Search Result
Results for "
antisense oligonucleotides
" in MedChemExpress (MCE) Product Catalog:
2
Biochemical Assay Reagents
Cat. No. |
Product Name |
Target |
Research Areas |
Chemical Structure |
-
- HY-132582C
-
BIIB080 sodium; ISIS 814907 sodium
|
Tau Protein
|
Neurological Disease
|
IONIS-MAPTRx sodium is the first Tau-lowering antisense oligonucleotide (ASO). IONIS-MAPTRx sodium has the potential for the research of Alzheimer Disease .
|
-
-
- HY-132593A
-
WVE-120101 sodium
|
Huntingtin
|
Neurological Disease
|
Rovanersen sodium is an antisense oligonucleotide that specifically targets mutated mRNA copies of the huntington (HTT) gene without affecting healthy mRNA of HTT gene, thereby preventing the production of faulty Huntingtin protein. Rovanersen sodium can be used for huntington’s disease research .
|
-
-
- HY-136151
-
|
Others
|
Others
|
UNC10217938A is a 3-deazapteridine analog with strong oligonucleotide enhancing effects. UNC10217938A enhances oligonucleotides effects by modulating their intracellular trafficking and release from endosomes. UNC10217938A also enhances the effects of antisense and siRNA oligonucleotides .
|
-
-
- HY-W570887
-
-
-
- HY-P3392
-
ION373
|
FAP
|
Neurological Disease
|
Zilganersen (ION373) is a glial fibrillary acidic protein (GFAP) inhibitor, an antisense oligonucleotide. Zilganersen can be used in Alexander disease (AxD) research .
|
-
-
- HY-132582
-
BIIB080; ISIS 814907
|
Tau Protein
|
Neurological Disease
|
IONIS-MAPTRx (BIIB080) is the first Tau-lowering antisense oligonucleotide (ASO). IONIS-MAPTRx has the potential for the research of Alzheimer Disease .
|
-
-
- HY-132593
-
WVE-120101
|
Huntingtin
|
Neurological Disease
|
Rovanersen (WVE-120101) is an antisense oligonucleotide that specifically targets mutated mRNA copies of the huntington (HTT) gene without affecting healthy mRNA of HTT gene, thereby preventing the production of faulty Huntingtin protein. Rovanersen can be used for huntington’s disease research .
|
-
-
- HY-159695
-
-
-
- HY-159695A
-
-
-
- HY-148647
-
ISIS 301012 free base
|
Apolipoprotein
HCV
|
Infection
|
Mipomersen (ISIS 301012 free base) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has anti-HCV effect and reduces the infectivity of the HCV. Mipomersen can be used for the research of homozygous familial hypercholesterolemia (HoFH) .
|
-
-
- HY-145721A
-
GED-0301 sodium
|
TGF-beta/Smad
|
Inflammation/Immunology
|
Mongersen sodium is a specific and orally active SMAD7 antisense oligonucleotide. Mongersen sodium restores TGF-β1 activity leading to inhibition of inflammatory signals. Mongersen sodium can attenuate Crohn's disease-like experimental colitis in mice .
|
-
-
- HY-132579A
-
RG6042 sodium; IONIS-HTTRx sodium
|
Huntingtin
|
Neurological Disease
|
Tominersen sodium is a second-generation 2′-O-(2-methoxyethyl) antisense oligonucleotide that targets huntingtin protein (HTT) mRNA and potently suppresses HTT production. Tominersen improves survival and reduces brain atrophy in mice. Tominersen sodium can be used for the research of Huntington’s disease (HD) .
|
-
-
- HY-132579
-
RG6042; IONIS-HTTRx
|
Huntingtin
|
Neurological Disease
|
Tominersen (RG6042) is a second-generation 2′-O-(2-methoxyethyl) antisense oligonucleotide that targets huntingtin protein (HTT) mRNA and potently suppresses HTT production. Tominersen improves survival and reduces brain atrophy in mice. Tominersen can be used for the research of Huntington’s disease (HD) .
|
-
-
- HY-145721
-
GED-0301
|
TGF-beta/Smad
|
Inflammation/Immunology
|
Mongersen (GED-0301) is a specific and orally active SMAD7 antisense oligonucleotide. Mongersen restores TGF-β1 activity leading to inhibition of inflammatory signals. Mongersen can attenuate Crohn's disease-like experimental colitis in mice .
|
-
-
- HY-109528
-
ISIS-2922
|
CMV
|
Infection
|
Fomivirsen (ISIS-2922) sodium is an antisense 21 mer phosphorothioate oligonucleotide. Fomivirsen sodium is an antiviral agent that is used cytomegalovirus retinitis (CMV) research, incluiding in AIDs. Fomivirsen sodium binds to and degrades the mRNAs encoding CMV immediate-early 2 protein, thus inhibiting virus proliferation .
|
-
-
- HY-112958
-
ISIS-2922 free base
|
CMV
|
Infection
|
Fomivirsen (ISIS-2922 free base) is an antisense 21 mer phosphorothioate oligonucleotide. Fomivirsen is an antiviral agent that is used CMV research, incluiding in AIDs. Fomivirsen binds to and degrades the mRNAs encoding CMV immediate-early 2 protein, thus inhibiting virus proliferation .
|
-
-
- HY-132608
-
ISIS-420915 sodium
|
Transthyretin (TTR)
|
Neurological Disease
|
Inotersen (ISIS-420915) sodium is a 2′-O-methoxyethyl-modified antisense oligonucleotide. Inotersen sodium inhibits the production of transthyretin (TTR) protein by targeting the TTR RNA transcript and reduces the levels of the TTR transcript. Inotersen sodium can be used for the research of hereditary TTR amyloidosis polyneuropathy .
|
-
-
- HY-132580A
-
BIIB067 sodium; ISIS-SOD1Rx sodium
|
DNA/RNA Synthesis
|
Neurological Disease
|
Tofersen sodium is an antisense oligonucleotide that mediates RNase H-dependent degradation of superoxide dismutase 1 (SOD1) mRNA to reduce the synthesis of SOD1 protein. Tofersen sodium can be used for the research of amyotrophic lateral sclerosis (ALS) .
|
-
-
- HY-159696A
-
|
GCGR
|
Metabolic Disease
|
ISIS 449884 sodium is a 2'-O-methoxyethyl antisense oligonucleotide that targets GCGR. ISIS 449884 sodium has an ability to reduce hepatic glucose output and lower the blood glucose level. ISIS 449884 sodium can be used for the study of type 2 diabetes mellitus (T2DM) .
|
-
-
- HY-159696
-
|
GCGR
|
Metabolic Disease
|
ISIS 449884 is a 2'-O-methoxyethyl antisense oligonucleotide that targets GCGR. ISIS 449884 has an ability to reduce hepatic glucose output and lower the blood glucose level. ISIS 449884 can be used for the study of type 2 diabetes mellitus (T2DM) .
|
-
-
- HY-132580
-
BIIB067; ISIS-SOD1Rx
|
DNA/RNA Synthesis
|
Neurological Disease
|
Tofersen (BIIB067) is an antisense oligonucleotide that mediates RNase H-dependent degradation of superoxide dismutase 1 (SOD1) mRNA to reduce the synthesis of SOD1 protein. Tofersen can be used for the research of amyotrophic lateral sclerosis (ALS) .
|
-
-
- HY-21997
-
|
DNA/RNA Synthesis
|
Others
|
Dmt-2'fluoro-da(bz) amidite, an uniformly modified 2'-deoxy-2'-fluoro phosphorothioate oligonucleotide, is a nuclease-resistant antisense compound with high affinity and specificity for RNA targets. Dmt-2'fluoro-da(bz) amidite is also an intermediate for 5’-DMT-3’-phosphoramidite synthesis .
|
-
-
- HY-132586
-
NS-065/NCNP-01
|
Nucleoside Antimetabolite/Analog
|
Metabolic Disease
|
Viltolarsen (NS-065/NCNP-01) is a phosphorodiamidate morpholino antisense oligonucleotide. Viltolarsen binds to exon 53 of the dystrophin mRNA precursor and restores the amino acid open-reading frame by skipping exon 53, resulting in the production of a shortened dystrophin protein that contains essential functional portions. Viltolarsen has the potential for Duchenne muscular dystrophy (DMD) research .
|
-
-
- HY-132586A
-
NS-065/NCNP-01 sodium
|
Nucleoside Antimetabolite/Analog
|
Metabolic Disease
|
Viltolarsen (NS-065/NCNP-01) sodium is a phosphorodiamidate morpholino antisense oligonucleotide. Viltolarsen sodium binds to exon 53 of the dystrophin mRNA precursor and restores the amino acid open-reading frame by skipping exon 53, resulting in the production of a shortened dystrophin protein that contains essential functional portions. Viltolarsen sodium has the potential for Duchenne muscular dystrophy (DMD) research .
|
-
-
- HY-148089
-
|
Transthyretin (TTR)
|
Neurological Disease
|
Eplontersen is a triantennary N-acetyl galactosamine (GalNAc3-7a)-conjugated antisense oligonucleotide targeting transthyretin (TTR) mRNA to inhibit production of both variant and wild-type TTR protein. Misfolded TTR induces amyloid fibrils formation in the heart and peripheral nerves, leads to amyloid TTR (ATTR) amyloidosis diseases .
|
-
-
- HY-148089A
-
|
Transthyretin (TTR)
|
Neurological Disease
|
Eplontersen sodium is a triantennary N-acetyl galactosamine (GalNAc3-7a)-conjugated antisense oligonucleotide targeting transthyretin (TTR) mRNA to inhibit production of both variant and wild-type TTR protein. Misfolded TTR induces amyloid fibrils formation in the heart and peripheral nerves, leads to amyloid TTR (ATTR) amyloidosis diseases .
|
-
-
- HY-112974
-
GSK-2998728; ISIS-420915
|
Transthyretin (TTR)
|
Others
|
Inotersen is an antisense oligonucleotide that inhibits hepatic production of transthyretin (TTR).
|
-
-
- HY-157261
-
|
Others
|
Others
|
UNC2383 is an oligonucleotide enhancing compound that can enhance effects of antisense oligonucleotides (ASOs), and splice switching oligonucleotides (SSOs) .
|
-
-
- HY-W570885
-
|
DNA/RNA Synthesis
|
Others
|
2'-O-MOE-rC is a 2'-O-MOE modified nucleoside. 2'-O-MOE-rC can be used for synthesis of DNA .
|
-
-
- HY-153725
-
|
Liposome
|
Cancer
|
17:1 Lyso PC is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
-
- HY-W591449
-
|
Liposome
|
Cancer
|
DOPE-PEG-Azide, MW 2000 is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
-
- HY-153481
-
ISIS-107248
|
Integrin
|
Others
|
ATL 1102 is a novel second-generation antisense oligonucleotide to CD49d mRNA
|
-
-
- HY-153481A
-
ISIS-107248 sodium
|
Integrin
|
Others
|
ATL 1102 sodium is a novel second-generation antisense oligonucleotide to CD49d mRNA
|
-
-
- HY-153488
-
|
Ras
|
Cancer
|
ISIS-2503 is a 20-mer antisense oligonucleotide that inhibits Ha-Ras expression
|
-
-
- HY-153488A
-
|
Ras
|
Cancer
|
ISIS-2503 sodium is a 20-mer antisense oligonucleotide that inhibits Ha-Ras expression
|
-
-
- HY-149906C
-
GEM91 sodium
|
HIV
|
Infection
|
Trecovirsen sodium is a 25-mer antisense phosphorothioate oligonucleotide targeted at the gag site of the HIV gene.
|
-
-
- HY-149906
-
GEM91
|
HIV
|
Infection
|
Trecovirsen (GEM91) is a 25-mer antisense phosphorothioate oligonucleotide targeted at the gag site of the HIV gene.
|
-
-
- HY-143230
-
OGX-011
|
Apoptosis
|
Cancer
|
Custirsen is a highly specific antisense oligonucleotide that inhibits the production of clusterin , an antiapoptotic protein that is upregulated in response to chemotherapy and that confers treatment resistance.
|
-
-
- HY-143230A
-
OGX-011 sodium
|
Apoptosis
|
Cancer
|
Custirsen sodium is a highly specific antisense oligonucleotide that inhibits the production of clusterin , an antiapoptotic protein that is upregulated in response to chemotherapy and that confers treatment resistance.
|
-
-
- HY-P3392A
-
ION373 sodium
|
FAP
|
Neurological Disease
|
Zilganersen sodium is a glial fibrillary acidic protein (GFAP) inhibitor. Zilganersen sodium can be used in Alexander disease (AxD) research .
|
-
-
- HY-153479
-
-
-
- HY-153479A
-
-
-
- HY-145727A
-
ISIS 304801 sodium
|
Apolipoprotein
|
Endocrinology
|
Volanesorsen sodium is an antisense oligonucleotide thay targes Apolipoprotein C-III (APOC3)
mRNA. Volanesorsen sodium is used for the study of familial chylomicronemia syndrome.
|
-
-
- HY-149906A
-
FITC-GEM91 sodium
|
HIV
|
Infection
|
FITC-Trecovirsen (sodium) is a FITC labeled Trecovirsen. Trecovirsen is a 25-mer antisense phosphorothioate oligonucleotide targeted at the gag site of the HIV gene .
|
-
-
- HY-145722A
-
OGX-427
|
HSP
|
Cancer
|
Apatorsen is an antisense oligonucleotide designed to bind to Hsp27 mRNA, resulting in the inhibition of the production of Hsp27 protein.
|
-
-
- HY-145726
-
|
TNF Receptor
|
Inflammation/Immunology
|
ISIS 104838 is an antisense oligonucleotide agent that reduces the production of tumor necrosis factor (TNF-alpha), a substance that contributes to joint pain and swelling in rheumatoid arthritis.
|
-
-
- HY-145726A
-
|
TNF Receptor
|
Inflammation/Immunology
|
ISIS 104838 sodium is an antisense oligonucleotide agent that reduces the production of tumor necrosis factor (TNF-alpha), a substance that contributes to joint pain and swelling in rheumatoid arthritis.
|
-
-
- HY-145722
-
OGX-427 sodium
|
HSP
|
Cancer
|
Apatorsen (sodium) is an antisense oligonucleotide designed to bind to Hsp27 mRNA, resulting in the inhibition of the production of Hsp27 protein.
|
-
-
- HY-153497
-
IONIS ANGPT-L3Rx; ISIS 703802
|
ANGPTL
|
Metabolic Disease
|
Vupanorsen is an N-acetyl galactosamine-conjugated antisense oligonucleotide that inhibits Angiopoietin-like 3 (ANGPTL3) protein synthesis. Vupanorsen lowers triglycerides and atherogenic lipoproteins.
|
-
-
- HY-153497A
-
IONIS ANGPT-L3Rx sodium; ISIS 703802 sodium
|
ANGPTL
|
Metabolic Disease
|
Vupanorsen (sodium) is an N-acetyl galactosamine-conjugated antisense oligonucleotide that inhibits Angiopoietin-like 3 (ANGPTL3) protein synthesis. Vupanorsen (sodium) lowers triglycerides and atherogenic lipoproteins.
