Search Result

Results for "

viral RNA

" in MedChemExpress (MCE) Product Catalog:

By Targets:	DNA/RNA Synthesis (26) Antibiotic (1) Apoptosis (1) Bacterial (5) Biochemical Assay Reagents (2) Dengue Virus (5) DNA Methyltransferase (2) Drug Intermediate (1) Drug Isomer (1) Drug Metabolite (2) Endogenous Metabolite (11) Enterovirus (7) Filovirus (3) Flavivirus (6) HBV (8) HCV (17) HCV Protease (3) Histamine Receptor (2) Histone Acetyltransferase (1) HIV (6) HIV Integrase (1) HSV (1) Influenza Virus (23) Isotope-Labeled Compounds (8) METTL3 (1) Nucleoside Antimetabolite/Analog (1) Opioid Receptor (1) Orthopoxvirus (1) Reverse Transcriptase (2) RSV (4) SARS-CoV (25) Sirtuin (1) STING (1) Tomato Spotted Wilt Virus (TSWV) (1) Topoisomerase (4) TRP Channel (2) Virus Protease (4)
By Research Areas:	Cancer (9) Endocrinology (2) Infection (86) Inflammation/Immunology (7) Metabolic Disease (1) Neurological Disease (3)
Oligonucleotides:	Nucleosides and their Analogs (1) Antisense Oligonucleotides (2)

Inhibitors & Agonists

Screening Libraries

Biochemical Assay Reagents

Peptides

Natural
Products

Recombinant Proteins

Isotope-Labeled Compounds

Oligonucleotides

Targets Recommended: DNA/RNA Synthesis Small Interfering RNA (siRNA)

Cat. No.	Product Name	Target	Research Areas	Chemical Structure

HY-156215

NCI-B16	HCV	Infection
NCI-B16 is a small molecule RNA binder and inhibits HCV viral replication .

HY-W250152

Polycytidylic acid potassium	Biochemical Assay Reagents	Inflammation/Immunology
Polycytidylic acid potassium is an immunostimulant and synthetic double-stranded RNA. Polycytidylic acid potassium can be used experimentally to model viral infections in vivo. Polycytidylic acid potassium is a common tool in immune system research .

HY-126113

KIN101	Flavivirus Dengue Virus Influenza Virus HCV	Infection
KIN101 is a potent **RNA viral inhibitor with IC₅₀s of 2 μM, >5 μM for influenza virus and Dengue virus (DNV), respectively. KIN101, an isoflavone agonist of IRF-3** dependent signaling, induces IRF-3 nuclear translocation. KIN101 has broad-spectrum activity against RNA viruses .

HY-122587

AVG-233	DNA/RNA Synthesis RSV	Infection
AVG-233 is a potent, orally active RNA dependent RNA polymerase (RdRp) inhibitor. AVG-233 prevents initiation of the viral polymerase complex at the promoter. AVG-233 binding site is present in the L_1-1749 fragment. AVG-233 has nanomolar activity against both RSV strains and clinical RSV isolates (EC₅₀=0.14-0.31 μM). AVG-233 can be used for research of respiratory syncytial virus (RSV) .

HY-14768

Favipiravir Maximum Cited Publications 41 Publications Verification T-705	DNA/RNA Synthesis Influenza Virus SARS-CoV Bacterial	Infection
Favipiravir (T-705) is a potent viral RNA polymerase inhibitor, it is phosphoribosylated by cellular enzymes to its active form, Favipiravir-ribofuranosyl-5′-triphosphate (RTP). Favipiravir-RTP inhibits the influenza viral RNA-dependent RNA polymerase (RdRP) activity with an IC₅₀ of 341 nM.

HY-137660

pppApG	DNA/RNA Synthesis	Infection
pppApG is a starting product of both vRNA (viral RNA) and cRNA (complementary RNA) synthesis. pppApG can be used for influenza virus research .

HY-109072

Riamilovir	SARS-CoV	Infection
Riamilovir is an antiviral drug whose activity is primarily directed against RNA viruses. Riamilovir acts directly on the virus's RNA-dependent RNA polymerase, thereby preventing the virus from replicating. This mechanism allows Riamilovir to effectively reduce the amount of virus, accelerate the relief of symptoms, and help reduce the severity of the disease. Riamilovir can be used in the study of acute respiratory viral infections caused by new variants of SARS-CoV-2 .

HY-148780

HBV-IN-29	HBV	Infection
HBV-IN-29 (ex8), a flavone derivative, is a potent covalently closed circular DNA (cccDNA) inhibitor. cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-29 has the potential for the research of HBV infection .

