMR1; EMR-1; EMR1 hormone receptor; EMR1_HUMAN; AGRE1_HUMAN; Gpf480; Ly71; Lymphocyte antigen 71; TM7LN3.	WB, IHC-P, IHC-F, ICC/IF	Mouse, Rat
	ADGRE1 (F4/80) Antibody (YA920) is an unconjugated, approximately 102 kDa, rabbit-derived, anti-ADGRE1 (F4/80) (YA920) monoclonal antibody. ADGRE1 (F4/80) Antibody (YA920) can be used for: WB, IHC-P, IF-Tissue, IHC-Fr expriments in mouse, rat background without labeling.

HY-P81409

	SATB1 Antibody (YA1154) DNA-binding protein SATB1 (Special AT-rich sequence-binding protein 1)	IHC-P	Human
	SATB1 Antibody (YA1154) is a rabbit-derived non-conjugated IgG antibody (Clone NO.: YA1154), targeting SATB1. SATB1 Antibody (YA1154) can be used for IHC-P experiment in human background.