|
-
- HY-112754A
-
1,2-Dioleoyl-3-trimethylammonium-propane chloride
|
Liposome
|
Cancer
|
DOTAP chloride is a useful and effective cationic lipid for transient and stable transfection DNA (plasmids, bacmids) and modified nucleic acids (antisense oligonucleotides) with out the use of helper lipid .
|
-
- HY-112980
-
|
DNA/RNA Synthesis
|
Inflammation/Immunology
|
Nusinersen is an antisense oligonucleotide agent that modifies pre–messenger RNA splicing of the SMN2 gene and thus promotes increased production of full-length SMN protein .
|
-
- HY-145728
-
ISIS-2302
|
Integrin
|
Inflammation/Immunology
|
Alicaforsen is a 20-base antisense oligonucleotide inhibiting ICAM-1 production, which is an important adhesion molecule involved in leukocyte migration and trafficking to the site of inflammation.
|
-
- HY-145728A
-
ISIS-2302 sodium
|
Integrin
|
Inflammation/Immunology
|
Alicaforsen sodium is a 20-base antisense oligonucleotide inhibiting ICAM-1 production, which is an important adhesion molecule involved in leukocyte migration and trafficking to the site of inflammation.
|
-
- HY-112980A
-
|
DNA/RNA Synthesis
|
Inflammation/Immunology
|
Nusinersen sodium is an antisense oligonucleotide agent that modifies pre–messenger RNA splicing of the SMN2 gene and thus promotes increased production of full-length SMN protein .
|
-
- HY-158826
-
RO 707179
|
HIF/HIF Prolyl-Hydroxylase
|
Cancer
|
EZN-2968 is an antisense oligonucleotide that specifically binds and inhibits the expression of HIF-1α mRNA. EZN-2968, inhibits tumor cell growth.
|
-
- HY-158826A
-
|
HIF/HIF Prolyl-Hydroxylase
|
Cancer
|
EZN-2968 sodium is an antisense oligonucleotide that specifically binds and inhibits the expression of HIF-1α mRNA. EZN-2968 sodium, inhibits tumor cell growth.
|
-
- HY-148410A
-
STK-001 sodium
|
Sodium Channel
|
Others
|
Zorevunersen sodium is an antisense oligonucleotide that is intended to increase the level of productive SCN1A mRNA and consequently increase the expression of the sodium channel Nav1.1 protein. Zorevunersen sodium is used for the study of Dravet syndrome.
|
-
- HY-108764
-
ISIS 301012
|
Apolipoprotein
HCV
|
Metabolic Disease
|
Mipomersen sodium (ISIS 301012) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has anti-HCV effect and reduces the infectivity of the HCV. Mipomersen sodium can be used for the research of homozygous familial hypercholesterolemia (HoFH) .
|
-
- HY-148410
-
STK-001
|
Sodium Channel
|
Others
|
Zorevunersen (STK-001) is an antisense oligonucleotide that is intended to increase the level of productive SCN1A mRNA and consequently increase the expression of the sodium channel Nav1.1 protein. Zorevunersen is used for the study of Dravet syndrome.
|
-
- HY-132582A
-
|
Tau Protein
|
Cancer
|
Tau ASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (Tau ASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )
|
-
- HY-158825
-
CIVI007 sodium
|
PCSK9
|
Metabolic Disease
|
Cepadacursen sodium is a liver-targeting antisense oligonucleotide (ASO), inhibits proprotein convertase subtilisin/kexin type 9 (PCSK9) protein synthesis. Cepadacursen sodium can be used for hypercholesterolemia treatment and the prevention of atherosclerotic cardiovascular disease (ASCVD).
|
-
- HY-153491
-
ISIS 678354; IONIS-APOCIII-LRx; AKCEA-APOCIII-LRx
|
Apolipoprotein
|
Cardiovascular Disease
|
Olezarsen is an N-acetyl-galactosamine-conjugated antisense oligonucleotide targeted to hepatic APOC3 mRNA to inhibit apolipoprotein C-III (apoC-III) production, in lowering triglyceride levels in patients at high risk for or with established cardiovascular disease.
|
-
- HY-153491A
-
ISIS 678354 sodium; IONIS-APOCIII-LRx sodium; AKCEA-APOCIII-LRx sodium
|
Apolipoprotein
|
Cardiovascular Disease
|
Olezarsen sodium is an N-acetyl-galactosamine-conjugated antisense oligonucleotide targeted to hepatic APOC3 mRNA to inhibit apolipoprotein C-III (apoC-III) production, in lowering triglyceride levels in patients at high risk for or with established cardiovascular disease.
|
-
- HY-148370A
-
RG6299 sodium
|
Complement System
|
Others
|
IONIS-FB-LRx sodium is a specific antisense oligonucleotide (ASO) targeting complement factor B (CFB). IONIS-FB-LRx sodium effectively reduces circulating levels of CFB, and can be used for geographic atrophy (GA) research .
|
-
- HY-145728B
-
(R/S)-ISIS-2302
|
Integrin
|
Inflammation/Immunology
|
(R/S)-Alicaforsen is the racemate of Alicaforsen composed of R and S configurations. Alicaforsen is a 20-base antisense oligonucleotide inhibiting ICAM-1 production, which is an important adhesion molecule involved in leukocyte migration and trafficking to the site of inflammation.
|
-
- HY-158821
-
|
TGF-beta/Smad
|
Others
|
ISTH0036, an antisense oligonucleotide selectively targeting transforming growth factor beta 2 (TGF-β2), can be use in the study of primary open angle glaucoma (POAG), and wet age-related macular degeneration.
|
-
- HY-158821A
-
|
TGF-beta/Smad
|
Others
|
ISTH0036 sodium, an antisense oligonucleotide selectively targeting transforming growth factor beta 2 (TGF-β2), can be use in the study of primary open angle glaucoma (POAG) , and wet age-related macular degeneration.
|
-
- HY-148413
-
ISIS 3521 sodium
|
PKC
|
Cancer
|
Aprinocarsen (ISIS 3521) sodium, a specific antisense oligonucleotide inhibitor of protein kinase C-alpha (PKC-α). Aprinocarsen sodium is a 20-mer oligonucleotide, it regulates cell differentiation and proliferation. Aprinocarsen sodium inhibits the growth of human tumor cell lines in nude mice. Aprinocarsen sodium shows the value as a chemotherapeutic compound of human cancers .
|
-
- HY-145729
-
AZD9150
|
STAT
Apoptosis
|
Cancer
|
Danvatirsen is an antisense oligonucleotide targeting STAT3 with potential antitumor activity. Danvatirsen binds to STAT3 mRNA, thereby inhibiting translation of the transcript. Suppression of STAT3 expression induces tumor cell apoptosis and decreases tumor cell growth.
|
-
- HY-148505
-
|
Nucleoside Antimetabolite/Analog
|
Others
|
5'-ODMT cEt N-Bzm5 C Phosphoramidite Amidite is a potent nucleic acid analog. 5'-ODMT cEt N-Bzm5 C Phosphoramidite Amidite blongs to modified antisense oligonucleotide .
|
-
- HY-145729A
-
AZD9150 sodium
|
Apoptosis
STAT
|
Cancer
|
Danvatirsen sodium is an antisense oligonucleotide targeting STAT3 with potential antitumor activity. Danvatirsen sodium binds to STAT3 mRNA, thereby inhibiting translation of the transcript. Suppression of STAT3 expression induces tumor cell apoptosis and decreases tumor cell growth.
|
-
- HY-112754A1
-
1,2-Dioleoyl-3-trimethylammonium-propane chloride (Excipient)
|
Biochemical Assay Reagents
|
Others
|
DOTAP chloride Excipient is a cationic lipid with good membrane fusion ability and biocompatibility. DOTAP chloride Excipient can be used as an excipient for transient and stable transfection DNA (plasmids, bacmids) and modified nucleic acids (antisense oligonucleotides) without the use of helper lipid .
|
-
- HY-147217
-
ISIS 505358
|
HBV
|
Infection
|
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
|
-
- HY-148370
-
RG6299
|
Complement System
|
Others
|
IONIS-FB-LRx is a specific antisense oligonucleotide (ASO) targeting complement factor B (CFB). IONIS-FB-LRx effectively reduces circulating levels of CFB. IONIS-FB-LRx can be used for geographic atrophy (GA) research .
|
-
- HY-145727
-
ISIS 304801
|
Apolipoprotein
|
Endocrinology
|
Volanesorsen (ISIS 304801) is an antisense oligonucleotide inhibitor of apolipoprotein CIII (apo-CIII) mRNA that reduces triglyceride levels and improves insulin resistance. Volanesorsen is being studied in the treatment of hypertriglyceridemia, familial chylosiderosis syndrome, and type 2 diabetes .
|
-
- HY-132598A
-
SPC-3649 sodium
|
MicroRNA
|
Infection
|
Miravirsen sodium is a potent miR-122 inhibitor and inhibits the biogenesis of miR-122. Miravirsen sodium is a 15-nucleotide locked nucleic acid-modified phosphorothioate antisense oligonucleotide. Miravirsen sodium inhibits HCV replication, and can be used in research of HCV infection .
|
-
- HY-158829
-
|
EGFR
|
Cancer
|
SSOe26 sodium is a 15mer antisense oligonucleotide targeting?HER4. SSOe26 sodium induces exon 26 skipping, leading to the generation of a novel mRNA transcript that excludes exon 26 (CYT2 isoform). SSOe26 sodium decreases tumour growth in mouse xenografts.
|
-
- HY-148687
-
|
PCSK9
|
Cardiovascular Disease
|
SPC5001 is a locked nucleic acid (LNA)-modifed antisense oligonucleotide (ASO) complementary to human PCSK9 (proprotein convertase subtilisin/kexin type 9) mRNA. SPC5001 can be used for the research of hypercholesterolemia. SPC5001 sequence: 5′-TGmCTACAAAACmCmCA-3′ .
|
-
- HY-148827A
-
HYBO-165 sodium
|
PKA
|
Cancer
|
GEM231 sodium is an 18mer antisense oligonucleotide targeting the mRNA of the PKA-I (RIα regulatory subunit of cAMP dependent protein kinase type I ). GEM231 sodium induces cell growth arrest, apoptosis, and differentiation in a variety of cancer cell lines in vitro and in tumors in vivo.
|
-
- HY-148827
-
HYBO-165
|
PKA
|
Cancer
|
GEM231 is an 18mer antisense oligonucleotide targeting the mRNA of the PKA-I (RIα regulatory subunit of cAMP dependent protein kinase type I ). GEM231 induces cell growth arrest, apoptosis, and differentiation in a variety of cancer cell lines in vitro and in tumors in vivo.
|
-
- HY-147217A
-
ISIS 505358 sodium
|
HBV
|
Infection
|
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .
|
-
- HY-148687A
-
|
PCSK9
|
Cardiovascular Disease
|
SPC5001 sodium is a locked nucleic acid (LNA)-modifed antisense oligonucleotide (ASO) complementary to human PCSK9 (proprotein convertase subtilisin/kexin type 9) mRNA. SPC5001 sodium can be used for the research of hypercholesterolemia. SPC5001 sequence: 5′-TGmCTACAAAACmCmCA-3′ .
|
-
- HY-158827A
-
|
PCSK9
|
Metabolic Disease
|
AZD8233 sodium, a liver-targeting antisense oligonucleotide (ASO), inhibits subtilisin/kexin type 9 (PCSK9) protein synthesis. AZD8233 sodium increases the available LDL receptors by reducing PCSK9 levels, thereby clearing LDL from the blood and decreasing LDL-C levels.
|
-
- HY-132598
-
SPC-3649
|
MicroRNA
HCV
|
Infection
Inflammation/Immunology
|
Miravirsen (SPC-3649) is a potent miR-122 inhibitor and inhibits the biogenesis of miR-122. Miravirsen is a 15-nucleotide locked nucleic acid-modified phosphorothioate antisense oligonucleotide. Miravirsen inhibits HCV replication. Miravirsen can be used in research of HCV infection .
|
-
- HY-158827
-
|
PCSK9
|
Metabolic Disease
|
AZD8233, a liver-targeting antisense oligonucleotide (ASO), inhibits proprotein convertase subtilisin/kexin type 9 (PCSK9) protein synthesis. AZD8233 increases the available LDL receptors by reducing PCSK9 levels, thereby clearing LDL from the blood and decreasing LDL-C levels.
|
-
- HY-153485A
-
ISIS 766720 sodium; IONIS-GHR-LRx sodium
|
GHR
Small Interfering RNA (siRNA)
|
Others
|
Cimdelirsen is a novel, ligand-conjugated, hepatic-targeted investigative antisense oligonucleotide designed to reduce growth hormone receptor (GHr) synthesis, thereby inhibiting deleterious effects of growth hormone (GH) hypersecretion and reducing circulating insulin-like growth factor-1 (IGF-1) levels in acromegaly patients.
|
-
- HY-153485
-
ISIS 766720; IONIS-GHR-LRx
|
GHR
Small Interfering RNA (siRNA)
|
Others
|
Cimdelirsen is a novel, ligand-conjugated, hepatic-targeted investigative antisense oligonucleotide designed to reduce growth hormone receptor (GHr) synthesis, thereby inhibiting deleterious effects of growth hormone (GH) hypersecretion and reducing circulating insulin-like growth factor-1 (IGF-1) levels in acromegaly patients.
|
-
- HY-148130A
-
RG6091 sodium; RO7248824 sodium
|
E1/E2/E3 Enzyme
|
Others
|
Rugonersen sodium is a locked-nucleic acid (LNA)- modified antisense oligonucleotides (ASOs), and results in reduction of ubiquitin-protein ligase E3A (UBE3A) silencing. Angelman syndrome (AS) sodium is a severe neurodevelopmental disorder caused by the loss of neuronal E3 ligase UBE3A, Rugonersen has been used for AS reasearch .
|
-
- HY-148130
-
RG6091; RO7248824
|
E1/E2/E3 Enzyme
|
Others
|
Rugonersen (RG6091; RO7248824) is a locked-nucleic acid (LNA)- modified antisense oligonucleotides (ASOs), and results in reduction of ubiquitin-protein ligase E3A (UBE3A) silencing. Angelman syndrome (AS) is a severe neurodevelopmental disorder caused by the loss of neuronal E3 ligase UBE3A, Rugonersen has been used for AS reasearch .
|
-
- HY-150236
-
|
Huntingtin
|
Neurological Disease
|
FITC-labeled Tominersen (sodium) is the Tominersen labeled with FITC. Tominersen (RG6042) is a second-generation 2′-O-(2-methoxyethyl) antisense oligonucleotide that targets huntingtin protein (HTT) mRNA and potently suppresses HTT production. Tominersen improves survival and reduces brain atrophy in mice. Tominersen can be used for the research of Huntington’s disease (HD).