HY-148781

HBV-IN-30	HBV	Infection
HBV-IN-30 (ex44), a flavone derivative, is a potent covalently closed circular DNA (cccDNA) inhibitor. cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-30 has the potential for the research of HBV infection .

HY-161945

IN-RNA-IN-2	HIV HIV Integrase	Infection
IN-RNA-IN-2 (compound 1a) is an inhibitor (IC₅₀=70 nM) of the interaction between HIV-1 integrase and the viral RNA genome. IN-RNA-IN-2 exerts its anti-HIV activity by inhibiting the viral replication process .

HY-W269306

Bonaphthone	DNA/RNA Synthesis Influenza Virus	Infection
Bonaphthone is an antiviral agent with anti-DNA and -RNA viral activities .

HY-W128400

3′-Deoxy-3′-fluoroguanosine	DNA/RNA Synthesis HCV	Infection
3′-Deoxy-3′-fluoroguanosine exhibits antiviral activity against tick-borne encephalitis virus (TBEV), through interaction with NS5B RdRp of HCV, resulting in suppression of viral RNA synthesis by disruption of further extension of the replicating viral RNA .

HY-152294

3′-Deoxy-3′-methyluridine	DNA/RNA Synthesis	Infection
3′-Deoxy-3′-methyluridine is a nucleoside derivative, involving in preparation inhibitors of RNA-dependent RNA viral polymerase .

HY-14768R

Favipiravir (Standard)	DNA/RNA Synthesis Influenza Virus SARS-CoV Bacterial	Infection
Favipiravir (Standard) is the analytical standard of Favipiravir. This product is intended for research and analytical applications. Favipiravir (T-705) is a potent viral RNA polymerase inhibitor, it is phosphoribosylated by cellular enzymes to its active form, Favipiravir-ribofuranosyl-5′-triphosphate (RTP). Favipiravir-RTP inhibits the influenza viral RNA-dependent RNA polymerase (RdRP) activity with an IC₅₀ of 341 nM.

HY-149050

Viral polymerase-IN-1 hydrochloride	Influenza Virus SARS-CoV	Infection
Viral polymerase-IN-1 hydrochloride, a Gemcitabine (HY-17026) derivative, potently inhibits influenza A and B viruses infection with IC₉₀ values of 11.4-15.9 μM. Viral polymerase-IN-1 hydrochloride is active against SARS-CoV-2 infection. Viral polymerase-IN-1 hydrochloride suppresses influenza virus infection by affecting viral RNA replication/transcription in cells .

HY-18649

Galidesivir hydrochloride 5+ Cited Publications BCX4430 hydrochloride; Immucillin-A hydrochloride	DNA/RNA Synthesis SARS-CoV Filovirus	Infection
Galidesivir (BCX4430) hydrochloride, an adenosine analog and a direct-acting antiviral agent, disrupts viral RNA-dependent RNA polymerase (RdRp) activity. Galidesivir hydrochloride is active in vitro against many RNA viral pathogens, including the filoviruses and emerging infectious agents such as MERS-CoV, SARS-CoV, and SARS-CoV-2. Galidesivir hydrochloride inhibits some negative-sense RNA viruses with EC₅₀s ranging from ~3 to ~68 μM .

HY-18649A

Galidesivir 5+ Cited Publications BCX4430; Immucillin-A	DNA/RNA Synthesis SARS-CoV Filovirus	Infection
Galidesivir (BCX4430), an adenosine analog and a direct-acting antiviral agent, disrupts viral RNA-dependent RNA polymerase (RdRp) activity. Galidesivir is active in vitro against many RNA viral pathogens, including the filoviruses and emerging infectious agents such as MERS-CoV, SARS-CoV, and SARS-CoV-2. Galidesivir inhibits some negative-sense RNA viruses with EC₅₀s ranging from ~3 to ~68 μM .

HY-W769714

Favipiravir-13C3 T-705-¹³C₃	Isotope-Labeled Compounds Antibiotic Bacterial	Infection
Favipiravir- ¹³C3 is the ¹³C labeled isotope of Favipiravir- ¹³C3(HY-14768 ).Favipiravir (T-705) is a potent viral RNA polymerase inhibitor, it is phosphoribosylated by cellular enzymes to its active form, Favipiravir-ribofuranosyl-5′-triphosphate (RTP). Favipiravir-RTP inhibits the influenza viral RNA-dependent RNA polymerase (RdRP) activity with an IC₅₀ of 341 nM.

HY-19111

R-82150 TIBO-R 82150	HIV Reverse Transcriptase	Infection
R-82150 (TIBO-R 82150) is an HIV-1 reverse transcriptase inhibitor that blocks the reverse transcription of viral RNA by binding to the non-substrate binding site of reverse transcriptase, thereby inhibiting viral replication. R-82150 does not inhibit the replication of HIV-2, other RNA viruses, and DNA viruses .