|
-
- HY-138577
-
|
DNA/RNA Synthesis
Nucleoside Antimetabolite/Analog
|
Others
|
2'-F-Bz-dC Phosphoramidite can be used in the synthesis of oligoribonucleotide (such as DNA and RNA). 2'-F-Bz-dC Phosphoramidite also used for synthesis antiviral agent to inhibit the replication of virus. 2'-F-Bz-dC Phosphoramidite contains a phosphorothioate backbone, to synthesise antisense oligonucleotide analogs to induce apoptosis in cancer cells .
|
-
- HY-158828
-
|
EGFR
|
Cancer
|
SSO111 sodium, a 20mer fully modified antisense oligonucleotide, targets the oncogene?HER2. SSO111 sodium induces exon 15 skipping during splicing, leading to the generation of a novel mRNA transcript that excludes exon 15. SSO111 sodium downregulated HER2 mRNA, which resulted in the inhibition of proliferation and induction of apoptosis in HER2-overexpressing tumor cells.
|
-
- HY-40118
-
Boc-L-proline methyl ester
|
Liposome
|
Others
|
Boc-Pro-OMe (Boc-L-proline methyl ester) is a lipid compound that can be used for liposome preparation. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble loads can be captured in the internal aqueous space of liposomes, while lipophilic loads can be distributed into the lipid bilayer and become part of the lipid bilayer. Especially for the delivery of antisense oligonucleotides, it can overcome the problems of inefficient cellular uptake and rapid loss in the body.
|
-
- HY-164579
-
|
Liposome
|
Others
|
NH2-GG-DSPE is a lipid compound that can be used for liposome preparation. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble loads can be captured in the internal aqueous space of liposomes, while lipophilic loads can be distributed into the lipid bilayer and become part of the lipid bilayer. Especially for the delivery of antisense oligonucleotides, it can overcome the problems of inefficient cellular uptake and rapid loss in the body.
|
-
- HY-157678
-
|
Liposome
|
Others
|
1,2-Dilinoleoyl-sn-glycero-3-phospho-L-serine sodium is a lipid compound that can be used for liposome preparation. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble loads can be captured in the internal aqueous space of liposomes, while lipophilic loads can be distributed into the lipid bilayer and become part of the lipid bilayer. Especially for the delivery of antisense oligonucleotides, it can overcome the problems of inefficient cellular uptake and rapid loss in the body.
|
-
- HY-157624
-
18:0-22:6 PE
|
Liposome
|
Others
|
1-Stearoyl-2-docosahexaenoyl-sn-glycero-3-phosphoethanolamine (18:0-22:6 PE) is a lipid compound that can be used for liposome preparation. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble loads can be captured in the internal aqueous space of liposomes, while lipophilic loads can be distributed into the lipid bilayer and become part of the lipid bilayer. Especially for the delivery of antisense oligonucleotides, it can overcome the problems of inefficient cellular uptake and rapid loss in the body.
|
-
- HY-165975
-
(2S)-3-Keto-C6-dihydrosphingosine hydrochloride
|
Liposome
|
Others
|
(2S)-3-Keto sphinganine (d6:0) ((2S)-3-Keto-C6-dihydrosphingosine) hydrochloride is a lipid compound that can be used for liposome preparation. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble loads can be captured in the internal aqueous space of liposomes, while lipophilic loads can be distributed into the lipid bilayer and become part of the lipid bilayer. Especially for the delivery of antisense oligonucleotides, it can overcome the problems of inefficient cellular uptake and rapid loss in the body.
|
-
- HY-W440752
-
|
Liposome
|
Cancer
|
BP Lipid 113 is an ionizable lipid analogous to SM-102. It can be used to prepare liposome or lipid nanoparticles.
|
-
- HY-W800749
-
|
Liposome
|
Cancer
|
BP Lipid 223 is an pentanolamine lipid (Compound 7) from patent WO2017075531A with both ester bonds located adjacent to C6 relative to the amine head. The introduction of ester linkages can improve the clearance of the lipid in the liver. This compound is analgous to ALC-0315. The lipid can be used to prepare mRNA nanocarriers with good balance of delivery efficiency and pharmakokinetics as well as rapid lipid clearance profile.
|
-
- HY-W800786
-
N-MCC-PE
|
Liposome
|
Cancer
|
16:0 PE MCC is a maleimide-functionalized thiol-reactive lipid with a phosphoethanolamine linked to two palmitic acid tails and a maleimide group.
|
-
- HY-W440711
-
|
Liposome
|
Cancer
|
Cholesterol-PEG-Biotin (MW 2000) is a pegylated lipids which has strong binding to avidin or streptavidin.
|
-
- HY-W800734
-
MPPC; PC(14:0/16:0)
|
Liposome
|
Cancer
|
1-Myristoyl-2-palmitoyl-sn-glycero-3-phosphocholine (MPPC) is an asymmetrical phosphatidylcholine containing a myristic acid (14:0) at the sn-1 position and a palmitic acid (16:0) at the sn-2 position. It is commonly used in the generation of micelles, liposomes, and other types of artificial membranes.
|
-
- HY-W800777
-
|
Liposome
|
Cancer
|
6-(3-Hydroxypropylamino)hexyl 2-hexyldecanoate is an ionizable lipid which can be used to make ALC-0315. The lipid has an ester bond adjacent to C6 relative to the amine nitrogen. The introduction of ester linkages can improve the clearance of the lipid in the liver.
|
-
- HY-W800785
-
1-palMitoyl-2-(10,12-tricosadiynoyl)-sn-glycero-3-phosphocholine
|
Liposome
|
Cancer
|
16:0-23:2 Diyne PC is a phospholipase-mediated hydrolyzed phosphocoline with palmitic acid (16:0) and Pentacosa-10,12-diynoic acid for tails.
|
-
- HY-W440706
-
|
Liposome
|
Cancer
|
Cholesterol-PEG-alcohol (MW 2000) is a pegylated lipids which can be used for preparation of liposome or nanoparticle. The lipophilic moiety can encapsulate hydrophobic drugs whereas the hydrophilic PEG chain helps the overal water solubility of the micelles. The amine can react with an activated NHS ester to form a stable amide bond.
|
-
- HY-W800787
-
|
Liposome
|
Cancer
|
18:1 PE MCC is a maleimide-functionalized thiol-reactive lipid with a phosphoethanolamine linked to two oleic acid tails and a maleimide group.
|
-
- HY-W440719
-
|
Liposome
|
Cancer
|
Cholesterol-PEG-MAL (MW 2000) is a PEG derivative and can be used to prepare liposome or nanoparticle due to its ability to self-assemble in water. The maleimide moiety is reactive with thiol molecule to form a covalent thioether bond.
|
-
- HY-W339838
-
14:0 Lyso PG
|
Liposome
|
Cancer
|
1-Myristoyl-2-hydroxy-sn-glycero-3-PG sodium is a lysophospholipid containing myristic acid (14:0) at the sn-1 position. It has been used in the generation of micelles, liposomes, and other types of artificial membranes, including lipid-based drug carrier systems.
|
-
- HY-141615
-
PDME; 16:0 Dimethyl PE
|
Liposome
|
Cancer
|
1,2-Dipalmitoyl-sn-glycero-3-phospho-N,N-dimethylethanolamine has been used in the generation of liposomes and monolayers for use in the study of membrane permeability and monolayer viscosity, respectively.
|
-
- HY-W440748
-
|
Liposome
|
Cancer
|
BP Lipid 109 is an amine lipid which has long (11 carbons) lipid tail on the primary ester. Both esters are located at C7 position and the head contains ethanolamine. It can be used to prepare liposome or lipid nanoparticles.
|
-
- HY-W140488
-
10:0 PE
|
Liposome
|
Cancer
|
1,2-Didecanoyl-sn-glycero-3-phosphoethanolamine, a phospholipid, showes very promising P-gp inhibitory results at a concentration of 0.3 mM.
|
-
- HY-W440694
-
|
Liposome
|
Cancer
|
Cholesterol-PEG-Azide (MW 2000) is a pegylated lipids which can be used for preparation of liposome or nanoparticle. The lipophilic moiety can encapsulate hydrophobic drugs whereas the hydrophilic PEG chain helps the overal water solubility of the micelles. Cholesterol-PEG-Azide (MW 2000) can be reacted with alkyne via CuAAC or SPAAC click chemistry.
|
-
- HY-W800737
-
|
Liposome
|
Cancer
|
BP Lipid 126 is an amino ionizable lipid (Compound 143) from patent WO2017201333A1 with ester bonds located at C8 and C7 position relative to nitrogen. The ester linkages are introduced to improve tissue clearance. The ethanolamine head can effectively enhance mRNA encapsulation. BP Lipid 126 can be used in the generation of liposomes.
|
-
- HY-W343736
-
1,3-DPPE; 1,3-Dipalmitoyl-sn-glycero-2-PE
|
Liposome
|
Cancer
|
1,3-Dipalmitoyl-glycero-2-phosphoethanolamine is a phospholipid containing the saturated long-chain (16:0) stearic acid inserted at the sn-1 and sn-3 positions and PE at the sn-2 site. It can be used in the generation of micelles, liposomes, and other types of artificial membranes.
|
-
- HY-W800784
-
|
Liposome
|
Cancer
|
23:2 Diyne PE [DC(8,9)PE] is a phospholipase-mediated hydrolyzed phosphocoline with palmitic acid (16:0) and Pentacosa-10,12-diynoic acid for tails.
|
-
- HY-W440690
-
|
Liposome
|
Cancer
|
Cholesterol-PEG-Amine (MW 2000) is a pegylated lipids which can be used for preparation of liposome or nanoparticle. The lipophilic moiety can encapsulate hydrophobic drugs whereas the hydrophilic PEG chain helps the overal water solubility of the micelles.
|
-
- HY-138913
-
|
Liposome
|
Cancer
|
2H-Cho-Arg (TFA) is a steroid-based cationic lipid that contains a 2H-cholesterol skeleton coupled to an L-arginine head group and can be used to facilitate gene transfection.
|
-
- HY-W440698
-
|
Liposome
|
Cancer
|
Cholesterol-PEG-Acid (MW 2000) is a polydisperse PEG derivative which can be used to create liposome as drug carrier for delivering therapeutic agents into tissues.
|
-
- HY-W340832
-
|
Liposome
|
Cancer
|
18:1 Biotinyl Cap PE is a fluorescent lipid, which features a head group that has been altered to include biotinyl cap PE.
|
-
- HY-W800778
-
|
Liposome
|
Cancer
|
Bis(2-butyloctyl) 10-oxononadecanedioate is an ionizable lipid-like compound containing four hydrophobic tails bound by esters. It can be used to build lipids for mRNA encapsulation and delivery.
|
-
- HY-W440743
-
|
Liposome
|
Cancer
|
BP Lipid 103 is an amine ionizable lipid analogous to SM-102. It can be used to prepare liposome or lipid nanoparticles.
|
-
- HY-W591913
-
|
Liposome
|
Cancer
|
Cholesterol-PEG-methoxy, MW 2000 is a PEG derivative which self-assembles in water to form micelle-like structure. The cholesterol tail can be used to encapsulate hydrophobic drugs while the PEG chain ehances the water solubility of the micelles.
|
-
- HY-160912
-
|
ELOVL
|
Cancer
|
ELOVL6-IN-5 (compound B) is an inhibitor of the elongase enzyme of long-chain fatty acid family 6 (ELOVL6). ELOVL6 is a rate-limiting enzyme for the elongation of saturated and monounsaturated long-chain fatty acids and is an effective target for inhibiting diabetes. ELOVL6-IN-5 reduces hepatic fatty acid levels in a mouse model of diet-induced obesity (DIO). However, ELOVL6 inhibition by ELOVL6-IN-5 did not improve insulin resistance .
|
-
- HY-115435
-
DMPS-Na; Dimyristoyl phosphatidylserine sodium
|
Liposome
|
Cancer
|
1,2-Dimyristoyl-sn-glycero-3-phospho-L-serine sodium is an anionic phospholipid with myristic acid tails (14:0) and contains a carboxylic acid (COOH) and amine (NH2) in their head group. It has been used in the preparation of liposome.
|
-
- HY-134174
-
|
Liposome
|
Cancer
|
1-Palmitoyl-2-oleoyl-sn-glycero-3-phosphate is a phospholipid containing saturated palmitic acid (16:0) and monounsaturated oleic acid (18:1) inserted at the sn-1 and sn-2 positions, respectively. It can be used in the generation of micelles, liposomes, and other types of artificial membranes.
|
-
- HY-W440751
-
|
Liposome
|
Cancer
|
BP Lipid 112 is an amine lipid with two ester linkages at C6 and C7 position. The C6 ester has a long 11 carbons lipid tail. It can be used to prepare liposome or lipid nanoparticles.
|
-
- HY-W440727
-
|
Liposome
|
Cancer
|
Cholesterol-PEG-Vinylsulfone (MW 2000) is a thiol reactive polyPEG via thiol-ene reaction to form a thioether bond. It can self-assemble in water and is used to prepare liposome as drug vehicle for targeted delivery into tissues.
|
-
- HY-W440724
-
|
Liposome
|
Cancer
|
Cholesterol-PEG-Thiol (MW 3400) is an amphiphatic PEG derivative which forms micelles in water and can be used to prepare liposomes or nanoparticles for drug delivery system. The thiol moiety is reactive with maleimide to form a stable thioether bond.
|
-
- HY-W440981
-
1-Stearoyl-2-palmitoyl-sn-glycero-3-phosphocholine
|
Liposome
|
Cancer
|
SPPC is a phospholipid with different length of fatty acid. The sn-1 position contains a stearic acid (18:0) while the sn-2 position is occupied by a palmitic acid (16:0).
|
-
- HY-W440803
-
|
Liposome
|
Cancer
|
BP Lipid 218 is an ionizable amine lipid with two identical ester tails adjacent to C6 position relative to amine.
|
-
- HY-W440800
-
|
Liposome
|
Cancer
|
BP Lipid 226 is an amino ionizable lipid analogous to ALC-0315. It can be used to prepare liposome or lipid nanoparticles.
|
-
- HY-W440820
-
|
Liposome
|
Cancer
|
Bis(bis(2-carboxyethyl)aminopropyl)methylamine is a symmetrical branched linker featuring three tertiary amines and four carboxylic acids. Each carboxylic acid is open to forming esters or amides. It can be used in developing lipid nanoparticles.
|
-
- HY-W440766
-
|
Liposome
|
Cancer
|
BP Lipid 209 is an amine lipid which has a 9-carbons lipid tail on the primary ester. Both esters are located at C8 and C10 position relative to the amine nitrogen. It can be used to prepare liposome or lipid nanoparticles.
|
-
- HY-W440957
-
PC(16:0/14:0); 1-palmitoyl-2-myristoyl-sn-glycero-3-phosphocholine
|
Liposome
|
Cancer
|
PMPC is a phosphatidylcholine with asymmetrical fatty acid. Palmitic acid occupies sn-1 position while myristic acid is placed at the sn-2 position.
|
-
- HY-W440958
-
PSPC; PC(16:0-18:0)
|
Liposome
|
Cancer
|
1-Palmitoyl-2-stearoyl-sn-glycero-3-phosphocholine is an assymetrical phospholipid containing saturated palmitic and stearic acid at the sn-1 and sn-2 position respectively. The phosphate group is attached to choline.
|
-
- HY-W440931
-
|
Liposome
|
Cancer
|
MPEG2000-DMG is a synthetic lipid comprised of polyPEG and dimyristoyl glycerol. It is used in the creation of lipid nanoparticles (LNPs) for mRNA vaccines.
|
-
- HY-W591461
-
|
Liposome
|
Cancer
|
DSPE-PEG-COOH, MW 2000 is a phospholipid polyPEG which can be used to prepare liposomes or nanoparticles. The terminal carboxylic acid can react with primary amine groups to form a stable amide bond.
|
-
- HY-W440985
-
1,2-dilauroyl-sn-glycero-3-phospho-L-serine
|
Liposome
|
Cancer
|
DLPS is an anionic phospholipid with lauric acid tails (12:0) and contains a carboxylic acid (COOH) and amine (NH2) in their head group. It has been used in the preparation of lipid-mixing vesicles, liposome, or artificial membrane. Due to the medium size of fatty acid chain, DLPS is used to form thinner membranes/walls.
|
-
- HY-W440991
-
|
Liposome
|
Cancer
|
DOPE-PEG-Amine (MW 2000) is a polydisperse PEG covalently attached to a phospholipid. The polymer is an amphiphilic molecule with hydrophobic fatty acid chains and hydrophilic PEG head which enables lipid bilayer or micelle formation in water. The phospholipid PEG can be used to prepare liposome or nanoparticles for targeted drug delivery and is reactive with alkyne to form a triazole ring.
|
-
- HY-W440995
-
|
Liposome
|
Cancer
|
DOPE-PEG-Mal (MW 2000) is a phospholipid polyPEG which can be used to prepare liposomes or nanoparticles. It is also reactive with thiol at pH 6.5 tp 7.5 to form a stable thioether bond.
|
-
- HY-W441005
-
|
Liposome
|
Cancer
|
Amino-Gly-Gly-DSPE (hydrochloride) is a specially modified phospholipid that has been used to synthesize liposomes. The terminal amine is reactive with an NHS ester compound or carboxylic acid molecule in the presence of activator, such as HATU or EDC.
|
-
- HY-W587499
-
|
Liposome
|
Cancer
|
2-Arachidonoyl-sn-glycero-3-phosphocholine is a phospholipid molecule that is a major component of the plasma membrane. It is a phospholipid molecule that is involved in the regulation of membrane fluidity, signal transduction, cell-cell communication, and mediator of inflammation.
|
-
- HY-W590535
-
1,2-DNPC;
1,2-Dinonadecanoyl-sn-glycero-3-phosphocholine
|
Liposome
|
Cancer
|
19:0 PC is a saturated phospholipid that has been used as a standard for the quantification of phosphatidylcholines in human synovial fluid. It has also been used to study dynamics of lipid bilayer phase transition.
|
-
- HY-W590536
-
1-Palmitoyl-2-Lauroyl-sn-glycero-3-Phosphatidylcholine; 1-Palmitoyl-2-Lauroyl-sn-glycero-3-Phosphocholine
|
Liposome
|
Cancer
|
1,2-PLPC is a phospholipid containing palmitoyl (16:0) and lauryl (12:0) acyl substituents at the sn-1 and sn-2 positions, respectively. It can be used in the generation of micelles, liposomes, and other types of artificial membranes.
|
-
- HY-W590538
-
|
Liposome
|
Cancer
|
HAPC-Chol is a cationic cholesterol that can be used as a component of lipoplexes complexes.
|
-
- HY-W590555
-
|
Liposome
|
Cancer
|
Thiol-PEG-DMG, MW 2000 is a phospholipid polyPEG which can be used to prepare liposomes or nanoparticles. The terminal thiol group reacts with maleimide, OPSS, vinylsulfone and transition metal surfaces including gold, silver, etc.
|
-
- HY-W590593
-
|
Liposome
|
Cancer
|
mPEG-Cholesterol,MW 2000 is a PEG derivative which self-assembles in water to form micelle-like structure. The cholesterol tail can be used to encapsulate hydrophobic drugs while the PEG chain ehances the water solubility of the micelles.
|
-
- HY-W591332
-
|
Liposome
|
Cancer
|
DMPE-mPEG, MW 2000 is a PEGylated 1,2-Dimyristoyl-sn-glycero-3-phosphoethanolamine (14:0 PE) compound with a methyl group at the other end of the PEG chain. The PEG polymer exhibits amphiphatic behavior and helps to form stable micelles in an aqueous solution. It can be used to prepare nanoparticles or liposomes for targeted drug delivery applications.
|
-
- HY-W800733
-
1,2-Dilauroyl-sn-glycero-3-phosphorylglycerol; PG(12:0/12:0)
|
Liposome
|
Cancer
|
DLPG is a phospholipid containing lauric acid (12 chain fatty acid) inserted at the sn-1 and sn-2 positions. Its phosphate group is attached to glycerol. It is used in the generation of micelles, liposomes, and other artificial membranes.
|
-
- HY-W800788
-
|
Liposome
|
Cancer
|
18:1 MPB PE is a maleimide-functionalized thiol-reactive lipid with a phosphoethanolamine linked to two oleic acid tails and a phenyl maleimide group.
|
-
- HY-W800789
-
|
Liposome
|
Cancer
|
16:0 MPB PE is a maleimide-functionalized thiol-reactive lipid with a phosphoethanolamine linked to two palmitic acid tails and a phenyl maleimide group.
|
-
- HY-W800790
-
|
Liposome
|
Cancer
|
18:1 Caproylamine PE is a amine-functionalized lipid with a phosphoethanolamine linked to two oleic acid tails.
|
-
- HY-W800791
-
|
Liposome
|
Cancer
|
16:0 Caproylamine PE is an amide-functionalized lipid with a phosphoethanolamine linked to two palmitic acid tails.
|
-
- HY-W800792
-
1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-(succinyl)
|
Liposome
|
Cancer
|
18:1 Succinyl PE is a carboxylic acid-functionalized lipid with a two carbon linker to a phosphoethanolamine bound to two oleic acid tails.
|
-
- HY-W800793
-
1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-(succinyl)
|
Liposome
|
Cancer
|
16:0 Succinyl PE is a carboxylic acid-functionalized lipid with a two carbon linker to a phosphoethanolamine bound to two palmitic acid tails.
|
-
- HY-W800794
-
DPPE-NG; 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-(glutaryl)
|
Liposome
|
Cancer
|
16:0 Glutaryl PE is is a carboxylic acid-functionalized lipid with a three carbon linker to a phosphoethanolamine bound to two palmitic acid tails.
|
-
- HY-W800795
-
DOPE-NG; 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-(dodecanoyl)
|
Liposome
|
Cancer
|
18:1 Dodecanyl PE is a carboxylic acid-functionalized lipid with a ten carbon linker to a phosphoethanolamine bound to two oleic acid tails.
|
-
- HY-W800796
-
1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-(biotinyl)
|
Liposome
|
Cancer
|
18:1 Biotinyl PE is a biotin-functionalized lipid attached to a phosphoethanolamine linked to two oleic acid groups.
|
-
- HY-W800797
-
1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-(biotinyl)
|
Liposome
|
Cancer
|
16:0 Biotinyl PE is a biotin-functionalized lipid attached to a phosphoethanolamine linked to two palmitic acid groups.
|
-
- HY-W800798
-
1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-(cyanur)
|
Liposome
|
Cancer
|
16:0 Cyanur PE is a cyanur-functionalized lipid attached to a phosphoethanolamine linked to two palmitic acid groups.
|
-
- HY-W800802
-
|
Liposome
|
Cancer
|
BP Lipid 227 is an ionizable lipid. It has primary esters at C5 position relative to the amine nitrogen. The primary lipid tail has an 8 carbon tail. BP Lipid 227 can be used in the generation of liposomes.
|
-
- HY-W800805
-
|
Liposome
|
Cancer
|
DOPE-Mal is a synthetic analog of naturally-occurring PE containing 18:1 fatty acids at the sn-1 and sn-2 positions with a terminal maliemide group. The maleimide group will react with a thiol group to form a covalent bond. The hydrophilic PEG spacer increases solubility in aqueous media.
|
-
- HY-W800812
-
|
Liposome
|
Cancer
|
BP Lipid 308 has a terminal tertiary amine group, a linoleic group, and a 4,4-bis(octyloxy)butanoic acid sodium salt tail. This compound can be useful for the building or modification of lipid nanoparticles.
|
-
- HY-W800825
-
|
Liposome
|
Cancer
|
Octadecanedioic Acid Mono-L-carnitine ester is a cationic lipid which may be used in combination with other lipids in the formation of lipid nanoparticles (LNPs). Its terminal carboxylic acid can react with primary amine groups in the presence of activators (e.g. HATU) to form a stable amide bond.
|
-
- HY-W800827
-
|
Liposome
|
Cancer
|
BP Lipid 229 is an amino ionizable lipid. It has primary esters at C7 position relative to the amine nitrogen. The primary lipid tail has 8 carbon tail. BP Lipid 229 can be used in the generation of liposomes.
|
-
- HY-W800841
-
|
Liposome
|
Cancer
|
BP Lipid 314 is an ionizable amino lipid featuring a dimethylamino head group, a carbamate linking to a central tertiary carbon with two other branches, a linoleate ester, and an aliphatic acetal ester.
|
-
- HY-W800843
-
|
Liposome
|
Cancer
|
tert-Butyl 3-(7-((undecan-3-yloxy)carbonyl)heptylamino)propylcarbamate is an aminolipid featuring a Boc-protected primary amine, a propylamine spacer attached to an octanoate chain and a C11 chain.
|
-
- HY-W800849
-
|
Liposome
|
Cancer
|
BP Lipid 315 is a cationic ionizable lipid ALC-0315 analogue featuring a Boc-protected primary amine, a central tertiary amine, and two ester tails located at the C8 position relative to the amine. One of these esters features a symmetrical branched C17 tail, while the other is an asymmetric C11 tail.
|
-
- HY-W590538A
-
|
Liposome
|
Others
|
HAPC-Chol is a cationic cholesterol that can be used as a component of lipoplexes complexes .
|
-
Cat. No. |
Product Name |
Type |
-
- HY-150236
-
|
Dyes
|
FITC-labeled Tominersen (sodium) is the Tominersen labeled with FITC. Tominersen (RG6042) is a second-generation 2′-O-(2-methoxyethyl) antisense oligonucleotide that targets huntingtin protein (HTT) mRNA and potently suppresses HTT production. Tominersen improves survival and reduces brain atrophy in mice. Tominersen can be used for the research of Huntington’s disease (HD).
|
Cat. No. |
Product Name |
Type |
-
- HY-21997
-
|
Gene Sequencing and Synthesis
|
Dmt-2'fluoro-da(bz) amidite, an uniformly modified 2'-deoxy-2'-fluoro phosphorothioate oligonucleotide, is a nuclease-resistant antisense compound with high affinity and specificity for RNA targets. Dmt-2'fluoro-da(bz) amidite is also an intermediate for 5’-DMT-3’-phosphoramidite synthesis .
|
-
- HY-112754A
-
1,2-Dioleoyl-3-trimethylammonium-propane chloride
|
Drug Delivery
|
DOTAP chloride is a useful and effective cationic lipid for transient and stable transfection DNA (plasmids, bacmids) and modified nucleic acids (antisense oligonucleotides) with out the use of helper lipid .
|
Cat. No. |
Product Name |
Target |
Research Area |
-
- HY-P10567
-
|
Peptides
|
Others
|
Pip6a is an arginine-rich cell-penetrating peptide. Pip6a has the ability to deliver associated cargoes across the plasma and endosomal membranes and is stable to serum proteolysis. Pip6a is composed of a hydrophobic core region flanked on each side by arginine-rich domains containing β-alanine and aminohexanoyl spacers. Pip6a-conjugated morpholino phosphorodiamidate oligomer (PMO) dramatically enhanced antisense oligonucleotide (ASO) delivery into striated muscles of myotonic dystrophy (DM1) mice .
|
-
- HY-40118
-
Boc-L-proline methyl ester
|
Liposome
|
Others
|
Boc-Pro-OMe (Boc-L-proline methyl ester) is a lipid compound that can be used for liposome preparation. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble loads can be captured in the internal aqueous space of liposomes, while lipophilic loads can be distributed into the lipid bilayer and become part of the lipid bilayer. Especially for the delivery of antisense oligonucleotides, it can overcome the problems of inefficient cellular uptake and rapid loss in the body.
|
Cat. No. |
Product Name |
|
Classification |
-
- HY-W440694
-
|
|
Azide
|
Cholesterol-PEG-Azide (MW 2000) is a pegylated lipids which can be used for preparation of liposome or nanoparticle. The lipophilic moiety can encapsulate hydrophobic drugs whereas the hydrophilic PEG chain helps the overal water solubility of the micelles. Cholesterol-PEG-Azide (MW 2000) can be reacted with alkyne via CuAAC or SPAAC click chemistry.
|
Cat. No. |
Product Name |
|
Classification |
-
- HY-108753A
-
AVI 4658 sodium
|
|
Antisense Oligonucleotides
|
Eteplirsen sodium is a synthetic antisense oligonucleotide, and can be used for Duchenne muscular dystrophy research .
|
-
- HY-132593A
-
WVE-120101 sodium
|
|
Antisense Oligonucleotides
|
Rovanersen sodium is an antisense oligonucleotide that specifically targets mutated mRNA copies of the huntington (HTT) gene without affecting healthy mRNA of HTT gene, thereby preventing the production of faulty Huntingtin protein. Rovanersen sodium can be used for huntington’s disease research .
|
-
- HY-159693A
-
-
- HY-159693
-
-
- HY-W570887
-
-
- HY-108753
-
AVI 4658
|
|
Antisense Oligonucleotides
|
Eteplirsen (AVI 4658) is a synthetic antisense oligonucleotide. Eteplirsen can be used for Duchenne muscular dystrophy research .
|
-
- HY-P3392
-
ION373
|
|
Antisense Oligonucleotides
|
Zilganersen (ION373) is a glial fibrillary acidic protein (GFAP) inhibitor, an antisense oligonucleotide. Zilganersen can be used in Alexander disease (AxD) research .
|
-
- HY-132582
-
BIIB080; ISIS 814907
|
|
Antisense Oligonucleotides
|
IONIS-MAPTRx (BIIB080) is the first Tau-lowering antisense oligonucleotide (ASO). IONIS-MAPTRx has the potential for the research of Alzheimer Disease .