HY-14768S

Favipiravir-13C15N T-705-¹³C¹⁵N	Isotope-Labeled Compounds Bacterial DNA/RNA Synthesis SARS-CoV Influenza Virus	Infection
Favipiravir- ¹³C ¹⁵N (T-705- ¹³C ¹⁵N) is ¹³C and ¹⁵N labeled Favipiravir. Favipiravir (T-705) is a potent viral RNA polymerase inhibitor, it is phosphoribosylated by cellular enzymes to its active form, Favipiravir-ribofuranosyl-5′-triphosphate (RTP). Favipiravir-RTP inhibits the influenza viral RNA-dependent RNA polymerase (RdRP) activity with an IC₅₀ of 341 nM.

HY-158322

nsp12-IN-1	SARS-CoV	Infection
Nsp12-IN-1 is a nucleoside analogue. Nsp12-IN-1 can block the synthesis of viral RNA and inhibit viral replication. Nsp12-IN-1 can be used in the study of pan-coronavirus .

HY-106312A

Enviroxime LY122772	Enterovirus	Infection
Enviroxime (LY122772) is an antiviral compound that inhibits the replication of rhinoviruses and enteroviruses. Enviroxime blocks the replication of plus-strand viral RNA by targeting the viral 3A coding region. Enviroxime can be a useful tool for investigating the natural function of the 3A protein .

HY-169746

Antiviral agent 63	HCV	Infection
Antiviral agent 63 is a nucleoside analog with anti-HCV activity. Antiviral agent 63 can inhibit viral replication by inhibiting the activity of HCV RNA-dependent RNA polymerase or other virus-related enzymes .

HY-14768A

Favipiravir sodium T-705 sodium	DNA/RNA Synthesis Influenza Virus SARS-CoV Bacterial	Infection
Favipiravir (T-705) sodium is an inhibitor of viral RNA polymerase (RNA polymerase), which is converted into its active form Favipiravir-ribofuranosyl-5′-triphosphate (RTP). Favipiravir-RTP inhibits the activity of influenza virus RNA-dependent RNA polymerase (RdRP) with an IC₅₀ of 341 nM .

HY-158028

PAN endonuclease-IN-2	Influenza Virus	Infection
PAN endonuclease-IN-2 (compound T-31) is a PA_N endonuclease inhibitor (IC₅₀: 0.15 μM) and antiviral agent with broad-spectrum anti- Influenza activity. PAN is the N-terminal PA subunit of the polymerase-RNA complex and the dependent endonuclease (CEN) active site. PAN initiates RNA replication by promoting cleavage of the RNA strand and allowing the polymerase to begin synthesizing new RNA molecules. PAN endonuclease-IN-2 targets both the influenza HA and RdRp complexes, thereby interfering with viral entry into host cells and viral replication .

HY-139850

GPS491	HIV	Infection
GPS491 (EC₅₀ = 0.47 μM) suppresses expression of the HIV-1 structural protein Gag and alters HIV-1 RNA accumulation, decreasing the abundance of RNAs encoding the structural proteins while increasing levels of viral RNAs encoding the regulatory proteins.

HY-N0086

N6-Methyladenosine 5+ Cited Publications 6-Methyladenosine; N-Methyladenosine	Influenza Virus Endogenous Metabolite	Infection
N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies **viral RNAs** and has antiviral activities.

HY-155583A

RNase L-IN-1 trihydrochloride	DNA/RNA Synthesis	Infection
RNase L-IN-1 (compound 17a) trihydrochloride is an inhibitor of RNase L or ribonuclease L. RNase L degrades RNA to prevent viral replication and mediates innate immune responses and inflammation .

HY-155583

RNase L-IN-1	DNA/RNA Synthesis	Infection
RNase L-IN-1 (compound 17a) is an inhibitor of RNase L, or Ribonuclease L. RNase L degrades RNAs to prevent viral replication, and mediates the innate immune responses and inflammation .

HY-148167

2'-Deoxy-2'-fluoro-l-uridine	DNA/RNA Synthesis Virus Protease	Infection
2'-Deoxy-2'-fluoro-l-uridine is an L-nucleoside compound. 2'-Deoxy-2'-fluoro-l-uridine is a potent, selective viral RNA polymerase inhibitor, thereby inhibiting RNA virus replication .

HY-147217

Bepirovirsen ISIS 505358	HBV	Infection
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-144047

HBV-IN-16	HBV DNA/RNA Synthesis	Infection
HBV-IN-16 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-16 is a quinoline derivative. HBV-IN-16 has the potential for the research of HBV infection (extracted from patent WO2019121357A1, compound 1) .