|
-
- HY-132593
-
WVE-120101
|
|
Antisense Oligonucleotides
|
Rovanersen (WVE-120101) is an antisense oligonucleotide that specifically targets mutated mRNA copies of the huntington (HTT) gene without affecting healthy mRNA of HTT gene, thereby preventing the production of faulty Huntingtin protein. Rovanersen can be used for huntington’s disease research .
|
-
- HY-159692
-
IONIS-1063734
|
|
Antisense Oligonucleotides
|
AZD8701 (IONIS-1063734) is an antisense oligonucleotide targeting FOXP3 in regulatory T cells (Tregs). AZD8701 can relieve immunosuppression in cancer .
|
-
- HY-159692A
-
IONIS-1063734 sodium
|
|
Antisense Oligonucleotides
|
AZD8701 (IONIS-1063734) sodium is an antisense oligonucleotide targeting FOXP3 in regulatory T cells (Tregs). AZD8701 sodium can relieve immunosuppression in cancer .
|
-
- HY-132581A
-
BIIB078 sodium; IONIS-C9Rx sodium
|
|
Antisense Oligonucleotides
|
Tadnersen sodium, an antisense oligonucleotide (ASO), selectively targets C9ORF72 transcript variants 1 and 3 that carry the expansion .
|
-
- HY-151123A
-
AKCEA-APO(a)-LRx sodium; ISIS 681257 sodium; TQJ230 sodium
|
|
Antisense Oligonucleotides
|
Pelacarsen sodium is a liver-specific antisense oligonucleotide against apolipoprotein(a) that reduces lipoprotein(a) up to 80% with good tolerability .
|
-
- HY-159695
-
ISIS 426115
|
|
Antisense Oligonucleotides
|
IONIS-GCCRRx (ISIS 426115), a glucocorticoid receptor antagonist, is a 2'-O-methoxyethyl (2'-MOE) antisense oligonucleotide (ASO) .
|
-
- HY-159695A
-
ISIS 426115 sodium
|
|
Antisense Oligonucleotides
|
IONIS-GCCRRx (ISIS 426115) sodium, a glucocorticoid receptor antagonist, is a 2'-O-methoxyethyl (2'-MOE) antisense oligonucleotide (ASO) .
|
-
- HY-132581
-
BIIB078; IONIS-C9Rx
|
|
Antisense Oligonucleotides
|
Tadnersen (BIIB078), an antisense oligonucleotide (ASO), selectively targets C9ORF72 transcript variants 1 and 3 that carry the expansion .
|
-
- HY-148647
-
ISIS 301012 free base
|
|
Antisense Oligonucleotides
|
Mipomersen (ISIS 301012 free base) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has anti-HCV effect and reduces the infectivity of the HCV. Mipomersen can be used for the research of homozygous familial hypercholesterolemia (HoFH) .
|
-
- HY-151123
-
AKCEA-APO(a)-LRx; ISIS 681257; TQJ230
|
|
Antisense Oligonucleotides
|
Pelacarsen (AKCEA-APO(a)-LRx) is a liver-specific antisense oligonucleotide against apolipoprotein(a) that reduces lipoprotein(a) up to 80% with good tolerability .
|
-
- HY-145721A
-
GED-0301 sodium
|
|
Antisense Oligonucleotides
|
Mongersen sodium is a specific and orally active SMAD7 antisense oligonucleotide. Mongersen sodium restores TGF-β1 activity leading to inhibition of inflammatory signals. Mongersen sodium can attenuate Crohn's disease-like experimental colitis in mice .
|
-
- HY-132579A
-
RG6042 sodium; IONIS-HTTRx sodium
|
|
Antisense Oligonucleotides
|
Tominersen sodium is a second-generation 2′-O-(2-methoxyethyl) antisense oligonucleotide that targets huntingtin protein (HTT) mRNA and potently suppresses HTT production. Tominersen improves survival and reduces brain atrophy in mice. Tominersen sodium can be used for the research of Huntington’s disease (HD) .
|
-
- HY-132579
-
RG6042; IONIS-HTTRx
|
|
Antisense Oligonucleotides
|
Tominersen (RG6042) is a second-generation 2′-O-(2-methoxyethyl) antisense oligonucleotide that targets huntingtin protein (HTT) mRNA and potently suppresses HTT production. Tominersen improves survival and reduces brain atrophy in mice. Tominersen can be used for the research of Huntington’s disease (HD) .
|
-
- HY-145721
-
GED-0301
|
|
Antisense Oligonucleotides
|
Mongersen (GED-0301) is a specific and orally active SMAD7 antisense oligonucleotide. Mongersen restores TGF-β1 activity leading to inhibition of inflammatory signals. Mongersen can attenuate Crohn's disease-like experimental colitis in mice .
|
-
- HY-109528
-
ISIS-2922
|
|
Antisense Oligonucleotides
|
Fomivirsen (ISIS-2922) sodium is an antisense 21 mer phosphorothioate oligonucleotide. Fomivirsen sodium is an antiviral agent that is used cytomegalovirus retinitis (CMV) research, incluiding in AIDs. Fomivirsen sodium binds to and degrades the mRNAs encoding CMV immediate-early 2 protein, thus inhibiting virus proliferation .
|
-
- HY-132608
-
ISIS-420915 sodium
|
|
Antisense Oligonucleotides
|
Inotersen (ISIS-420915) sodium is a 2′-O-methoxyethyl-modified antisense oligonucleotide. Inotersen sodium inhibits the production of transthyretin (TTR) protein by targeting the TTR RNA transcript and reduces the levels of the TTR transcript. Inotersen sodium can be used for the research of hereditary TTR amyloidosis polyneuropathy .
|
-
- HY-132580A
-
BIIB067 sodium; ISIS-SOD1Rx sodium
|
|
Antisense Oligonucleotides
|
Tofersen sodium is an antisense oligonucleotide that mediates RNase H-dependent degradation of superoxide dismutase 1 (SOD1) mRNA to reduce the synthesis of SOD1 protein. Tofersen sodium can be used for the research of amyotrophic lateral sclerosis (ALS) .
|
-
- HY-159696A
-
|
|
Antisense Oligonucleotides
|
ISIS 449884 sodium is a 2'-O-methoxyethyl antisense oligonucleotide that targets GCGR. ISIS 449884 sodium has an ability to reduce hepatic glucose output and lower the blood glucose level. ISIS 449884 sodium can be used for the study of type 2 diabetes mellitus (T2DM) .
|
-
- HY-159696
-
|
|
Antisense Oligonucleotides
|
ISIS 449884 is a 2'-O-methoxyethyl antisense oligonucleotide that targets GCGR. ISIS 449884 has an ability to reduce hepatic glucose output and lower the blood glucose level. ISIS 449884 can be used for the study of type 2 diabetes mellitus (T2DM) .
|
-
- HY-132580
-
BIIB067; ISIS-SOD1Rx
|
|
Antisense Oligonucleotides
|
Tofersen (BIIB067) is an antisense oligonucleotide that mediates RNase H-dependent degradation of superoxide dismutase 1 (SOD1) mRNA to reduce the synthesis of SOD1 protein. Tofersen can be used for the research of amyotrophic lateral sclerosis (ALS) .
|
-
- HY-21997
-
|
|
Nucleoside Phosphoramidites
|
Dmt-2'fluoro-da(bz) amidite, an uniformly modified 2'-deoxy-2'-fluoro phosphorothioate oligonucleotide, is a nuclease-resistant antisense compound with high affinity and specificity for RNA targets. Dmt-2'fluoro-da(bz) amidite is also an intermediate for 5’-DMT-3’-phosphoramidite synthesis .
|
-
- HY-132586
-
NS-065/NCNP-01
|
|
Antisense Oligonucleotides
|
Viltolarsen (NS-065/NCNP-01) is a phosphorodiamidate morpholino antisense oligonucleotide. Viltolarsen binds to exon 53 of the dystrophin mRNA precursor and restores the amino acid open-reading frame by skipping exon 53, resulting in the production of a shortened dystrophin protein that contains essential functional portions. Viltolarsen has the potential for Duchenne muscular dystrophy (DMD) research .
|
-
- HY-147410
-
ION-363
|
|
Antisense Oligonucleotides
|
Ulefnersen (ION363) is an Antisense Oligonucleotide (ASO) directed against the 6th intron of the fused-in sarcoma (FUS) transcript to silence FUS in a non-allele-specific manner. Ulefnersen can reduce postnatal levels of FUS protein in the brain and spinal cord in disease-relevant mouse model of ALS-FUS , delaying motor neuron degeneration. Ulefnersen can be used in the research of Amyotrophic Lateral Sclerosis (ALS) .
|
-
- HY-147410A
-
ION-363 sodium
|
|
Antisense Oligonucleotides
|
Ulefnersen sodium (ION363) is an Antisense Oligonucleotide (ASO) directed against the 6th intron of the fused-in sarcoma (FUS) transcript to silence FUS in a non-allele-specific manner. Ulefnersen sodium can reduce postnatal levels of FUS protein in the brain and spinal cord in disease-relevant mouse model of ALS-FUS , delaying motor neuron degeneration. Ulefnersen sodium can be used in the research of Amyotrophic Lateral Sclerosis (ALS) .
|
-
- HY-132586A
-
NS-065/NCNP-01 sodium
|
|
Antisense Oligonucleotides
|
Viltolarsen (NS-065/NCNP-01) sodium is a phosphorodiamidate morpholino antisense oligonucleotide. Viltolarsen sodium binds to exon 53 of the dystrophin mRNA precursor and restores the amino acid open-reading frame by skipping exon 53, resulting in the production of a shortened dystrophin protein that contains essential functional portions. Viltolarsen sodium has the potential for Duchenne muscular dystrophy (DMD) research .
|
-
- HY-148089
-
|
|
Antisense Oligonucleotides
|
Eplontersen is a triantennary N-acetyl galactosamine (GalNAc3-7a)-conjugated antisense oligonucleotide targeting transthyretin (TTR) mRNA to inhibit production of both variant and wild-type TTR protein. Misfolded TTR induces amyloid fibrils formation in the heart and peripheral nerves, leads to amyloid TTR (ATTR) amyloidosis diseases .
|
-
- HY-148089A
-
|
|
Antisense Oligonucleotides
|
Eplontersen sodium is a triantennary N-acetyl galactosamine (GalNAc3-7a)-conjugated antisense oligonucleotide targeting transthyretin (TTR) mRNA to inhibit production of both variant and wild-type TTR protein. Misfolded TTR induces amyloid fibrils formation in the heart and peripheral nerves, leads to amyloid TTR (ATTR) amyloidosis diseases .
|
-
- HY-112974
-
GSK-2998728; ISIS-420915
|
|
Antisense Oligonucleotides
|
Inotersen is an antisense oligonucleotide that inhibits hepatic production of transthyretin (TTR).
|
-
- HY-139788
-
ION-957943 free acid; BAY-3563450; IONIS-FXI-LRx
|
|
Antisense Oligonucleotides
|
Fesomersen is an antisense oligonucleotide designed to inhibit the production of Factor XI.
|
-
- HY-139788A
-
ION-957943; BAY-2976217; IONIS-FXI-LRx sodium
|
|
Antisense Oligonucleotides
|
Fesomersen (sodium) is an antisense oligonucleotide designed to inhibit the production of Factor XI.
|
-
- HY-W570885
-
-
- HY-W591449
-
|
|
Pegylated Lipids
|
DOPE-PEG-Azide, MW 2000 is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-153481
-
-
- HY-153481A
-
ISIS-107248 sodium
|
|
Antisense Oligonucleotides
|
ATL 1102 sodium is a novel second-generation antisense oligonucleotide to CD49d mRNA
|
-
- HY-153488
-
-
- HY-153488A
-
-
- HY-149906C
-
GEM91 sodium
|
|
Antisense Oligonucleotides
|
Trecovirsen sodium is a 25-mer antisense phosphorothioate oligonucleotide targeted at the gag site of the HIV gene.
|
-
- HY-149906
-
GEM91
|
|
Antisense Oligonucleotides
|
Trecovirsen (GEM91) is a 25-mer antisense phosphorothioate oligonucleotide targeted at the gag site of the HIV gene.
|
-
- HY-153324
-
|
|
Antisense Oligonucleotides
|
PS220 (sodium) is an antisense RNA oligonucleotides. PS220 (sodium) can be used for research of treating muscular dystrophy .
|
-
- HY-153495
-
BP1001
|
|
Antisense Oligonucleotides
|
Prexigebersen is an antisense oligonucleotide designed to inhibit protein synthesis of Grb2 (growth factor receptor bound protein 2).
|
-
- HY-153495A
-
BP1001 sodium
|
|
Antisense Oligonucleotides
|
Prexigebersen sodium is an antisense oligonucleotide designed to inhibit protein synthesis of Grb2 (growth factor receptor bound protein 2).
|
-
- HY-143230
-
OGX-011
|
|
Antisense Oligonucleotides
|
Custirsen is a highly specific antisense oligonucleotide that inhibits the production of clusterin , an antiapoptotic protein that is upregulated in response to chemotherapy and that confers treatment resistance.
|
- HY-145725
-
IONIS 598769 sodium; ISIS 598769 sodium
|
|
Antisense Oligonucleotides
|
Baliforsen (sodium) is an antisense oligonucleotide (16 nucleotides) designed to target myotonic dystrophy protein kinase (DMPK) mRNA and research myotonic dystrophy.
|
- HY-145725A
-
ISIS 598769; IONIS 598769; BIIB 065; ISIS-DMPK-2.5Rx
|
|
Antisense Oligonucleotides
|
Baliforsen is an antisense oligonucleotide (16 nucleotides) designed to target myotonic dystrophy protein kinase (DMPK) mRNA and research myotonic dystrophy.
|
- HY-143230A
-
OGX-011 sodium
|
|
Antisense Oligonucleotides
|
Custirsen sodium is a highly specific antisense oligonucleotide that inhibits the production of clusterin , an antiapoptotic protein that is upregulated in response to chemotherapy and that confers treatment resistance.
|
- HY-P3392A
-
ION373 sodium
|
|
Antisense Oligonucleotides
|
Zilganersen sodium is a glial fibrillary acidic protein (GFAP) inhibitor. Zilganersen sodium can be used in Alexander disease (AxD) research .
|
- HY-153479
-
|
|
Antisense Oligonucleotides
|
Aganirsen is a 25 mer DNA antisense oligonucleotide, which silences expression of insulin receptor substrate-1 (IRS-1).
|
- HY-153479A
-
|
|
Antisense Oligonucleotides
|
Aganirsen sodium is a 25 mer DNA antisense oligonucleotide, which silences expression of insulin receptor substrate-1 (IRS-1).
|
- HY-145727A
-
ISIS 304801 sodium
|
|
Antisense Oligonucleotides
|
Volanesorsen sodium is an antisense oligonucleotide thay targes Apolipoprotein C-III (APOC3)
mRNA. Volanesorsen sodium is used for the study of familial chylomicronemia syndrome.