HY-170523

RU-0415529	SARS-CoV DNA Methyltransferase	Infection
RU-0415529 is an orally active inhibitor for SARS-CoV-2 nonstructural protein 14 (NSP14) with an IC₅₀ of 356 nM. RU-0415529 binds to the SAH-stabilized cap binding pocket, inhibits viral RNA methylation and the viral replication. RU-0415529 exhibits anti-infectious activity in mouse models .

HY-144046

HBV-IN-15	HBV DNA/RNA Synthesis	Infection
HBV-IN-15 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-15 is a flavone derivative. HBV-IN-16 has the potential for the research of HBV infection (extracted from patent WO2020052774A1, compound 2) .

HY-144045

HBV-IN-14	HBV DNA/RNA Synthesis	Infection
HBV-IN-14 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-14 is a pyridinopyrimidinones compound. HBV-IN-14 has the potential for the research of HBV infection (extracted from patent WO2021190502A1, compound 5) .

HY-162793

RdRP-IN-8	Influenza Virus	Infection
RdRP-IN-8 (compound 45) is an anti-influenza virus compound. RdRP-IN-8 inhibits viral RNA-dependent RNA polymerase (RdRP) activity by disrupting heterodimerization of PA and PB1 subunits (EC₅₀=0.13 μM) .

HY-147217A

Bepirovirsen sodium ISIS 505358 sodium	HBV	Infection
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-19743

Triazavirin	Nucleoside Antimetabolite/Analog Influenza Virus DNA/RNA Synthesis	Infection
Triazavirin is a nucleoside analogue of nucleic acid and an antiviral agent. Triazavirin works by inhibiting the synthesis of viral RNA and DNA and replication of genomic fragments. Triazavirin is also an effective protective agent on the transmission stage of influenza .

HY-113761

ASN03576800	Filovirus	Infection
ASN03576800 could be a potent inhibitor for Ebola virus matrix protein VP40 in process of viral assembly and budding process. ASN03576800 occupies the RNA binding region of VP40 .

HY-107745

SDM25N hydrochloride	Opioid Receptor Flavivirus	Infection Neurological Disease
SDM25N hydrochloride, a δ-opioid receptor antagonist, is a potent DENV inhibitor. SDM25N hydrochloride targets the viral NS4B protein and restricts genomic RNA replication .

HY-170395

GHP-88309	RSV DNA/RNA Synthesis	Infection
GHP-88309 is a broad-spectrum, orally active antiviral agent targeting paramyxoviruses, that targets the viral polymerase, interupts the viral RNA synthesis, and inhibits respiratory syncytial virus (RSV), measles virus (MeV), and canine distemper virus (CDV) with EC₅₀ of 0.06-1.2 μM. GHP-88309 exhibits anti-infectious efficacy in mouse models .

HY-153810

Mosnodenvir JNJ-1802	Virus Protease Flavivirus Dengue Virus	Infection
Mosnodenvir (JNJ-1802) is an orally active pan serotype dengue virus (DENV) inhibitor, with EC₅₀ values ranging from 0.057 to 11 nM for four dengue virus (DENV) serotypes. Mosnodenvir blocks viral replication by inhibiting the formation of complexes between two viral proteins, nonstructural protein 3 (NS3) and NS4B, thereby preventing the formation of new viral RNA. Mosnodenvir exhibits picomolar to nanomolar antiviral activity in vitro and has antiviral efficacy in mice and non-human primates .

HY-126303

GS-443902 GS-441524 triphosphate; Remdesivir metabolite	DNA/RNA Synthesis SARS-CoV RSV HCV Drug Metabolite	Infection
GS-443902 (GS-441524 triphosphate) is a potent viral RNA-dependent RNA-polymerases (RdRp) inhibitor with IC₅₀s of 1.1 µM, 5 µM for RSV RdRp and HCV RdRp, respectively. GS-443902 is the active triphosphate metabolite of Remdesivir .

HY-102077

SAMT-247	HIV	Infection
SAMT-247 is a microbicide that selectively inactivate the viral nucleocapsid protein NCp7, causing zinc ejection and preventing RNA encapsidation. SAMT-247 shows good antiviral activity .

HY-N8533

Sodium Camptothecin	DNA/RNA Synthesis	Infection Cancer
Sodium Camptothecin is a plant alkaloid, with antitumor activity. Sodium Camptothecin is a reversible inhibitor of RNA synthesis. Sodium Camptothecin is an effective inhibitor of adenovirus replication. Sodium Camptothecin inhibits DNA synthesis and causes breaks in intracellular preformed viral DNA .