|
- HY-149906A
-
FITC-GEM91 sodium
|
|
Antisense Oligonucleotides
|
FITC-Trecovirsen (sodium) is a FITC labeled Trecovirsen. Trecovirsen is a 25-mer antisense phosphorothioate oligonucleotide targeted at the gag site of the HIV gene .
|
- HY-145722A
-
OGX-427
|
|
Antisense Oligonucleotides
|
Apatorsen is an antisense oligonucleotide designed to bind to Hsp27 mRNA, resulting in the inhibition of the production of Hsp27 protein.
|
- HY-145726
-
|
|
Antisense Oligonucleotides
|
ISIS 104838 is an antisense oligonucleotide agent that reduces the production of tumor necrosis factor (TNF-alpha), a substance that contributes to joint pain and swelling in rheumatoid arthritis.
|
- HY-145726A
-
|
|
Antisense Oligonucleotides
|
ISIS 104838 sodium is an antisense oligonucleotide agent that reduces the production of tumor necrosis factor (TNF-alpha), a substance that contributes to joint pain and swelling in rheumatoid arthritis.
|
- HY-145722
-
OGX-427 sodium
|
|
Antisense Oligonucleotides
|
Apatorsen (sodium) is an antisense oligonucleotide designed to bind to Hsp27 mRNA, resulting in the inhibition of the production of Hsp27 protein.
|
- HY-153497
-
IONIS ANGPT-L3Rx; ISIS 703802
|
|
Antisense Oligonucleotides
|
Vupanorsen is an N-acetyl galactosamine-conjugated antisense oligonucleotide that inhibits Angiopoietin-like 3 (ANGPTL3) protein synthesis. Vupanorsen lowers triglycerides and atherogenic lipoproteins.
|
- HY-153497A
-
IONIS ANGPT-L3Rx sodium; ISIS 703802 sodium
|
|
Antisense Oligonucleotides
|
Vupanorsen (sodium) is an N-acetyl galactosamine-conjugated antisense oligonucleotide that inhibits Angiopoietin-like 3 (ANGPTL3) protein synthesis. Vupanorsen (sodium) lowers triglycerides and atherogenic lipoproteins.
|
- HY-158823
-
|
|
Antisense Oligonucleotides
|
GTI-2501, an antisense oligonucleotide targeting R1, the large subunit of human ribonucleotide reductase, shows potent anti-tumor activity against a variety of tumors
|
- HY-158823A
-
|
|
Antisense Oligonucleotides
|
GTI-2501 sodium, an antisense oligonucleotide targeting R1, the large subunit of human ribonucleotide reductase, shows potent anti-tumor activity against a variety of tumors
|
- HY-112754A
-
1,2-Dioleoyl-3-trimethylammonium-propane chloride
|
|
Cationic Lipids
|
DOTAP chloride is a useful and effective cationic lipid for transient and stable transfection DNA (plasmids, bacmids) and modified nucleic acids (antisense oligonucleotides) with out the use of helper lipid .
|
- HY-112980
-
|
|
Antisense Oligonucleotides
|
Nusinersen is an antisense oligonucleotide agent that modifies pre–messenger RNA splicing of the SMN2 gene and thus promotes increased production of full-length SMN protein .
|
- HY-145728
-
ISIS-2302
|
|
Antisense Oligonucleotides
|
Alicaforsen is a 20-base antisense oligonucleotide inhibiting ICAM-1 production, which is an important adhesion molecule involved in leukocyte migration and trafficking to the site of inflammation.
|
- HY-139787
-
ISIS-721744 free acid; IONIS-PKK-LRX free acid
|
|
Antisense Oligonucleotides
|
Donidalorsen is an antisense oligonucleotide designed to reduce the production of prekallikrein (PKK). PKK plays an important role in the activation of inflammatory mediators associated with acute attacks of Hereditary angioedema (HAE).
|
- HY-139787A
-
ISIS-721744; IONIS-PKK-LRX
|
|
Antisense Oligonucleotides
|
Donidalorsen (sodium) is an antisense oligonucleotide designed to reduce the production of prekallikrein (PKK). PKK plays an important role in the activation of inflammatory mediators associated with acute attacks of Hereditary angioedema (HAE).
|
- HY-145728A
-
ISIS-2302 sodium
|
|
Antisense Oligonucleotides
|
Alicaforsen sodium is a 20-base antisense oligonucleotide inhibiting ICAM-1 production, which is an important adhesion molecule involved in leukocyte migration and trafficking to the site of inflammation.
|
- HY-112980A
-
|
|
Antisense Oligonucleotides
|
Nusinersen sodium is an antisense oligonucleotide agent that modifies pre–messenger RNA splicing of the SMN2 gene and thus promotes increased production of full-length SMN protein .
|
- HY-158826
-
RO 707179
|
|
Antisense Oligonucleotides
|
EZN-2968 is an antisense oligonucleotide that specifically binds and inhibits the expression of HIF-1α mRNA. EZN-2968, inhibits tumor cell growth.
|
- HY-158826A
-
|
|
Antisense Oligonucleotides
|
EZN-2968 sodium is an antisense oligonucleotide that specifically binds and inhibits the expression of HIF-1α mRNA. EZN-2968 sodium, inhibits tumor cell growth.
|
- HY-145724
-
Kyndrisa; GSK2402968A; PRO051
|
|
Antisense Oligonucleotides
|
Drisapersen, a antisense oligonucleotide, induces exon 51 skipping during dystrophin pre-mRNA splicing and allows synthesis of partially functional dystrophin in Duchenne muscular dystrophy (DMD) patients with amenable mutations.
|
- HY-153489A
-
ISIS-CRPRx sodium
|
|
Antisense Oligonucleotides
|
ISIS 329993 sodium is an antisense oligonucleotide targeting to C-reactive protein (CRP). ISIS-CRPRx sodium has been tested in a rodent model of rheumatoid arthritis (RA) and was shown to improve the clinical signs of arthritis
|
- HY-132585A
-
Vesleteplirsen sodium
|
|
Antisense Oligonucleotides
|
SRP-5051 sodium is a next-generation antisense oligonucleotide of peptide phosphorodiamidate morpholino oligomer (PPMO). SRP-5051 targeting exon 51 skipping in Duchenne muscular dystrophy (DMD) .
|
- HY-148410A
-
STK-001 sodium
|
|
Antisense Oligonucleotides
|
Zorevunersen sodium is an antisense oligonucleotide that is intended to increase the level of productive SCN1A mRNA and consequently increase the expression of the sodium channel Nav1.1 protein. Zorevunersen sodium is used for the study of Dravet syndrome.
|
- HY-145724A
-
Kyndrisa sodium; GSK2402968A sodium; PRO051 sodium
|
|
Antisense Oligonucleotides
|
Drisapersen sodium, a antisense oligonucleotide, induces exon 51 skipping during dystrophin pre-mRNA splicing and allows synthesis of partially functional dystrophin in Duchenne muscular dystrophy (DMD) patients with amenable mutations.
|
- HY-153489
-
ISIS-CRPRx
|
|
Antisense Oligonucleotides
|
ISIS 329993 (ISIS-CRPRx) is an antisense oligonucleotide targeting to C-reactive protein (CRP). ISIS-CRPRx has been tested in a rodent model of rheumatoid arthritis (RA) and was shown to improve the clinical signs of arthritis
|
- HY-108764
-
ISIS 301012
|
|
Antisense Oligonucleotides
|
Mipomersen sodium (ISIS 301012) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has anti-HCV effect and reduces the infectivity of the HCV. Mipomersen sodium can be used for the research of homozygous familial hypercholesterolemia (HoFH) .
|
- HY-148410
-
STK-001
|
|
Antisense Oligonucleotides
|
Zorevunersen (STK-001) is an antisense oligonucleotide that is intended to increase the level of productive SCN1A mRNA and consequently increase the expression of the sodium channel Nav1.1 protein. Zorevunersen is used for the study of Dravet syndrome.
|
- HY-153496
-
QR 110
|
|
Antisense Oligonucleotides
|
Sepofarsen (QR-110) is an RNA antisense oligonucleotide targeting to the p.Cys998X mutation (also known as the c.2991+1655A>G mutation) in the CEP290 gene.
|
- HY-132582A
-
|
|
Antisense Oligonucleotides
|
Tau ASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (Tau ASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )
|
- HY-153496A
-
QR 110 sodium
|
|
Antisense Oligonucleotides
|
Sepofarsen (QR-110) sodium is an RNA antisense oligonucleotide targeting to the p.Cys998X mutation (also known as the c.2991+1655A>G mutation) in the CEP290 gene.
|
- HY-158825
-
CIVI007 sodium
|
|
Antisense Oligonucleotides
|
Cepadacursen sodium is a liver-targeting antisense oligonucleotide (ASO), inhibits proprotein convertase subtilisin/kexin type 9 (PCSK9) protein synthesis. Cepadacursen sodium can be used for hypercholesterolemia treatment and the prevention of atherosclerotic cardiovascular disease (ASCVD).
|
- HY-153491
-
ISIS 678354; IONIS-APOCIII-LRx; AKCEA-APOCIII-LRx
|
|
Antisense Oligonucleotides
|
Olezarsen is an N-acetyl-galactosamine-conjugated antisense oligonucleotide targeted to hepatic APOC3 mRNA to inhibit apolipoprotein C-III (apoC-III) production, in lowering triglyceride levels in patients at high risk for or with established cardiovascular disease.
|
- HY-153491A
-
ISIS 678354 sodium; IONIS-APOCIII-LRx sodium; AKCEA-APOCIII-LRx sodium
|
|
Antisense Oligonucleotides
|
Olezarsen sodium is an N-acetyl-galactosamine-conjugated antisense oligonucleotide targeted to hepatic APOC3 mRNA to inhibit apolipoprotein C-III (apoC-III) production, in lowering triglyceride levels in patients at high risk for or with established cardiovascular disease.
|
- HY-148370A
-
RG6299 sodium
|
|
Antisense Oligonucleotides
|
IONIS-FB-LRx sodium is a specific antisense oligonucleotide (ASO) targeting complement factor B (CFB). IONIS-FB-LRx sodium effectively reduces circulating levels of CFB, and can be used for geographic atrophy (GA) research .
|
- HY-145728B
-
(R/S)-ISIS-2302
|
|
Antisense Oligonucleotides
|
(R/S)-Alicaforsen is the racemate of Alicaforsen composed of R and S configurations. Alicaforsen is a 20-base antisense oligonucleotide inhibiting ICAM-1 production, which is an important adhesion molecule involved in leukocyte migration and trafficking to the site of inflammation.
|
- HY-158821
-
|
|
Antisense Oligonucleotides
|
ISTH0036, an antisense oligonucleotide selectively targeting transforming growth factor beta 2 (TGF-β2), can be use in the study of primary open angle glaucoma (POAG), and wet age-related macular degeneration.
|
- HY-158821A
-
|
|
Antisense Oligonucleotides
|
ISTH0036 sodium, an antisense oligonucleotide selectively targeting transforming growth factor beta 2 (TGF-β2), can be use in the study of primary open angle glaucoma (POAG) , and wet age-related macular degeneration.
|
- HY-148413
-
ISIS 3521 sodium
|
|
Antisense Oligonucleotides
|
Aprinocarsen (ISIS 3521) sodium, a specific antisense oligonucleotide inhibitor of protein kinase C-alpha (PKC-α). Aprinocarsen sodium is a 20-mer oligonucleotide, it regulates cell differentiation and proliferation. Aprinocarsen sodium inhibits the growth of human tumor cell lines in nude mice. Aprinocarsen sodium shows the value as a chemotherapeutic compound of human cancers .
|
- HY-145729
-
AZD9150
|
|
Antisense Oligonucleotides
|
Danvatirsen is an antisense oligonucleotide targeting STAT3 with potential antitumor activity. Danvatirsen binds to STAT3 mRNA, thereby inhibiting translation of the transcript. Suppression of STAT3 expression induces tumor cell apoptosis and decreases tumor cell growth.
|
- HY-148505
-
|
|
Nucleoside Phosphoramidites
|
5'-ODMT cEt N-Bzm5 C Phosphoramidite Amidite is a potent nucleic acid analog. 5'-ODMT cEt N-Bzm5 C Phosphoramidite Amidite blongs to modified antisense oligonucleotide .
|
- HY-150237
-
|
|
Antisense Oligonucleotides
|
FITC-labeled Drisapersen (sodium) is Drisapersen labeled with FITC. Drisapersen, a antisense oligonucleotide, induces exon 51 skipping during dystrophin pre-mRNA splicing and allows synthesis of partially functional dystrophin in Duchenne muscular dystrophy (DMD) patients with amenable mutations.
|
- HY-145729A
-
AZD9150 sodium
|
|
Antisense Oligonucleotides
|
Danvatirsen sodium is an antisense oligonucleotide targeting STAT3 with potential antitumor activity. Danvatirsen sodium binds to STAT3 mRNA, thereby inhibiting translation of the transcript. Suppression of STAT3 expression induces tumor cell apoptosis and decreases tumor cell growth.
|
- HY-112754A1
-
1,2-Dioleoyl-3-trimethylammonium-propane chloride (Excipient)
|
|
Emulsifiers
Liposomal Film-forming Agents
|
DOTAP chloride Excipient is a cationic lipid with good membrane fusion ability and biocompatibility. DOTAP chloride Excipient can be used as an excipient for transient and stable transfection DNA (plasmids, bacmids) and modified nucleic acids (antisense oligonucleotides) without the use of helper lipid .
|
- HY-147217
-
ISIS 505358
|
|
Antisense Oligonucleotides
|
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
|
- HY-148370
-
RG6299
|
|
Antisense Oligonucleotides
|
IONIS-FB-LRx is a specific antisense oligonucleotide (ASO) targeting complement factor B (CFB). IONIS-FB-LRx effectively reduces circulating levels of CFB. IONIS-FB-LRx can be used for geographic atrophy (GA) research .
|
- HY-145727
-
ISIS 304801
|
|
Antisense Oligonucleotides
|
Volanesorsen (ISIS 304801) is an antisense oligonucleotide inhibitor of apolipoprotein CIII (apo-CIII) mRNA that reduces triglyceride levels and improves insulin resistance. Volanesorsen is being studied in the treatment of hypertriglyceridemia, familial chylosiderosis syndrome, and type 2 diabetes .
|
- HY-132598A
-
SPC-3649 sodium
|
|
Antisense Oligonucleotides
|
Miravirsen sodium is a potent miR-122 inhibitor and inhibits the biogenesis of miR-122. Miravirsen sodium is a 15-nucleotide locked nucleic acid-modified phosphorothioate antisense oligonucleotide. Miravirsen sodium inhibits HCV replication, and can be used in research of HCV infection .
|
- HY-158829
-
|
|
Antisense Oligonucleotides
|
SSOe26 sodium is a 15mer antisense oligonucleotide targeting?HER4. SSOe26 sodium induces exon 26 skipping, leading to the generation of a novel mRNA transcript that excludes exon 26 (CYT2 isoform). SSOe26 sodium decreases tumour growth in mouse xenografts.
|
- HY-148687
-
|
|
Antisense Oligonucleotides
|
SPC5001 is a locked nucleic acid (LNA)-modifed antisense oligonucleotide (ASO) complementary to human PCSK9 (proprotein convertase subtilisin/kexin type 9) mRNA. SPC5001 can be used for the research of hypercholesterolemia. SPC5001 sequence: 5′-TGmCTACAAAACmCmCA-3′ .
|
- HY-148827A
-
HYBO-165 sodium
|
|
Antisense Oligonucleotides
|
GEM231 sodium is an 18mer antisense oligonucleotide targeting the mRNA of the PKA-I (RIα regulatory subunit of cAMP dependent protein kinase type I ). GEM231 sodium induces cell growth arrest, apoptosis, and differentiation in a variety of cancer cell lines in vitro and in tumors in vivo.
|
- HY-148827
-
HYBO-165
|
|
Antisense Oligonucleotides
|
GEM231 is an 18mer antisense oligonucleotide targeting the mRNA of the PKA-I (RIα regulatory subunit of cAMP dependent protein kinase type I ). GEM231 induces cell growth arrest, apoptosis, and differentiation in a variety of cancer cell lines in vitro and in tumors in vivo.
|
- HY-147217A
-
ISIS 505358 sodium
|
|
Antisense Oligonucleotides
|
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .
|
- HY-148687A
-
|
|
Antisense Oligonucleotides
|
SPC5001 sodium is a locked nucleic acid (LNA)-modifed antisense oligonucleotide (ASO) complementary to human PCSK9 (proprotein convertase subtilisin/kexin type 9) mRNA. SPC5001 sodium can be used for the research of hypercholesterolemia. SPC5001 sequence: 5′-TGmCTACAAAACmCmCA-3′ .
|
- HY-158827A
-
|
|
Antisense Oligonucleotides
|
AZD8233 sodium, a liver-targeting antisense oligonucleotide (ASO), inhibits subtilisin/kexin type 9 (PCSK9) protein synthesis. AZD8233 sodium increases the available LDL receptors by reducing PCSK9 levels, thereby clearing LDL from the blood and decreasing LDL-C levels.
|
- HY-132598
-
SPC-3649
|
|
Antisense Oligonucleotides
|
Miravirsen (SPC-3649) is a potent miR-122 inhibitor and inhibits the biogenesis of miR-122. Miravirsen is a 15-nucleotide locked nucleic acid-modified phosphorothioate antisense oligonucleotide. Miravirsen inhibits HCV replication. Miravirsen can be used in research of HCV infection .
|
- HY-132584A
-
SRP-4045 sodium
|
|
Antisense Oligonucleotides
|
Casimersen sodium is an antisense oligonucleotide of the phosphorodiamidate morpholino oligomer subclass. Casimersen sodium binds to exon 45 of dystrophin pre-mRNA, restores the open-reading frame (by skipping exon 45) resulting in the production of an internally truncated but functional dystrophin protein. Casimersen sodium can be used for the research of Duchenne muscular dystrophy (DMD) .
|
- HY-158827
-
|
|
Antisense Oligonucleotides
|
AZD8233, a liver-targeting antisense oligonucleotide (ASO), inhibits proprotein convertase subtilisin/kexin type 9 (PCSK9) protein synthesis. AZD8233 increases the available LDL receptors by reducing PCSK9 levels, thereby clearing LDL from the blood and decreasing LDL-C levels.
|
- HY-153485A
-
ISIS 766720 sodium; IONIS-GHR-LRx sodium
|
|
Antisense Oligonucleotides
|
Cimdelirsen is a novel, ligand-conjugated, hepatic-targeted investigative antisense oligonucleotide designed to reduce growth hormone receptor (GHr) synthesis, thereby inhibiting deleterious effects of growth hormone (GH) hypersecretion and reducing circulating insulin-like growth factor-1 (IGF-1) levels in acromegaly patients.
|
- HY-153485
-
ISIS 766720; IONIS-GHR-LRx
|
|
Antisense Oligonucleotides
|
Cimdelirsen is a novel, ligand-conjugated, hepatic-targeted investigative antisense oligonucleotide designed to reduce growth hormone receptor (GHr) synthesis, thereby inhibiting deleterious effects of growth hormone (GH) hypersecretion and reducing circulating insulin-like growth factor-1 (IGF-1) levels in acromegaly patients.
|
- HY-148130A
-
RG6091 sodium; RO7248824 sodium
|
|
Antisense Oligonucleotides
|
Rugonersen sodium is a locked-nucleic acid (LNA)- modified antisense oligonucleotides (ASOs), and results in reduction of ubiquitin-protein ligase E3A (UBE3A) silencing. Angelman syndrome (AS) sodium is a severe neurodevelopmental disorder caused by the loss of neuronal E3 ligase UBE3A, Rugonersen has been used for AS reasearch .
|
- HY-153734
-
|
|
Antisense Oligonucleotides
|
Inactive ASO (in vivo) sodium is an inactive Antisense Oligonucleotide. ASO is a class of oligonucleotide molecules, usually composed of 20-30 bases, used to interfere with or regulate gene expression. Inactive ASO (in vivo) sodium is not targeted in the rodent genome and can be used as a negative control for Tofersen. Inactive ASO (in vivo) sodium contains thiophosphate skeleton modification and MOE modification. Cytosine in Inactive ASO (in vivo) is 5' methylcytosine. See References for the location of chemical modifications
|
- HY-132584
-
SRP-4045
|
|
Antisense Oligonucleotides
|
Casimersen (SRP-4045) is an antisense oligonucleotide of the phosphorodiamidate morpholino oligomer subclass. Casimersen binds to exon 45 of dystrophin pre-mRNA, restores the open-reading frame (by skipping exon 45) resulting in the production of an internally truncated but functional dystrophin protein. Casimersen can be used for the research of Duchenne muscular dystrophy (DMD) .
|
- HY-148130
-
RG6091; RO7248824
|
|
Antisense Oligonucleotides
|
Rugonersen (RG6091; RO7248824) is a locked-nucleic acid (LNA)- modified antisense oligonucleotides (ASOs), and results in reduction of ubiquitin-protein ligase E3A (UBE3A) silencing. Angelman syndrome (AS) is a severe neurodevelopmental disorder caused by the loss of neuronal E3 ligase UBE3A, Rugonersen has been used for AS reasearch .
|
- HY-150236
-
|
|
Antisense Oligonucleotides
|
FITC-labeled Tominersen (sodium) is the Tominersen labeled with FITC. Tominersen (RG6042) is a second-generation 2′-O-(2-methoxyethyl) antisense oligonucleotide that targets huntingtin protein (HTT) mRNA and potently suppresses HTT production. Tominersen improves survival and reduces brain atrophy in mice. Tominersen can be used for the research of Huntington’s disease (HD).
|
- HY-138577
-
|
|
Nucleoside Phosphoramidites
|
2'-F-Bz-dC Phosphoramidite can be used in the synthesis of oligoribonucleotide (such as DNA and RNA). 2'-F-Bz-dC Phosphoramidite also used for synthesis antiviral agent to inhibit the replication of virus. 2'-F-Bz-dC Phosphoramidite contains a phosphorothioate backbone, to synthesise antisense oligonucleotide analogs to induce apoptosis in cancer cells .
|
- HY-158828
-
|
|
Antisense Oligonucleotides
|
SSO111 sodium, a 20mer fully modified antisense oligonucleotide, targets the oncogene?HER2. SSO111 sodium induces exon 15 skipping during splicing, leading to the generation of a novel mRNA transcript that excludes exon 15. SSO111 sodium downregulated HER2 mRNA, which resulted in the inhibition of proliferation and induction of apoptosis in HER2-overexpressing tumor cells.
|
- HY-158830
-
|
|
Antisense Oligonucleotides
|
MDM4-targeting ASO sodium is a 25mer antisense oligonucleotide targeting?MDM4. MDM4-targeting ASO sodium induced exon 6 skipping, leading to nonsense-mediated decay of the mRNA transcript that excludes exon-6. In multiple human melanoma cell lines and in melanoma patient-derived xenograft (PDX) mouse models, MDM4-targeting ASO-mediated skipping of exon 6 decreased MDM4 abundance, inhibited melanoma growth, and enhanced sensitivity to MAPK-targeting therapeutics.
|
- HY-157678
-
|
|
Phospholipids
|
1,2-Dilinoleoyl-sn-glycero-3-phospho-L-serine sodium is a lipid compound that can be used for liposome preparation. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble loads can be captured in the internal aqueous space of liposomes, while lipophilic loads can be distributed into the lipid bilayer and become part of the lipid bilayer. Especially for the delivery of antisense oligonucleotides, it can overcome the problems of inefficient cellular uptake and rapid loss in the body.
|
- HY-157624
-
18:0-22:6 PE
|
|
Phospholipids
|
1-Stearoyl-2-docosahexaenoyl-sn-glycero-3-phosphoethanolamine (18:0-22:6 PE) is a lipid compound that can be used for liposome preparation. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble loads can be captured in the internal aqueous space of liposomes, while lipophilic loads can be distributed into the lipid bilayer and become part of the lipid bilayer. Especially for the delivery of antisense oligonucleotides, it can overcome the problems of inefficient cellular uptake and rapid loss in the body.
|
- HY-W440752
-
|
|
Cationic Lipids
|
BP Lipid 113 is an ionizable lipid analogous to SM-102. It can be used to prepare liposome or lipid nanoparticles.
|
- HY-W800749
-
|
|
Cationic Lipids
|
BP Lipid 223 is an pentanolamine lipid (Compound 7) from patent WO2017075531A with both ester bonds located adjacent to C6 relative to the amine head. The introduction of ester linkages can improve the clearance of the lipid in the liver. This compound is analgous to ALC-0315. The lipid can be used to prepare mRNA nanocarriers with good balance of delivery efficiency and pharmakokinetics as well as rapid lipid clearance profile.
|
- HY-W800786
-
N-MCC-PE
|
|
Phospholipids
|
16:0 PE MCC is a maleimide-functionalized thiol-reactive lipid with a phosphoethanolamine linked to two palmitic acid tails and a maleimide group.
|
- HY-W440711
-
|
|
Pegylated Lipids
|
Cholesterol-PEG-Biotin (MW 2000) is a pegylated lipids which has strong binding to avidin or streptavidin.
|
- HY-W800734
-
MPPC; PC(14:0/16:0)
|
|
Phospholipids
|
1-Myristoyl-2-palmitoyl-sn-glycero-3-phosphocholine (MPPC) is an asymmetrical phosphatidylcholine containing a myristic acid (14:0) at the sn-1 position and a palmitic acid (16:0) at the sn-2 position. It is commonly used in the generation of micelles, liposomes, and other types of artificial membranes.
|
- HY-W800777
-
|
|
Cationic Lipids
|
6-(3-Hydroxypropylamino)hexyl 2-hexyldecanoate is an ionizable lipid which can be used to make ALC-0315. The lipid has an ester bond adjacent to C6 relative to the amine nitrogen. The introduction of ester linkages can improve the clearance of the lipid in the liver.
|
- HY-W800785
-
1-palMitoyl-2-(10,12-tricosadiynoyl)-sn-glycero-3-phosphocholine
|
|
Phospholipids
|
16:0-23:2 Diyne PC is a phospholipase-mediated hydrolyzed phosphocoline with palmitic acid (16:0) and Pentacosa-10,12-diynoic acid for tails.
|
- HY-W440706
-
|
|
Pegylated Lipids
|
Cholesterol-PEG-alcohol (MW 2000) is a pegylated lipids which can be used for preparation of liposome or nanoparticle. The lipophilic moiety can encapsulate hydrophobic drugs whereas the hydrophilic PEG chain helps the overal water solubility of the micelles. The amine can react with an activated NHS ester to form a stable amide bond.
|
- HY-W800787
-
|
|
Phospholipids
|
18:1 PE MCC is a maleimide-functionalized thiol-reactive lipid with a phosphoethanolamine linked to two oleic acid tails and a maleimide group.
|
- HY-W440719
-
|
|
Pegylated Lipids
|
Cholesterol-PEG-MAL (MW 2000) is a PEG derivative and can be used to prepare liposome or nanoparticle due to its ability to self-assemble in water. The maleimide moiety is reactive with thiol molecule to form a covalent thioether bond.
|
- HY-W339838
-
14:0 Lyso PG
|
|
Phospholipids
|
1-Myristoyl-2-hydroxy-sn-glycero-3-PG sodium is a lysophospholipid containing myristic acid (14:0) at the sn-1 position. It has been used in the generation of micelles, liposomes, and other types of artificial membranes, including lipid-based drug carrier systems.
|
- HY-141615
-
PDME; 16:0 Dimethyl PE
|
|
Phospholipids
|
1,2-Dipalmitoyl-sn-glycero-3-phospho-N,N-dimethylethanolamine has been used in the generation of liposomes and monolayers for use in the study of membrane permeability and monolayer viscosity, respectively.
|
- HY-W440748
-
|
|
Cationic Lipids
|
BP Lipid 109 is an amine lipid which has long (11 carbons) lipid tail on the primary ester. Both esters are located at C7 position and the head contains ethanolamine. It can be used to prepare liposome or lipid nanoparticles.
|
- HY-W140488
-
10:0 PE
|
|
Phospholipids
|
1,2-Didecanoyl-sn-glycero-3-phosphoethanolamine, a phospholipid, showes very promising P-gp inhibitory results at a concentration of 0.3 mM.
|
- HY-W440694
-
|
|
Pegylated Lipids
|
Cholesterol-PEG-Azide (MW 2000) is a pegylated lipids which can be used for preparation of liposome or nanoparticle. The lipophilic moiety can encapsulate hydrophobic drugs whereas the hydrophilic PEG chain helps the overal water solubility of the micelles. Cholesterol-PEG-Azide (MW 2000) can be reacted with alkyne via CuAAC or SPAAC click chemistry.
|
- HY-W800737
-
|
|
Cationic Lipids
|
BP Lipid 126 is an amino ionizable lipid (Compound 143) from patent WO2017201333A1 with ester bonds located at C8 and C7 position relative to nitrogen. The ester linkages are introduced to improve tissue clearance. The ethanolamine head can effectively enhance mRNA encapsulation. BP Lipid 126 can be used in the generation of liposomes.
|
- HY-W343736
-
1,3-DPPE; 1,3-Dipalmitoyl-sn-glycero-2-PE
|
|
Phospholipids
|
1,3-Dipalmitoyl-glycero-2-phosphoethanolamine is a phospholipid containing the saturated long-chain (16:0) stearic acid inserted at the sn-1 and sn-3 positions and PE at the sn-2 site. It can be used in the generation of micelles, liposomes, and other types of artificial membranes.
|
- HY-W800784
-
|
|
Phospholipids
|
23:2 Diyne PE [DC(8,9)PE] is a phospholipase-mediated hydrolyzed phosphocoline with palmitic acid (16:0) and Pentacosa-10,12-diynoic acid for tails.