HY-149362

MTase-IN-1	SARS-CoV	Infection
MTase-IN-1 (compound 26) is a potent and selective inhibitor of coronavirus nsp14 N7-methyltransferases, with an IC₅₀ of 0.72 nM. MTase-IN-1 impairs viral RNA translation and immune evasion .

HY-W555382

Pseudane IX 2-Nonylquinolin-4(1H)-one	HCV	Infection
Pseudane IX, a compound isolated from the leaves of Ruta angustifolia, has strong anti-HCV activity with an IC₅₀ value of 1.4 μg/mL. Pseudane IX reduces HCV RNA replication and viral protein synthesis levels .

HY-10118

Filibuvir 2 Publications Verification	HCV DNA/RNA Synthesis	Infection
Filibuvir is an orally active, selective non-nucleoside inhibitor of the *HCV nonstructural 5B protein (NS5B) RNA-dependent RNA* polymerase (RdRp)*. Filibuvir binds noncovalently in the thumb II allosteric pocket of NS5B. Filibuvir inhibits genotype 1a and 1b replicons with EC₅₀s of 59 nM for both isoforms, respectively . Filibuvir preferentially inhibits elongative RNA* synthesis and potently decreases viral RNA accumulation .

HY-126303C

GS-443902 trisodium 5+ Cited Publications GS-441524 triphosphate trisodium; Remdesivir metabolite trisodium	DNA/RNA Synthesis SARS-CoV RSV HCV Drug Metabolite	Infection
GS-443902 trisodium (GS-441524 triphosphate trisodium) is a potent viral RNA-dependent RNA-polymerases (RdRp) inhibitor with IC₅₀s of 1.1 µM, 5 µM for RSV RdRp and HCV RdRp, respectively. GS-443902 trisodium is the active triphosphate metabolite of Remdesivir (GS-5734) .

HY-30234A

Clemizole hydrochloride 1 Publications Verification	Histamine Receptor TRP Channel HCV Protease HCV	Inflammation/Immunology Endocrinology Cancer
Clemizole hydrochloride is an H1 histamine receptor antagonist, is found to substantially inhibit HCV replication. Clemizole hydrochloride is an inhibitor of TRPC5 channel. The IC₅₀ of Clemizole hydrochloride for RNA binding by NS4B is 24 nM, whereas its EC₅₀ for viral replication is 8 µM.

Cat. No.	Product Name

HY-L044

Nucleotide Compound Library

525 compounds

Nucleoside and nucleotide analogues are synthetic, chemically modified compounds that have been developed to mimic their physiological counterparts in order to exploit cellular metabolism and subsequently be incorporated into DNA and RNA to inhibit cellular division and viral replication. In addition to their incorporation into nucleic acids, nucleoside and nucleotide analogues can interact with and inhibit essential enzymes such as human and viral polymerases (that is, DNA-dependent DNA polymerases, RNA-dependent DNA polymerases or RNA-dependent RNA polymerases), kinases, ribonucleotide reductase, DNA methyltransferases, purine and pyrimidine nucleoside phosphorylase and thymidylate synthase. These actions of nucleoside and nucleotide analogues have potential therapeutic benefits — for example, in the inhibition of cancer cell growth, the inhibition of viral replication as well as other indications.

MCE offers a unique collection of 525 nucleotide compounds including nucleotide, nucleoside and their structural analogues. MCE Nucleotide Compound Library is a useful tool to discover anti-cancer and antiviral drugs for high throughput screening (HTS) and high content screening (HCS).

HY-L073

Anti-Hepatitis C Virus Compound Library

342 compounds

Hepatitis C virus (HCV) is a hepatotropic enveloped positive- strand RNA virus (family Flaviviridae) that infects the parenchymal cells of the liver. HCV infection is a significant public health burden. Globally, an estimated 71 million people have chronic hepatitis C virus infection. A significant number of those who are chronically infected will develop cirrhosis or liver cancer. To date, there is no vaccine against HCV, and combination pegylated alpha interferon (pIFN-) and ribavirin, the main standard-of-care treatment for HCV, is effective in only a subset of patients and is associated with a wide spectrum of toxic side effects and complications. More recently, new therapeutic approaches that target essential components of the HCV life cycle have been developed, including direct-acting antiviral (DAA) that specifically block a viral enzyme or functional protein and host-targeted agents (HTA) that block interactions between host proteins and viral components that are essential to the viral life cycle. However, the genetic diversity of HCV viruses and the stage of liver disease (i.e., cirrhosis) are revealing themselves as obstacles for effective, pan-genotypic treatments. There still exists a need for the discovery and development of new HCV inhibitors. In particular, since the future of HCV therapy will likely consist of a cocktail approach using multiple inhibitors that target different steps of infection, new antivirals targeting all steps of the viral infection cycle.

MCE offers a unique collection of 342 compounds with identified and potential anti-HCV activity. MCE Anti- Hepatitis C Virus Compound Library is a useful tool for discovery new anti-HCV drugs and other anti-infection research.

Cat. No.	Product Name	Type

HY-W250152

Polycytidylic acid potassium	Biochemical Assay Reagents
Polycytidylic acid potassium is an immunostimulant and synthetic double-stranded RNA. Polycytidylic acid potassium can be used experimentally to model viral infections in vivo. Polycytidylic acid potassium is a common tool in immune system research .

HY-159067

DEAE-dextran, MW 500000 hydrochloride

DEAE-dextran, MW 500000 (hydrochloride), from bacterial (Leuconostoc mesenteroides); Diethylaminoethyl-dextran, MW 500000 hydrochloride

Carbohydrates

DEAE-dextran, MW 500000 hydrochloride (DEAE-dextran, MW 500000 hydrochloride, from bacterial (Leuconostoc mesenteroides)) is a high-molecular-weight positively charged polymer that significantly enhances the uptake of viral RNA by tissue culture cells. When employed in the delivery system for "tumor immunity" RNA-splenocyte transfer, DEAE-dextran can markedly extend the lifespan of tumor-bearing animals, comparable to that of actively immunized animals. Furthermore, DEAE-dextran serves as a complexing agent for nucleic acids, forming composite particles with DNA/RNA for extensive applications in gene delivery. Additionally, DEAE-dextran can be utilized as a coating for liposomes .

Cat. No.	Product Name	Target	Research Area

HY-P10836

DN59	Dengue Virus	Infection
DN59 is a 33 amino acid peptide that mimics the dengue virus type 2 E stem region. DN59 inhibits all four serotypes of dengue virus (IC₅₀: 2-5 μM) as well as other flaviviruses. N59 causes the release of genomic RNA by interacting directly with viral particles. DN59 has antiviral activity .

Cat. No.	Product Name	Category	Target	Chemical Structure

HY-N0086

N6-Methyladenosine 5+ Cited Publications 6-Methyladenosine; N-Methyladenosine	Infection Structural Classification Natural Products Microorganisms Classification of Application Fields Source classification Endogenous metabolite Disease Research Fields	Influenza Virus Endogenous Metabolite
N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies **viral RNAs** and has antiviral activities.

HY-N8533

Sodium Camptothecin	Infection Alkaloids Pyrrole Alkaloids Classification of Application Fields Source classification Quinoline Alkaloids Camptotheca acuminata Decne. Plants Nyssaceae Disease Research Fields	DNA/RNA Synthesis
Sodium Camptothecin is a plant alkaloid, with antitumor activity. Sodium Camptothecin is a reversible inhibitor of RNA synthesis. Sodium Camptothecin is an effective inhibitor of adenovirus replication. Sodium Camptothecin inhibits DNA synthesis and causes breaks in intracellular preformed viral DNA .

HY-135867F

NHC-diphosphate triammonium 1 Publications Verification	Infection Structural Classification Natural Products Classification of Application Fields Source classification Endogenous metabolite Disease Research Fields	Endogenous Metabolite Enterovirus HCV Topoisomerase SARS-CoV
NHC-diphosphate triammonium is an active phosphorylated intracellular metabolite of β-d-N4-Hydroxycytidine (NHC) (HY-125033) as a diphosphate form . NHC-diphosphate triammonium is a weak alternative substrate for the viral polymerase and can be incorporated into HCV replicon RNA .

HY-W019670

N4-Acetylcytidine 1 Publications Verification	Structural Classification Natural Products Classification of Application Fields Source classification Metabolic Disease Endogenous metabolite Disease Research Fields	Endogenous Metabolite Histone Acetyltransferase Enterovirus
N4-Acetylcytidine is a chemical modification substance present on various RNAs. N4-Acetylcytidine is formed by N-acetyltransferase 10 and other enzymes. N4-Acetylcytidine increases HMGB1. N4-Acetylcytidine modifies mRNA, tRNA and rRNA, affecting their stability, translation efficiency (such as enterovirus 71 RNA). N4-Acetylcytidine is used in the study of cancer, neuroinflammatory diseases, viral infections and obesity .

HY-W555382

Pseudane IX 2-Nonylquinolin-4(1H)-one	Structural Classification Alkaloids Ketones, Aldehydes, Acids Source classification Ruta graveolens Linn. Rutaceae Quinoline Alkaloids Plants	HCV
Pseudane IX, a compound isolated from the leaves of Ruta angustifolia, has strong anti-HCV activity with an IC₅₀ value of 1.4 μg/mL. Pseudane IX reduces HCV RNA replication and viral protein synthesis levels .

HY-135867

NHC-triphosphate	Infection Structural Classification Natural Products Classification of Application Fields Source classification Endogenous metabolite Disease Research Fields	Endogenous Metabolite Enterovirus HCV Topoisomerase SARS-CoV
NHC-triphosphate is an active phosphorylated intracellular metabolite of β-d-N4-Hydroxycytidine (NHC) (HY-125033) as a triphosphate form . NHC-triphosphate is a weak alternative substrate for the viral polymerase and can be incorporated into HCV replicon RNA .

HY-135867A

NHC-triphosphate tetrasodium	Structural Classification Natural Products Classification of Application Fields Source classification Other Diseases Endogenous metabolite Disease Research Fields	Endogenous Metabolite Enterovirus HCV Topoisomerase
NHC-triphosphate tetrasodium is an active phosphorylated intracellular metabolite of β-d-N4-Hydroxycytidine (NHC) (HY-125033) as a triphosphate form . NHC-triphosphate tetrasodium is a weak alternative substrate for the viral polymerase and can be incorporated into HCV replicon RNA .

HY-N0086R

N6-Methyladenosine (Standard)	Structural Classification Natural Products Microorganisms Source classification Endogenous metabolite	Influenza Virus Endogenous Metabolite
N6-Methyladenosine (Standard) is the analytical standard of N6-Methyladenosine. This product is intended for research and analytical applications. N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies **viral RNAs and has antiviral activities. In Vitro:** N6-methyladenosine (m6A) is selectively recognized by the human YTH domain family 2 (YTHDF2) protein to regulate mRNA degradation. N6-methyladenosine (m6A), a prevalent internal modification in the messenger RNA of all eukaryotes, is post-transcriptionally installed by m6A methyltransferase (e.g., MT-A70) within the consensus sequence of G(m6A)C (70%) or A(m6A)C (30%). N6-methyladenosine (m6A)-containing RNAs are greatly enriched in the YTHDF-bound portion and diminished in the flow-through portion . N6-methyladenosine (m6A), the most abundant internal RNA modification, functions in diverse biological processes, including regulation of embryonic stem cell self-renewal and differentiation. N6-methyladenosine (m6A) is a large protein complex, consisting in part of methyltransferase-like 3 (METTL3) and methyltransferase-like 14 (METTL14) catalytic subunits .

Species:	Virus (4)
Tag:	His (2) Tag Free (3) Flag (1)
Source:	Sf9 insect cells (1) E. coli (4)

Cat. No.	Compare	Product Name	Species	Source

HY-P703547

	HCVNS5B Protein, HCV Genome polyprotein; Hepatitis C virus genotype 1b (strain HC-J4); HCV; p23; Helicase; Hydrolase; Ion channel; Multifunctional enzyme; Nucleotidyltransferase; Protease; Ribonucleoprotein; RNA-binding; RNA-directed RNA polymerase; Serine protease; Thiol protease; Transferase; viral ion channel; viral nucleoprotein	Others	E. coli
	POLG proteins play multiple roles in the viral life cycle, contributing to viral RNA packaging, budding, and particle production. It exhibits RNA-binding and RNA chaperone activities, affecting translation initiation through interactions with viral IRES and ribosomal subunits. HCVNS5B Protein, HCV is the recombinant HCVNS5B, expressed by E. coli , with tag Free labeled tag. ,

HY-P703528

	SARS-CoV-2 NCP N Protein (His) Nucleoprotein; Nucleocapsid protein; NC; Protein N; N; Severe acute respiratory syndrome coronavirus 2; 2019-nCoV; N; Ribonucleoprotein; RNA-binding; viral nucleoprotein	Virus	E. coli

HY-P703529

	SARS-CoV-2 NCP N Protein (101a.a) Nucleoprotein; Nucleocapsid protein; NC; Protein N; N; Severe acute respiratory syndrome coronavirus 2; 2019-nCoV; N; Ribonucleoprotein; RNA-binding; viral nucleoprotein	Virus	E. coli

HY-P703530

	SARS-CoV-2 NCP N Protein (126a.a) Nucleoprotein; Nucleocapsid protein; NC; Protein N; N; Severe acute respiratory syndrome coronavirus 2; 2019-nCoV; N; Ribonucleoprotein; RNA-binding; viral nucleoprotein	Virus	E. coli

HY-P703531

	SARS-CoV-2 NCP N Protein (Sf9, His, Flag) Nucleoprotein; Nucleocapsid protein; NC; Protein N; N; Severe acute respiratory syndrome coronavirus 2; 2019-nCoV; N; Ribonucleoprotein; RNA-binding; viral nucleoprotein	Virus	Sf9 insect cells
	The SARS-CoV-2 nucleocapsid protein plays a crucial role in assembling the virion, forming the helical ribonucleocapsid (RNP), and interacting with the viral genome and membrane protein M. In addition to its structural function, it also enhances subgenomic viral RNA transcription and overall replication. NCP N Protein, SARS-CoV-2 (Sf9, His, Flag) is the recombinant virus-derived NCP N, expressed by Sf9 insect cells , with His, Flag labeled tag. ,

Compare Products


Products	In-stock - + Add to Cart
Cat. No.
Species
Source
Tag
Accession
Gene ID
Molecular Weight
Purity
Endotoxin Level
Biological Activity
Appearance
Formulation
Storage & Stability
Shipping
Free Sample	Yes No
Size	* This product has been "discontinued". Optimized version of product available: / In-stock - + Add to Cart Get quote

Cat. No.	Product Name	Chemical Structure

HY-N0086S

N6-Methyladenosine-d3
N6-Methyladenosine-d₃ (6-Methyladenosine-d₃; N-Methyladenosine-d₃) is a deuterium labeled N6-Methyladenosine (HY-N0086). N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies **viral RNAs** and has antiviral activities.

HY-B0402S

Amantadine-d15
Amantadine-d₁₅ is the deuterium labeled Amantadine. Amantadine (1-Adamantanamine) is an antiviral agent with activity against influenza A viruses. Amantadine blocks the proton flow through the M2 ion channel (M2 proton channel of influenza A) and thus prevents the release of viral RNA into the cytoplasm of the infected cells. Amantadine is an antiparkinsonian agent[1][2].

HY-W751835

Baloxavir-d4

Baloxavir-d₄ (Baloxavir acid-d₄; S-033447-d₄) is the deuterium-labeled Baloxavir (HY-109025A). Baloxavir-d₄ (Baloxavir-d₄ acid), derived from the proagent Baloxavir-d₄ marboxil, is a first-in-class, potent and selective cap-dependent endonuclease (CEN) inhibitor within the polymerase PA subunit of influenza A and B viruses. Baloxavir-d₄ inhibits viral RNA transcription and replication and has potently antiviral activity .

HY-W769714

Favipiravir-13C3
Favipiravir- ¹³C3 is the ¹³C labeled isotope of Favipiravir- ¹³C3(HY-14768 ).Favipiravir (T-705) is a potent viral RNA polymerase inhibitor, it is phosphoribosylated by cellular enzymes to its active form, Favipiravir-ribofuranosyl-5′-triphosphate (RTP). Favipiravir-RTP inhibits the influenza viral RNA-dependent RNA polymerase (RdRP) activity with an IC₅₀ of 341 nM.

HY-14768S

Favipiravir-13C15N

Favipiravir- ¹³C ¹⁵N (T-705- ¹³C ¹⁵N) is ¹³C and ¹⁵N labeled Favipiravir. Favipiravir (T-705) is a potent viral RNA polymerase inhibitor, it is phosphoribosylated by cellular enzymes to its active form, Favipiravir-ribofuranosyl-5′-triphosphate (RTP). Favipiravir-RTP inhibits the influenza viral RNA-dependent RNA polymerase (RdRP) activity with an IC₅₀ of 341 nM.

HY-109025AS

Baloxavir-d5
Baloxavir-d₅ is deuterium labeled Baloxavir. Baloxavir (Baloxavir acid), derived from the proagent Baloxavir marboxil, is a first-in-class, potent and selective cap-dependent endonuclease (CEN) inhibitor within the polymerase PA subunit of influenza A and B viruses. Baloxavir inhibits viral RNA transcription and replication and has potently antiviral activity[1][2].

HY-N0086S2

N6-Methyladenosine-13C4
N6-Methyladenosine- ¹³C₄ (6-Methyladenosine- ¹³C₄; N-Methyladenosine- ¹³C₄) is ¹³C-labeled N6-Methyladenosine (HY-N0086). N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies **viral RNAs** and has antiviral activities.

HY-N0086S3

N6-Methyladenosine-13C3
N6-Methyladenosine- ¹³C₃ (6-Methyladenosine- ¹³C₃) is ¹³C-labeled N6-Methyladenosine (HY-N0086). N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities .

HY-W555382S

Pseudane IX-d4
Pseudane IX-d₄ (2-Nonylquinolin-4(1H)-one-d₄) is deuterium labeled Pseudane IX. Pseudane IX, a compound isolated from the leaves of Ruta angustifolia, has strong anti-HCV activity with an IC₅₀ value of 1.4 μg/mL. Pseudane IX reduces HCV RNA replication and viral protein synthesis levels .

Cat. No.	Product Name		Classification