|
- HY-W440690
-
|
|
Pegylated Lipids
|
Cholesterol-PEG-Amine (MW 2000) is a pegylated lipids which can be used for preparation of liposome or nanoparticle. The lipophilic moiety can encapsulate hydrophobic drugs whereas the hydrophilic PEG chain helps the overal water solubility of the micelles.
|
- HY-138913
-
|
|
Cholesterol
|
2H-Cho-Arg (TFA) is a steroid-based cationic lipid that contains a 2H-cholesterol skeleton coupled to an L-arginine head group and can be used to facilitate gene transfection.
|
- HY-W440698
-
|
|
Pegylated Lipids
|
Cholesterol-PEG-Acid (MW 2000) is a polydisperse PEG derivative which can be used to create liposome as drug carrier for delivering therapeutic agents into tissues.
|
- HY-W340832
-
|
|
Phospholipids
|
18:1 Biotinyl Cap PE is a fluorescent lipid, which features a head group that has been altered to include biotinyl cap PE.
|
- HY-W800778
-
|
|
Cationic Lipids
|
Bis(2-butyloctyl) 10-oxononadecanedioate is an ionizable lipid-like compound containing four hydrophobic tails bound by esters. It can be used to build lipids for mRNA encapsulation and delivery.
|
- HY-W440743
-
|
|
Cationic Lipids
|
BP Lipid 103 is an amine ionizable lipid analogous to SM-102. It can be used to prepare liposome or lipid nanoparticles.
|
- HY-W591913
-
|
|
Pegylated Lipids
|
Cholesterol-PEG-methoxy, MW 2000 is a PEG derivative which self-assembles in water to form micelle-like structure. The cholesterol tail can be used to encapsulate hydrophobic drugs while the PEG chain ehances the water solubility of the micelles.
|
- HY-115435
-
DMPS-Na; Dimyristoyl phosphatidylserine sodium
|
|
Phospholipids
|
1,2-Dimyristoyl-sn-glycero-3-phospho-L-serine sodium is an anionic phospholipid with myristic acid tails (14:0) and contains a carboxylic acid (COOH) and amine (NH2) in their head group. It has been used in the preparation of liposome.
|
- HY-134174
-
|
|
Phospholipids
|
1-Palmitoyl-2-oleoyl-sn-glycero-3-phosphate is a phospholipid containing saturated palmitic acid (16:0) and monounsaturated oleic acid (18:1) inserted at the sn-1 and sn-2 positions, respectively. It can be used in the generation of micelles, liposomes, and other types of artificial membranes.
|
- HY-W440751
-
|
|
Cationic Lipids
|
BP Lipid 112 is an amine lipid with two ester linkages at C6 and C7 position. The C6 ester has a long 11 carbons lipid tail. It can be used to prepare liposome or lipid nanoparticles.
|
- HY-W440727
-
|
|
Pegylated Lipids
|
Cholesterol-PEG-Vinylsulfone (MW 2000) is a thiol reactive polyPEG via thiol-ene reaction to form a thioether bond. It can self-assemble in water and is used to prepare liposome as drug vehicle for targeted delivery into tissues.
|
- HY-W440724
-
|
|
Pegylated Lipids
|
Cholesterol-PEG-Thiol (MW 3400) is an amphiphatic PEG derivative which forms micelles in water and can be used to prepare liposomes or nanoparticles for drug delivery system. The thiol moiety is reactive with maleimide to form a stable thioether bond.
|
- HY-W440981
-
1-Stearoyl-2-palmitoyl-sn-glycero-3-phosphocholine
|
|
Phospholipids
|
SPPC is a phospholipid with different length of fatty acid. The sn-1 position contains a stearic acid (18:0) while the sn-2 position is occupied by a palmitic acid (16:0).
|
- HY-W440803
-
|
|
Cationic Lipids
|
BP Lipid 218 is an ionizable amine lipid with two identical ester tails adjacent to C6 position relative to amine.
|
- HY-W440800
-
|
|
Cationic Lipids
|
BP Lipid 226 is an amino ionizable lipid analogous to ALC-0315. It can be used to prepare liposome or lipid nanoparticles.
|
- HY-W440820
-
|
|
Cationic Lipids
|
Bis(bis(2-carboxyethyl)aminopropyl)methylamine is a symmetrical branched linker featuring three tertiary amines and four carboxylic acids. Each carboxylic acid is open to forming esters or amides. It can be used in developing lipid nanoparticles.
|
- HY-W440766
-
|
|
Cationic Lipids
|
BP Lipid 209 is an amine lipid which has a 9-carbons lipid tail on the primary ester. Both esters are located at C8 and C10 position relative to the amine nitrogen. It can be used to prepare liposome or lipid nanoparticles.
|
- HY-W440957
-
PC(16:0/14:0); 1-palmitoyl-2-myristoyl-sn-glycero-3-phosphocholine
|
|
Phospholipids
|
PMPC is a phosphatidylcholine with asymmetrical fatty acid. Palmitic acid occupies sn-1 position while myristic acid is placed at the sn-2 position.
|
- HY-W440958
-
PSPC; PC(16:0-18:0)
|
|
Phospholipids
|
1-Palmitoyl-2-stearoyl-sn-glycero-3-phosphocholine is an assymetrical phospholipid containing saturated palmitic and stearic acid at the sn-1 and sn-2 position respectively. The phosphate group is attached to choline.
|
- HY-W440931
-
|
|
Pegylated Lipids
|
MPEG2000-DMG is a synthetic lipid comprised of polyPEG and dimyristoyl glycerol. It is used in the creation of lipid nanoparticles (LNPs) for mRNA vaccines.
|
- HY-W591461
-
|
|
Pegylated Lipids
|
DSPE-PEG-COOH, MW 2000 is a phospholipid polyPEG which can be used to prepare liposomes or nanoparticles. The terminal carboxylic acid can react with primary amine groups to form a stable amide bond.
|
- HY-W440985
-
1,2-dilauroyl-sn-glycero-3-phospho-L-serine
|
|
Phospholipids
|
DLPS is an anionic phospholipid with lauric acid tails (12:0) and contains a carboxylic acid (COOH) and amine (NH2) in their head group. It has been used in the preparation of lipid-mixing vesicles, liposome, or artificial membrane. Due to the medium size of fatty acid chain, DLPS is used to form thinner membranes/walls.
|
- HY-W440991
-
|
|
Pegylated Lipids
|
DOPE-PEG-Amine (MW 2000) is a polydisperse PEG covalently attached to a phospholipid. The polymer is an amphiphilic molecule with hydrophobic fatty acid chains and hydrophilic PEG head which enables lipid bilayer or micelle formation in water. The phospholipid PEG can be used to prepare liposome or nanoparticles for targeted drug delivery and is reactive with alkyne to form a triazole ring.
|
- HY-W440995
-
|
|
Pegylated Lipids
|
DOPE-PEG-Mal (MW 2000) is a phospholipid polyPEG which can be used to prepare liposomes or nanoparticles. It is also reactive with thiol at pH 6.5 tp 7.5 to form a stable thioether bond.
|
- HY-W441005
-
|
|
Phospholipids
|
Amino-Gly-Gly-DSPE (hydrochloride) is a specially modified phospholipid that has been used to synthesize liposomes. The terminal amine is reactive with an NHS ester compound or carboxylic acid molecule in the presence of activator, such as HATU or EDC.
|
- HY-W587499
-
|
|
Phospholipids
|
2-Arachidonoyl-sn-glycero-3-phosphocholine is a phospholipid molecule that is a major component of the plasma membrane. It is a phospholipid molecule that is involved in the regulation of membrane fluidity, signal transduction, cell-cell communication, and mediator of inflammation.
|
- HY-W590535
-
1,2-DNPC;
1,2-Dinonadecanoyl-sn-glycero-3-phosphocholine
|
|
Phospholipids
|
19:0 PC is a saturated phospholipid that has been used as a standard for the quantification of phosphatidylcholines in human synovial fluid. It has also been used to study dynamics of lipid bilayer phase transition.
|
- HY-W590536
-
1-Palmitoyl-2-Lauroyl-sn-glycero-3-Phosphatidylcholine; 1-Palmitoyl-2-Lauroyl-sn-glycero-3-Phosphocholine
|
|
Phospholipids
|
1,2-PLPC is a phospholipid containing palmitoyl (16:0) and lauryl (12:0) acyl substituents at the sn-1 and sn-2 positions, respectively. It can be used in the generation of micelles, liposomes, and other types of artificial membranes.
|
- HY-W590538
-
|
|
Cholesterol
|
HAPC-Chol is a cationic cholesterol that can be used as a component of lipoplexes complexes.
|
- HY-W590555
-
|
|
Pegylated Lipids
|
Thiol-PEG-DMG, MW 2000 is a phospholipid polyPEG which can be used to prepare liposomes or nanoparticles. The terminal thiol group reacts with maleimide, OPSS, vinylsulfone and transition metal surfaces including gold, silver, etc.
|
- HY-W590593
-
|
|
Pegylated Lipids
|
mPEG-Cholesterol,MW 2000 is a PEG derivative which self-assembles in water to form micelle-like structure. The cholesterol tail can be used to encapsulate hydrophobic drugs while the PEG chain ehances the water solubility of the micelles.
|
- HY-W591332
-
|
|
Pegylated Lipids
|
DMPE-mPEG, MW 2000 is a PEGylated 1,2-Dimyristoyl-sn-glycero-3-phosphoethanolamine (14:0 PE) compound with a methyl group at the other end of the PEG chain. The PEG polymer exhibits amphiphatic behavior and helps to form stable micelles in an aqueous solution. It can be used to prepare nanoparticles or liposomes for targeted drug delivery applications.
|
- HY-W800733
-
1,2-Dilauroyl-sn-glycero-3-phosphorylglycerol; PG(12:0/12:0)
|
|
Phospholipids
|
DLPG is a phospholipid containing lauric acid (12 chain fatty acid) inserted at the sn-1 and sn-2 positions. Its phosphate group is attached to glycerol. It is used in the generation of micelles, liposomes, and other artificial membranes.
|
- HY-W800788
-
|
|
Phospholipids
|
18:1 MPB PE is a maleimide-functionalized thiol-reactive lipid with a phosphoethanolamine linked to two oleic acid tails and a phenyl maleimide group.
|
- HY-W800789
-
|
|
Phospholipids
|
16:0 MPB PE is a maleimide-functionalized thiol-reactive lipid with a phosphoethanolamine linked to two palmitic acid tails and a phenyl maleimide group.
|
- HY-W800790
-
|
|
Phospholipids
|
18:1 Caproylamine PE is a amine-functionalized lipid with a phosphoethanolamine linked to two oleic acid tails.
|
- HY-W800791
-
|
|
Phospholipids
|
16:0 Caproylamine PE is an amide-functionalized lipid with a phosphoethanolamine linked to two palmitic acid tails.
|
- HY-W800792
-
1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-(succinyl)
|
|
Phospholipids
|
18:1 Succinyl PE is a carboxylic acid-functionalized lipid with a two carbon linker to a phosphoethanolamine bound to two oleic acid tails.
|
- HY-W800793
-
1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-(succinyl)
|
|
Phospholipids
|
16:0 Succinyl PE is a carboxylic acid-functionalized lipid with a two carbon linker to a phosphoethanolamine bound to two palmitic acid tails.
|
- HY-W800794
-
DPPE-NG; 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-(glutaryl)
|
|
Phospholipids
|
16:0 Glutaryl PE is is a carboxylic acid-functionalized lipid with a three carbon linker to a phosphoethanolamine bound to two palmitic acid tails.
|
- HY-W800795
-
DOPE-NG; 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-(dodecanoyl)
|
|
Phospholipids
|
18:1 Dodecanyl PE is a carboxylic acid-functionalized lipid with a ten carbon linker to a phosphoethanolamine bound to two oleic acid tails.
|
- HY-W800796
-
1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-(biotinyl)
|
|
Phospholipids
|
18:1 Biotinyl PE is a biotin-functionalized lipid attached to a phosphoethanolamine linked to two oleic acid groups.
|
- HY-W800797
-
1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-(biotinyl)
|
|
Phospholipids
|
16:0 Biotinyl PE is a biotin-functionalized lipid attached to a phosphoethanolamine linked to two palmitic acid groups.
|
- HY-W800798
-
1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-(cyanur)
|
|
Phospholipids
|
16:0 Cyanur PE is a cyanur-functionalized lipid attached to a phosphoethanolamine linked to two palmitic acid groups.
|
- HY-W800802
-
|
|
Cationic Lipids
|
BP Lipid 227 is an ionizable lipid. It has primary esters at C5 position relative to the amine nitrogen. The primary lipid tail has an 8 carbon tail. BP Lipid 227 can be used in the generation of liposomes.
|
- HY-W800805
-
|
|
Phospholipids
|
DOPE-Mal is a synthetic analog of naturally-occurring PE containing 18:1 fatty acids at the sn-1 and sn-2 positions with a terminal maliemide group. The maleimide group will react with a thiol group to form a covalent bond. The hydrophilic PEG spacer increases solubility in aqueous media.
|
- HY-W800812
-
|
|
Cationic Lipids
|
BP Lipid 308 has a terminal tertiary amine group, a linoleic group, and a 4,4-bis(octyloxy)butanoic acid sodium salt tail. This compound can be useful for the building or modification of lipid nanoparticles.
|
- HY-W800825
-
|
|
Cationic Lipids
|
Octadecanedioic Acid Mono-L-carnitine ester is a cationic lipid which may be used in combination with other lipids in the formation of lipid nanoparticles (LNPs). Its terminal carboxylic acid can react with primary amine groups in the presence of activators (e.g. HATU) to form a stable amide bond.
|
- HY-W800827
-
|
|
Cationic Lipids
|
BP Lipid 229 is an amino ionizable lipid. It has primary esters at C7 position relative to the amine nitrogen. The primary lipid tail has 8 carbon tail. BP Lipid 229 can be used in the generation of liposomes.
|
- HY-W800841
-
|
|
Cationic Lipids
|
BP Lipid 314 is an ionizable amino lipid featuring a dimethylamino head group, a carbamate linking to a central tertiary carbon with two other branches, a linoleate ester, and an aliphatic acetal ester.
|
- HY-W800843
-
|
|
Cationic Lipids
|
tert-Butyl 3-(7-((undecan-3-yloxy)carbonyl)heptylamino)propylcarbamate is an aminolipid featuring a Boc-protected primary amine, a propylamine spacer attached to an octanoate chain and a C11 chain.
|
- HY-W800849
-
|
|
Cationic Lipids
|
BP Lipid 315 is a cationic ionizable lipid ALC-0315 analogue featuring a Boc-protected primary amine, a central tertiary amine, and two ester tails located at the C8 position relative to the amine. One of these esters features a symmetrical branched C17 tail, while the other is an asymmetric C11 tail.
|
Your information is safe with us. * Required Fields.
Inquiry Information
- Product Name:
- Cat. No.:
- Quantity:
- MCE Japan Authorized Agent: