From 11:00 pm to 12:00 pm EST ( 8:00 pm to 9:00 pm PST ) on January 6th, the website will be under maintenance. We are sorry for the inconvenience. Please arrange your schedule properly.
IONIS-MAPTRx sodium is the first Tau-lowering antisense oligonucleotide (ASO). IONIS-MAPTRx sodium has the potential for the research of Alzheimer Disease .
Rovanersen sodium is an antisense oligonucleotide that specifically targets mutated mRNA copies of the huntington (HTT) gene without affecting healthy mRNA of HTT gene, thereby preventing the production of faulty Huntingtin protein. Rovanersen sodium can be used for huntington’s disease research .
AS-Inclisiran sodium is the antisense of Inclisiran. Inclisiran (ALN-PCSsc) is a double-stranded small interfering RNA (siRNA) molecule that inhibits the transcription of PCSK-9. Inclisiran can be used for hyperlipidemia and cardiovascular disease (CVD) research .
Zilganersen (ION373) is a glial fibrillary acidic protein (GFAP) inhibitor, an antisense oligonucleotide. Zilganersen can be used in Alexander disease (AxD) research .
IONIS-MAPTRx (BIIB080) is the first Tau-lowering antisense oligonucleotide (ASO). IONIS-MAPTRx has the potential for the research of Alzheimer Disease .
Rovanersen (WVE-120101) is an antisense oligonucleotide that specifically targets mutated mRNA copies of the huntington (HTT) gene without affecting healthy mRNA of HTT gene, thereby preventing the production of faulty Huntingtin protein. Rovanersen can be used for huntington’s disease research .
Mipomersen (ISIS 301012 free base) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has anti-HCV effect and reduces the infectivity of the HCV. Mipomersen can be used for the research of homozygous familial hypercholesterolemia (HoFH) .
Mongersen sodium is a specific and orally active SMAD7 antisense oligonucleotide. Mongersen sodium restores TGF-β1 activity leading to inhibition of inflammatory signals. Mongersen sodium can attenuate Crohn's disease-like experimental colitis in mice .
Tominersen sodium is a second-generation 2′-O-(2-methoxyethyl) antisense oligonucleotide that targets huntingtin protein (HTT) mRNA and potently suppresses HTT production. Tominersen improves survival and reduces brain atrophy in mice. Tominersen sodium can be used for the research of Huntington’s disease (HD) .
Mongersen (GED-0301) is a specific and orally active SMAD7 antisense oligonucleotide. Mongersen restores TGF-β1 activity leading to inhibition of inflammatory signals. Mongersen can attenuate Crohn's disease-like experimental colitis in mice .
Tominersen (RG6042) is a second-generation 2′-O-(2-methoxyethyl) antisense oligonucleotide that targets huntingtin protein (HTT) mRNA and potently suppresses HTT production. Tominersen improves survival and reduces brain atrophy in mice. Tominersen can be used for the research of Huntington’s disease (HD) .
Fomivirsen (ISIS-2922) sodium is an antisense 21 mer phosphorothioate oligonucleotide. Fomivirsen sodium is an antiviral agent that is used cytomegalovirus retinitis (CMV) research, incluiding in AIDs. Fomivirsen sodium binds to and degrades the mRNAs encoding CMV immediate-early 2 protein, thus inhibiting virus proliferation .
Fomivirsen (ISIS-2922 free base) is an antisense 21 mer phosphorothioate oligonucleotide. Fomivirsen is an antiviral agent that is used CMV research, incluiding in AIDs. Fomivirsen binds to and degrades the mRNAs encoding CMV immediate-early 2 protein, thus inhibiting virus proliferation .
Trabedersen sodium is an antisense oligodeoxynucleotide that specifically inhibits TGF-β2 (TGF-beta/Smad). Trabedersen sodium can be used for the study of malignant brain tumors and other solid tumors overexpressing TGF-β2, such as those of the skin, pancreas and colon .
Tofersen sodium is an antisense oligonucleotide that mediates RNase H-dependent degradation of superoxide dismutase 1 (SOD1) mRNA to reduce the synthesis of SOD1 protein. Tofersen sodium can be used for the research of amyotrophic lateral sclerosis (ALS) .
Inotersen (ISIS-420915) sodium is a 2′-O-methoxyethyl-modified antisense oligonucleotide. Inotersen sodium inhibits the production of transthyretin (TTR) protein by targeting the TTR RNA transcript and reduces the levels of the TTR transcript. Inotersen sodium can be used for the research of hereditary TTR amyloidosis polyneuropathy .
Trabedersen (AP 12009) is an antisense oligodeoxynucleotide that specifically inhibits TGF-β2 (TGF-beta/Smad). Trabedersen can be used for the study of malignant brain tumors and other solid tumors overexpressing TGF-β2, such as those of the skin, pancreas and colon .
UNC10217938A is a 3-deazapteridine analog with strong oligonucleotide enhancing effects. UNC10217938A enhances oligonucleotides effects by modulating their intracellular trafficking and release from endosomes. UNC10217938A also enhances the effects of antisense and siRNA oligonucleotides .
Tofersen (BIIB067) is an antisense oligonucleotide that mediates RNase H-dependent degradation of superoxide dismutase 1 (SOD1) mRNA to reduce the synthesis of SOD1 protein. Tofersen can be used for the research of amyotrophic lateral sclerosis (ALS) .
ISIS 449884 sodium is a 2'-O-methoxyethyl antisense oligonucleotide that targets GCGR. ISIS 449884 sodium has an ability to reduce hepatic glucose output and lower the blood glucose level. ISIS 449884 sodium can be used for the study of type 2 diabetes mellitus (T2DM) .
ISIS 449884 is a 2'-O-methoxyethyl antisense oligonucleotide that targets GCGR. ISIS 449884 has an ability to reduce hepatic glucose output and lower the blood glucose level. ISIS 449884 can be used for the study of type 2 diabetes mellitus (T2DM) .
IONIS PTP1BRx (ISIS 404173) sodium is an antisense inhibitor of protein tyrosine phosphatase 1B (PTP-1B). IONIS PTP1BRx sodium shows antidiabetic activity, and can be used for the study of insulin resistance and type 2 diabetes mellitus associated with obesity .
IONIS PTP1BRx (ISIS 404173) is an antisense inhibitor of protein tyrosine phosphatase 1B (PTP-1B). IONIS PTP1BRx shows antidiabetic activity, and can be used for the study of insulin resistance and type 2 diabetes mellitus associated with obesity .
Dmt-2'fluoro-da(bz) amidite, an uniformly modified 2'-deoxy-2'-fluoro phosphorothioate oligonucleotide, is a nuclease-resistant antisense compound with high affinity and specificity for RNA targets. Dmt-2'fluoro-da(bz) amidite is also an intermediate for 5’-DMT-3’-phosphoramidite synthesis .
Viltolarsen (NS-065/NCNP-01) is a phosphorodiamidate morpholino antisense oligonucleotide. Viltolarsen binds to exon 53 of the dystrophin mRNA precursor and restores the amino acid open-reading frame by skipping exon 53, resulting in the production of a shortened dystrophin protein that contains essential functional portions. Viltolarsen has the potential for Duchenne muscular dystrophy (DMD) research .
Viltolarsen (NS-065/NCNP-01) sodium is a phosphorodiamidate morpholino antisense oligonucleotide. Viltolarsen sodium binds to exon 53 of the dystrophin mRNA precursor and restores the amino acid open-reading frame by skipping exon 53, resulting in the production of a shortened dystrophin protein that contains essential functional portions. Viltolarsen sodium has the potential for Duchenne muscular dystrophy (DMD) research .
Eplontersen is a triantennary N-acetyl galactosamine (GalNAc3-7a)-conjugated antisense oligonucleotide targeting transthyretin (TTR) mRNA to inhibit production of both variant and wild-type TTR protein. Misfolded TTR induces amyloid fibrils formation in the heart and peripheral nerves, leads to amyloid TTR (ATTR) amyloidosis diseases .
Eplontersen sodium is a triantennary N-acetyl galactosamine (GalNAc3-7a)-conjugated antisense oligonucleotide targeting transthyretin (TTR) mRNA to inhibit production of both variant and wild-type TTR protein. Misfolded TTR induces amyloid fibrils formation in the heart and peripheral nerves, leads to amyloid TTR (ATTR) amyloidosis diseases .
Custirsen is a highly specific antisense oligonucleotide that inhibits the production of clusterin , an antiapoptotic protein that is upregulated in response to chemotherapy and that confers treatment resistance.
UNC2383 is an oligonucleotide enhancing compound that can enhance effects of antisense oligonucleotides (ASOs), and splice switching oligonucleotides (SSOs) .
Custirsen sodium is a highly specific antisense oligonucleotide that inhibits the production of clusterin , an antiapoptotic protein that is upregulated in response to chemotherapy and that confers treatment resistance.
Volanesorsen sodium is an antisense oligonucleotide thay targes Apolipoprotein C-III (APOC3)
mRNA. Volanesorsen sodium is used for the study of familial chylomicronemia syndrome.
FITC-Trecovirsen (sodium) is a FITC labeled Trecovirsen. Trecovirsen is a 25-mer antisense phosphorothioate oligonucleotide targeted at the gag site of the HIV gene .
ISIS 104838 is an antisense oligonucleotide agent that reduces the production of tumor necrosis factor (TNF-alpha), a substance that contributes to joint pain and swelling in rheumatoid arthritis.
ISIS 104838 sodium is an antisense oligonucleotide agent that reduces the production of tumor necrosis factor (TNF-alpha), a substance that contributes to joint pain and swelling in rheumatoid arthritis.
17:1 Lyso PC is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
DOPE-PEG-Azide, MW 2000 is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
Vupanorsen is an N-acetyl galactosamine-conjugated antisense oligonucleotide that inhibits Angiopoietin-like 3 (ANGPTL3) protein synthesis. Vupanorsen lowers triglycerides and atherogenic lipoproteins.
Vupanorsen (sodium) is an N-acetyl galactosamine-conjugated antisense oligonucleotide that inhibits Angiopoietin-like 3 (ANGPTL3) protein synthesis. Vupanorsen (sodium) lowers triglycerides and atherogenic lipoproteins.
DOTAP chloride is a useful and effective cationic lipid for transient and stable transfection DNA (plasmids, bacmids) and modified nucleic acids (antisense oligonucleotides) with out the use of helper lipid .
Nusinersen is an antisense oligonucleotide agent that modifies pre–messenger RNA splicing of the SMN2 gene and thus promotes increased production of full-length SMN protein .
Alicaforsen is a 20-base antisense oligonucleotide inhibiting ICAM-1 production, which is an important adhesion molecule involved in leukocyte migration and trafficking to the site of inflammation.
Alicaforsen sodium is a 20-base antisense oligonucleotide inhibiting ICAM-1 production, which is an important adhesion molecule involved in leukocyte migration and trafficking to the site of inflammation.
Nusinersen sodium is an antisense oligonucleotide agent that modifies pre–messenger RNA splicing of the SMN2 gene and thus promotes increased production of full-length SMN protein .
SPC4061 an antisense nucleotide, is a potent PCSK9 inhibitor. SPC4061 targets the lock-in nucleic acid (LNA) of PCSK9 for the study of hypercholesterolemia and related diseases .
SPC4061 an antisense nucleotide, sodium is a potent PCSK9 inhibitor. SPC4061 targets the lock-in nucleic acid (LNA) of PCSK9 for the study of hypercholesterolemia and related diseases .
EZN-2968 sodium is an antisense oligonucleotide that specifically binds and inhibits the expression of HIF-1α mRNA. EZN-2968 sodium, inhibits tumor cell growth.
IONIS-FGFR4Rx (ISIS 463588) is an antisense inhibitor of fibroblast growth factor receptor 4 (FGFR4), which is promising for research of renal diseases .
IONIS-FGFR4Rx (ISIS 463588) sodium is an antisense inhibitor of fibroblast growth factor receptor 4 (FGFR4), which is promising for research of renal diseases .
5'-ODMT cEt G Phosphoramidite Amidite is a potent nucleic acid analog. 5'-ODMT cEt G Phosphoramidite Amidite shows excellent safety and antisense activity .
Zorevunersen sodium is an antisense oligonucleotide that is intended to increase the level of productive SCN1A mRNA and consequently increase the expression of the sodium channel Nav1.1 protein. Zorevunersen sodium is used for the study of Dravet syndrome.
SM45a is a small molecule targeting ligand. SM45a can be linked to the 3' or 5' end of a sense strand or an antisense strand of a DUX4 RNAi agent for promoting it entry into cells .
SM51a is a small molecule targeting ligand. SM51a can be linked to the 3' or 5' end of a sense strand or an antisense strand of a DUX4 RNAi agent for promoting it entry into cells .
Mipomersen sodium (ISIS 301012) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has anti-HCV effect and reduces the infectivity of the HCV. Mipomersen sodium can be used for the research of homozygous familial hypercholesterolemia (HoFH) .
Zorevunersen (STK-001) is an antisense oligonucleotide that is intended to increase the level of productive SCN1A mRNA and consequently increase the expression of the sodium channel Nav1.1 protein. Zorevunersen is used for the study of Dravet syndrome.
ISIS 14803 is a 20-unit antisense phosphorothioate oligodeoxynucleotide that binds to hepatitis C virus (HCV) RNA at the translation initiation region of the internal ribosome entry site (IRES) and inhibits protein expression in cell culture.
Tau ASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (Tau ASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )
ISIS 14803 sodium is a 20-unit antisense phosphorothioate oligodeoxynucleotide that binds to hepatitis C virus (HCV) RNA at the translation initiation region of the internal ribosome entry site (IRES) and inhibits protein expression in cell culture.
Monarsen sodium is a synthetic 20-base antisense oligodeoxynucleotide directed against the human AChE gene. Monarsen sodium is used in the study of Autoimmune myasthenia gravis (MG), a neuromuscular disorder caused by autoantibodies directed against the acetylcholine receptor (AChR).
Cepadacursen sodium is a liver-targeting antisense oligonucleotide (ASO), inhibits proprotein convertase subtilisin/kexin type 9 (PCSK9) protein synthesis. Cepadacursen sodium can be used for hypercholesterolemia treatment and the prevention of atherosclerotic cardiovascular disease (ASCVD).
Olezarsen is an N-acetyl-galactosamine-conjugated antisense oligonucleotide targeted to hepatic APOC3 mRNA to inhibit apolipoprotein C-III (apoC-III) production, in lowering triglyceride levels in patients at high risk for or with established cardiovascular disease.
Olezarsen sodium is an N-acetyl-galactosamine-conjugated antisense oligonucleotide targeted to hepatic APOC3 mRNA to inhibit apolipoprotein C-III (apoC-III) production, in lowering triglyceride levels in patients at high risk for or with established cardiovascular disease.
IONIS-FB-LRx sodium is a specific antisense oligonucleotide (ASO) targeting complement factor B (CFB). IONIS-FB-LRx sodium effectively reduces circulating levels of CFB, and can be used for geographic atrophy (GA) research .
5'-ODMT cEt m5U Phosphoramidite Amidite is a locked nucleic acid (LNA) analog. 5'-ODMT cEt m5U Phosphoramidite Amidite shows excellent safety and antisense activity .
Monarsen (EN101) is a synthetic 20-base antisense oligodeoxynucleotide directed against the human AChE gene. Monarsen is used in the study of Autoimmune myasthenia gravis (MG), a neuromuscular disorder caused by autoantibodies directed against the acetylcholine receptor (AChR).
(R/S)-Alicaforsen is the racemate of Alicaforsen composed of R and S configurations. Alicaforsen is a 20-base antisense oligonucleotide inhibiting ICAM-1 production, which is an important adhesion molecule involved in leukocyte migration and trafficking to the site of inflammation.
ISTH0036, an antisense oligonucleotide selectively targeting transforming growth factor beta 2 (TGF-β2), can be use in the study of primary open angle glaucoma (POAG), and wet age-related macular degeneration.
ISTH0036 sodium, an antisense oligonucleotide selectively targeting transforming growth factor beta 2 (TGF-β2), can be use in the study of primary open angle glaucoma (POAG) , and wet age-related macular degeneration.
Danvatirsen is an antisense oligonucleotide targeting STAT3 with potential antitumor activity. Danvatirsen binds to STAT3 mRNA, thereby inhibiting translation of the transcript. Suppression of STAT3 expression induces tumor cell apoptosis and decreases tumor cell growth.
5'-ODMT cEt N-Bzm5 C Phosphoramidite Amidite is a potent nucleic acid analog. 5'-ODMT cEt N-Bzm5 C Phosphoramidite Amidite blongs to modified antisense oligonucleotide .
Danvatirsen sodium is an antisense oligonucleotide targeting STAT3 with potential antitumor activity. Danvatirsen sodium binds to STAT3 mRNA, thereby inhibiting translation of the transcript. Suppression of STAT3 expression induces tumor cell apoptosis and decreases tumor cell growth.
DOTAP chloride Excipient is a cationic lipid with good membrane fusion ability and biocompatibility. DOTAP chloride Excipient can be used as an excipient for transient and stable transfection DNA (plasmids, bacmids) and modified nucleic acids (antisense oligonucleotides) without the use of helper lipid .
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
IONIS-FB-LRx is a specific antisense oligonucleotide (ASO) targeting complement factor B (CFB). IONIS-FB-LRx effectively reduces circulating levels of CFB. IONIS-FB-LRx can be used for geographic atrophy (GA) research .
Volanesorsen (ISIS 304801) is an antisense oligonucleotide inhibitor of apolipoprotein CIII (apo-CIII) mRNA that reduces triglyceride levels and improves insulin resistance. Volanesorsen is being studied in the treatment of hypertriglyceridemia, familial chylosiderosis syndrome, and type 2 diabetes .
Miravirsen sodium is a potent miR-122 inhibitor and inhibits the biogenesis of miR-122. Miravirsen sodium is a 15-nucleotide locked nucleic acid-modified phosphorothioate antisense oligonucleotide. Miravirsen sodium inhibits HCV replication, and can be used in research of HCV infection .
SSOe26 sodium is a 15mer antisense oligonucleotide targeting?HER4. SSOe26 sodium induces exon 26 skipping, leading to the generation of a novel mRNA transcript that excludes exon 26 (CYT2 isoform). SSOe26 sodium decreases tumour growth in mouse xenografts.
SPC5001 is a locked nucleic acid (LNA)-modifed antisense oligonucleotide (ASO) complementary to human PCSK9 (proprotein convertase subtilisin/kexin type 9) mRNA. SPC5001 can be used for the research of hypercholesterolemia. SPC5001 sequence: 5′-TGmCTACAAAACmCmCA-3′ .
GEM231 sodium is an 18mer antisense oligonucleotide targeting the mRNA of the PKA-I (RIα regulatory subunit of cAMP dependent protein kinase type I ). GEM231 sodium induces cell growth arrest, apoptosis, and differentiation in a variety of cancer cell lines in vitro and in tumors in vivo.
GEM231 is an 18mer antisense oligonucleotide targeting the mRNA of the PKA-I (RIα regulatory subunit of cAMP dependent protein kinase type I ). GEM231 induces cell growth arrest, apoptosis, and differentiation in a variety of cancer cell lines in vitro and in tumors in vivo.
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .
SPC5001 sodium is a locked nucleic acid (LNA)-modifed antisense oligonucleotide (ASO) complementary to human PCSK9 (proprotein convertase subtilisin/kexin type 9) mRNA. SPC5001 sodium can be used for the research of hypercholesterolemia. SPC5001 sequence: 5′-TGmCTACAAAACmCmCA-3′ .
AZD8233 sodium, a liver-targeting antisense oligonucleotide (ASO), inhibits subtilisin/kexin type 9 (PCSK9) protein synthesis. AZD8233 sodium increases the available LDL receptors by reducing PCSK9 levels, thereby clearing LDL from the blood and decreasing LDL-C levels.
Miravirsen (SPC-3649) is a potent miR-122 inhibitor and inhibits the biogenesis of miR-122. Miravirsen is a 15-nucleotide locked nucleic acid-modified phosphorothioate antisense oligonucleotide. Miravirsen inhibits HCV replication. Miravirsen can be used in research of HCV infection .
AS-Patisiran sodium is an antisense strand of Patisiran. Patisiran is a double-stranded small interfering RNA that targets a sequence within the transthyretin (TTR) messenger RNA. Patisiran specifically inhibits hepatic synthesis of mutant and wild-type TTR. Patisiran can be used for the research of hereditary TTR amyloidosis .
AZD8233, a liver-targeting antisense oligonucleotide (ASO), inhibits proprotein convertase subtilisin/kexin type 9 (PCSK9) protein synthesis. AZD8233 increases the available LDL receptors by reducing PCSK9 levels, thereby clearing LDL from the blood and decreasing LDL-C levels.
Rugonersen sodium is a locked-nucleic acid (LNA)- modified antisense oligonucleotides (ASOs), and results in reduction of ubiquitin-protein ligase E3A (UBE3A) silencing. Angelman syndrome (AS) sodium is a severe neurodevelopmental disorder caused by the loss of neuronal E3 ligase UBE3A, Rugonersen has been used for AS reasearch .
Aprinocarsen (ISIS 3521) sodium, a specific antisense oligonucleotide inhibitor of protein kinase C-alpha (PKC-α). Aprinocarsen sodium is a 20-mer oligonucleotide, it regulates cell differentiation and proliferation. Aprinocarsen sodium inhibits the growth of human tumor cell lines in nude mice. Aprinocarsen sodium shows the value as a chemotherapeutic compound of human cancers .
Rugonersen (RG6091; RO7248824) is a locked-nucleic acid (LNA)- modified antisense oligonucleotides (ASOs), and results in reduction of ubiquitin-protein ligase E3A (UBE3A) silencing. Angelman syndrome (AS) is a severe neurodevelopmental disorder caused by the loss of neuronal E3 ligase UBE3A, Rugonersen has been used for AS reasearch .
FITC-labeled Tominersen (sodium) is the Tominersen labeled with FITC. Tominersen (RG6042) is a second-generation 2′-O-(2-methoxyethyl) antisense oligonucleotide that targets huntingtin protein (HTT) mRNA and potently suppresses HTT production. Tominersen improves survival and reduces brain atrophy in mice. Tominersen can be used for the research of Huntington’s disease (HD).
2'-F-Bz-dC Phosphoramidite can be used in the synthesis of oligoribonucleotide (such as DNA and RNA). 2'-F-Bz-dC Phosphoramidite also used for synthesis antiviral agent to inhibit the replication of virus. 2'-F-Bz-dC Phosphoramidite contains a phosphorothioate backbone, to synthesise antisense oligonucleotide analogs to induce apoptosis in cancer cells .
SSO111 sodium, a 20mer fully modified antisense oligonucleotide, targets the oncogene?HER2. SSO111 sodium induces exon 15 skipping during splicing, leading to the generation of a novel mRNA transcript that excludes exon 15. SSO111 sodium downregulated HER2 mRNA, which resulted in the inhibition of proliferation and induction of apoptosis in HER2-overexpressing tumor cells.
Boc-Pro-OMe (Boc-L-proline methyl ester) is a lipid compound that can be used for liposome preparation. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble loads can be captured in the internal aqueous space of liposomes, while lipophilic loads can be distributed into the lipid bilayer and become part of the lipid bilayer. Especially for the delivery of antisense oligonucleotides, it can overcome the problems of inefficient cellular uptake and rapid loss in the body.
NH2-GG-DSPE is a lipid compound that can be used for liposome preparation. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble loads can be captured in the internal aqueous space of liposomes, while lipophilic loads can be distributed into the lipid bilayer and become part of the lipid bilayer. Especially for the delivery of antisense oligonucleotides, it can overcome the problems of inefficient cellular uptake and rapid loss in the body.
1,2-Dilinoleoyl-sn-glycero-3-phospho-L-serine sodium is a lipid compound that can be used for liposome preparation. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble loads can be captured in the internal aqueous space of liposomes, while lipophilic loads can be distributed into the lipid bilayer and become part of the lipid bilayer. Especially for the delivery of antisense oligonucleotides, it can overcome the problems of inefficient cellular uptake and rapid loss in the body.
1-Stearoyl-2-docosahexaenoyl-sn-glycero-3-phosphoethanolamine (18:0-22:6 PE) is a lipid compound that can be used for liposome preparation. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble loads can be captured in the internal aqueous space of liposomes, while lipophilic loads can be distributed into the lipid bilayer and become part of the lipid bilayer. Especially for the delivery of antisense oligonucleotides, it can overcome the problems of inefficient cellular uptake and rapid loss in the body.
(2S)-3-Keto sphinganine (d6:0) ((2S)-3-Keto-C6-dihydrosphingosine) hydrochloride is a lipid compound that can be used for liposome preparation. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble loads can be captured in the internal aqueous space of liposomes, while lipophilic loads can be distributed into the lipid bilayer and become part of the lipid bilayer. Especially for the delivery of antisense oligonucleotides, it can overcome the problems of inefficient cellular uptake and rapid loss in the body.
BP Lipid 223 is an pentanolamine lipid (Compound 7) from patent WO2017075531A with both ester bonds located adjacent to C6 relative to the amine head. The introduction of ester linkages can improve the clearance of the lipid in the liver. This compound is analgous to ALC-0315. The lipid can be used to prepare mRNA nanocarriers with good balance of delivery efficiency and pharmakokinetics as well as rapid lipid clearance profile.
1-Myristoyl-2-palmitoyl-sn-glycero-3-phosphocholine (MPPC) is an asymmetrical phosphatidylcholine containing a myristic acid (14:0) at the sn-1 position and a palmitic acid (16:0) at the sn-2 position. It is commonly used in the generation of micelles, liposomes, and other types of artificial membranes.
6-(3-Hydroxypropylamino)hexyl 2-hexyldecanoate is an ionizable lipid which can be used to make ALC-0315. The lipid has an ester bond adjacent to C6 relative to the amine nitrogen. The introduction of ester linkages can improve the clearance of the lipid in the liver.
Cholesterol-PEG-alcohol (MW 2000) is a pegylated lipids which can be used for preparation of liposome or nanoparticle. The lipophilic moiety can encapsulate hydrophobic drugs whereas the hydrophilic PEG chain helps the overal water solubility of the micelles. The amine can react with an activated NHS ester to form a stable amide bond.
Cholesterol-PEG-MAL (MW 2000) is a PEG derivative and can be used to prepare liposome or nanoparticle due to its ability to self-assemble in water. The maleimide moiety is reactive with thiol molecule to form a covalent thioether bond.
1-Myristoyl-2-hydroxy-sn-glycero-3-PG sodium is a lysophospholipid containing myristic acid (14:0) at the sn-1 position. It has been used in the generation of micelles, liposomes, and other types of artificial membranes, including lipid-based drug carrier systems.
1,2-Dipalmitoyl-sn-glycero-3-phospho-N,N-dimethylethanolamine has been used in the generation of liposomes and monolayers for use in the study of membrane permeability and monolayer viscosity, respectively.
BP Lipid 109 is an amine lipid which has long (11 carbons) lipid tail on the primary ester. Both esters are located at C7 position and the head contains ethanolamine. It can be used to prepare liposome or lipid nanoparticles.
Cholesterol-PEG-Azide (MW 2000) is a pegylated lipids which can be used for preparation of liposome or nanoparticle. The lipophilic moiety can encapsulate hydrophobic drugs whereas the hydrophilic PEG chain helps the overal water solubility of the micelles. Cholesterol-PEG-Azide (MW 2000) can be reacted with alkyne via CuAAC or SPAAC click chemistry.
BP Lipid 126 is an amino ionizable lipid (Compound 143) from patent WO2017201333A1 with ester bonds located at C8 and C7 position relative to nitrogen. The ester linkages are introduced to improve tissue clearance. The ethanolamine head can effectively enhance mRNA encapsulation. BP Lipid 126 can be used in the generation of liposomes.
1,3-Dipalmitoyl-glycero-2-phosphoethanolamine is a phospholipid containing the saturated long-chain (16:0) stearic acid inserted at the sn-1 and sn-3 positions and PE at the sn-2 site. It can be used in the generation of micelles, liposomes, and other types of artificial membranes.
Cholesterol-PEG-Amine (MW 2000) is a pegylated lipids which can be used for preparation of liposome or nanoparticle. The lipophilic moiety can encapsulate hydrophobic drugs whereas the hydrophilic PEG chain helps the overal water solubility of the micelles.
2H-Cho-Arg (TFA) is a steroid-based cationic lipid that contains a 2H-cholesterol skeleton coupled to an L-arginine head group and can be used to facilitate gene transfection.
Cholesterol-PEG-Acid (MW 2000) is a polydisperse PEG derivative which can be used to create liposome as drug carrier for delivering therapeutic agents into tissues.
Bis(2-butyloctyl) 10-oxononadecanedioate is an ionizable lipid-like compound containing four hydrophobic tails bound by esters. It can be used to build lipids for mRNA encapsulation and delivery.
Cholesterol-PEG-methoxy, MW 2000 is a PEG derivative which self-assembles in water to form micelle-like structure. The cholesterol tail can be used to encapsulate hydrophobic drugs while the PEG chain ehances the water solubility of the micelles.
ELOVL6-IN-5 (compound B) is an inhibitor of the elongase enzyme of long-chain fatty acid family 6 (ELOVL6). ELOVL6 is a rate-limiting enzyme for the elongation of saturated and monounsaturated long-chain fatty acids and is an effective target for inhibiting diabetes. ELOVL6-IN-5 reduces hepatic fatty acid levels in a mouse model of diet-induced obesity (DIO). However, ELOVL6 inhibition by ELOVL6-IN-5 did not improve insulin resistance .
1,2-Dimyristoyl-sn-glycero-3-phospho-L-serine sodium is an anionic phospholipid with myristic acid tails (14:0) and contains a carboxylic acid (COOH) and amine (NH2) in their head group. It has been used in the preparation of liposome.
1-Palmitoyl-2-oleoyl-sn-glycero-3-phosphate is a phospholipid containing saturated palmitic acid (16:0) and monounsaturated oleic acid (18:1) inserted at the sn-1 and sn-2 positions, respectively. It can be used in the generation of micelles, liposomes, and other types of artificial membranes.
BP Lipid 112 is an amine lipid with two ester linkages at C6 and C7 position. The C6 ester has a long 11 carbons lipid tail. It can be used to prepare liposome or lipid nanoparticles.
Cholesterol-PEG-Vinylsulfone (MW 2000) is a thiol reactive polyPEG via thiol-ene reaction to form a thioether bond. It can self-assemble in water and is used to prepare liposome as drug vehicle for targeted delivery into tissues.
Cholesterol-PEG-Thiol (MW 3400) is an amphiphatic PEG derivative which forms micelles in water and can be used to prepare liposomes or nanoparticles for drug delivery system. The thiol moiety is reactive with maleimide to form a stable thioether bond.
SPPC is a phospholipid with different length of fatty acid. The sn-1 position contains a stearic acid (18:0) while the sn-2 position is occupied by a palmitic acid (16:0).
Bis(bis(2-carboxyethyl)aminopropyl)methylamine is a symmetrical branched linker featuring three tertiary amines and four carboxylic acids. Each carboxylic acid is open to forming esters or amides. It can be used in developing lipid nanoparticles.
BP Lipid 209 is an amine lipid which has a 9-carbons lipid tail on the primary ester. Both esters are located at C8 and C10 position relative to the amine nitrogen. It can be used to prepare liposome or lipid nanoparticles.
1-Palmitoyl-2-stearoyl-sn-glycero-3-phosphocholine is an assymetrical phospholipid containing saturated palmitic and stearic acid at the sn-1 and sn-2 position respectively. The phosphate group is attached to choline.
MPEG2000-DMG is a synthetic lipid comprised of polyPEG and dimyristoyl glycerol. It is used in the creation of lipid nanoparticles (LNPs) for mRNA vaccines.
DSPE-PEG-COOH, MW 2000 is a phospholipid polyPEG which can be used to prepare liposomes or nanoparticles. The terminal carboxylic acid can react with primary amine groups to form a stable amide bond.
DLPS is an anionic phospholipid with lauric acid tails (12:0) and contains a carboxylic acid (COOH) and amine (NH2) in their head group. It has been used in the preparation of lipid-mixing vesicles, liposome, or artificial membrane. Due to the medium size of fatty acid chain, DLPS is used to form thinner membranes/walls.
DOPE-PEG-Amine (MW 2000) is a polydisperse PEG covalently attached to a phospholipid. The polymer is an amphiphilic molecule with hydrophobic fatty acid chains and hydrophilic PEG head which enables lipid bilayer or micelle formation in water. The phospholipid PEG can be used to prepare liposome or nanoparticles for targeted drug delivery and is reactive with alkyne to form a triazole ring.
DOPE-PEG-Mal (MW 2000) is a phospholipid polyPEG which can be used to prepare liposomes or nanoparticles. It is also reactive with thiol at pH 6.5 tp 7.5 to form a stable thioether bond.
Amino-Gly-Gly-DSPE (hydrochloride) is a specially modified phospholipid that has been used to synthesize liposomes. The terminal amine is reactive with an NHS ester compound or carboxylic acid molecule in the presence of activator, such as HATU or EDC.
2-Arachidonoyl-sn-glycero-3-phosphocholine is a phospholipid molecule that is a major component of the plasma membrane. It is a phospholipid molecule that is involved in the regulation of membrane fluidity, signal transduction, cell-cell communication, and mediator of inflammation.
19:0 PC is a saturated phospholipid that has been used as a standard for the quantification of phosphatidylcholines in human synovial fluid. It has also been used to study dynamics of lipid bilayer phase transition.
1,2-PLPC is a phospholipid containing palmitoyl (16:0) and lauryl (12:0) acyl substituents at the sn-1 and sn-2 positions, respectively. It can be used in the generation of micelles, liposomes, and other types of artificial membranes.
Thiol-PEG-DMG, MW 2000 is a phospholipid polyPEG which can be used to prepare liposomes or nanoparticles. The terminal thiol group reacts with maleimide, OPSS, vinylsulfone and transition metal surfaces including gold, silver, etc.
mPEG-Cholesterol,MW 2000 is a PEG derivative which self-assembles in water to form micelle-like structure. The cholesterol tail can be used to encapsulate hydrophobic drugs while the PEG chain ehances the water solubility of the micelles.
DMPE-mPEG, MW 2000 is a PEGylated 1,2-Dimyristoyl-sn-glycero-3-phosphoethanolamine (14:0 PE) compound with a methyl group at the other end of the PEG chain. The PEG polymer exhibits amphiphatic behavior and helps to form stable micelles in an aqueous solution. It can be used to prepare nanoparticles or liposomes for targeted drug delivery applications.
DLPG is a phospholipid containing lauric acid (12 chain fatty acid) inserted at the sn-1 and sn-2 positions. Its phosphate group is attached to glycerol. It is used in the generation of micelles, liposomes, and other artificial membranes.
16:0 MPB PE is a maleimide-functionalized thiol-reactive lipid with a phosphoethanolamine linked to two palmitic acid tails and a phenyl maleimide group.
BP Lipid 227 is an ionizable lipid. It has primary esters at C5 position relative to the amine nitrogen. The primary lipid tail has an 8 carbon tail. BP Lipid 227 can be used in the generation of liposomes.
DOPE-Mal is a synthetic analog of naturally-occurring PE containing 18:1 fatty acids at the sn-1 and sn-2 positions with a terminal maliemide group. The maleimide group will react with a thiol group to form a covalent bond. The hydrophilic PEG spacer increases solubility in aqueous media.
BP Lipid 308 has a terminal tertiary amine group, a linoleic group, and a 4,4-bis(octyloxy)butanoic acid sodium salt tail. This compound can be useful for the building or modification of lipid nanoparticles.
Octadecanedioic Acid Mono-L-carnitine ester is a cationic lipid which may be used in combination with other lipids in the formation of lipid nanoparticles (LNPs). Its terminal carboxylic acid can react with primary amine groups in the presence of activators (e.g. HATU) to form a stable amide bond.
BP Lipid 229 is an amino ionizable lipid. It has primary esters at C7 position relative to the amine nitrogen. The primary lipid tail has 8 carbon tail. BP Lipid 229 can be used in the generation of liposomes.
BP Lipid 314 is an ionizable amino lipid featuring a dimethylamino head group, a carbamate linking to a central tertiary carbon with two other branches, a linoleate ester, and an aliphatic acetal ester.
tert-Butyl 3-(7-((undecan-3-yloxy)carbonyl)heptylamino)propylcarbamate is an aminolipid featuring a Boc-protected primary amine, a propylamine spacer attached to an octanoate chain and a C11 chain.
BP Lipid 315 is a cationic ionizable lipid ALC-0315 analogue featuring a Boc-protected primary amine, a central tertiary amine, and two ester tails located at the C8 position relative to the amine. One of these esters features a symmetrical branched C17 tail, while the other is an asymmetric C11 tail.
FITC-labeled Tominersen (sodium) is the Tominersen labeled with FITC. Tominersen (RG6042) is a second-generation 2′-O-(2-methoxyethyl) antisense oligonucleotide that targets huntingtin protein (HTT) mRNA and potently suppresses HTT production. Tominersen improves survival and reduces brain atrophy in mice. Tominersen can be used for the research of Huntington’s disease (HD).
Dmt-2'fluoro-da(bz) amidite, an uniformly modified 2'-deoxy-2'-fluoro phosphorothioate oligonucleotide, is a nuclease-resistant antisense compound with high affinity and specificity for RNA targets. Dmt-2'fluoro-da(bz) amidite is also an intermediate for 5’-DMT-3’-phosphoramidite synthesis .
DOTAP chloride is a useful and effective cationic lipid for transient and stable transfection DNA (plasmids, bacmids) and modified nucleic acids (antisense oligonucleotides) with out the use of helper lipid .
Pip6a is an arginine-rich cell-penetrating peptide. Pip6a has the ability to deliver associated cargoes across the plasma and endosomal membranes and is stable to serum proteolysis. Pip6a is composed of a hydrophobic core region flanked on each side by arginine-rich domains containing β-alanine and aminohexanoyl spacers. Pip6a-conjugated morpholino phosphorodiamidate oligomer (PMO) dramatically enhanced antisense oligonucleotide (ASO) delivery into striated muscles of myotonic dystrophy (DM1) mice .
(RFR)4XB is a cationic membrane-penetrating peptide. (RFR)4XB carries its cargo (the antisense oligomer) across the outer membrane of gram-negative bacteria .
Boc-Pro-OMe (Boc-L-proline methyl ester) is a lipid compound that can be used for liposome preparation. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble loads can be captured in the internal aqueous space of liposomes, while lipophilic loads can be distributed into the lipid bilayer and become part of the lipid bilayer. Especially for the delivery of antisense oligonucleotides, it can overcome the problems of inefficient cellular uptake and rapid loss in the body.
ATG9B Protein, a phospholipid scramblase crucial for autophagy, dynamically cycles between the preautophagosomal structure (PAS) and the cytoplasmic vesicle pool. It plays a critical role in expanding autophagosomal membranes, facilitating lipid distribution with ATG2 and driving membrane expansion. Additionally, ATG9B participates in necrotic cell death. ATG9B Protein, Human (HEK293, FLAG) is the recombinant human-derived ATG9B protein, expressed by HEK293 , with C-Flag labeled tag. The total length of ATG9B Protein, Human (HEK293, FLAG) is 924 a.a., .
ATG9B Protein, a phospholipid scramblase crucial for autophagy, dynamically cycles between the preautophagosomal structure (PAS) and the cytoplasmic vesicle pool. It plays a critical role in expanding autophagosomal membranes, facilitating lipid distribution with ATG2 and driving membrane expansion. Additionally, ATG9B participates in necrotic cell death. ATG9B Protein, Human (HEK293, His, MBP, FLAG) is the recombinant human-derived ATG9B protein, expressed by HEK293 , with N-MBP, C-Flag, N-8*His labeled tag. The total length of ATG9B Protein, Human (HEK293, His, MBP, FLAG) is 924 a.a., .
Cholesterol-PEG-Azide (MW 2000) is a pegylated lipids which can be used for preparation of liposome or nanoparticle. The lipophilic moiety can encapsulate hydrophobic drugs whereas the hydrophilic PEG chain helps the overal water solubility of the micelles. Cholesterol-PEG-Azide (MW 2000) can be reacted with alkyne via CuAAC or SPAAC click chemistry.
Rovanersen sodium is an antisense oligonucleotide that specifically targets mutated mRNA copies of the huntington (HTT) gene without affecting healthy mRNA of HTT gene, thereby preventing the production of faulty Huntingtin protein. Rovanersen sodium can be used for huntington’s disease research .
Zilganersen (ION373) is a glial fibrillary acidic protein (GFAP) inhibitor, an antisense oligonucleotide. Zilganersen can be used in Alexander disease (AxD) research .
IONIS-MAPTRx (BIIB080) is the first Tau-lowering antisense oligonucleotide (ASO). IONIS-MAPTRx has the potential for the research of Alzheimer Disease .
IONIS-DNM2-2.5Rx (DYM101) is an antisense agent targeting dynamin 2. IONIS-DNM2-2.5Rx has the potential for the research of centronuclear myopathy (CNM) .
AZD8701 (IONIS-1063734) is an antisense oligonucleotide targeting FOXP3 in regulatory T cells (Tregs). AZD8701 can relieve immunosuppression in cancer .
AZD8701 (IONIS-1063734) sodium is an antisense oligonucleotide targeting FOXP3 in regulatory T cells (Tregs). AZD8701 sodium can relieve immunosuppression in cancer .
Pelacarsen sodium is a liver-specific antisense oligonucleotide against apolipoprotein(a) that reduces lipoprotein(a) up to 80% with good tolerability .
Rovanersen (WVE-120101) is an antisense oligonucleotide that specifically targets mutated mRNA copies of the huntington (HTT) gene without affecting healthy mRNA of HTT gene, thereby preventing the production of faulty Huntingtin protein. Rovanersen can be used for huntington’s disease research .
AS-Inclisiran sodium is the antisense of Inclisiran. Inclisiran (ALN-PCSsc) is a double-stranded small interfering RNA (siRNA) molecule that inhibits the transcription of PCSK-9. Inclisiran can be used for hyperlipidemia and cardiovascular disease (CVD) research .
Pelacarsen (AKCEA-APO(a)-LRx) is a liver-specific antisense oligonucleotide against apolipoprotein(a) that reduces lipoprotein(a) up to 80% with good tolerability .
Mipomersen (ISIS 301012 free base) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has anti-HCV effect and reduces the infectivity of the HCV. Mipomersen can be used for the research of homozygous familial hypercholesterolemia (HoFH) .
Mongersen sodium is a specific and orally active SMAD7 antisense oligonucleotide. Mongersen sodium restores TGF-β1 activity leading to inhibition of inflammatory signals. Mongersen sodium can attenuate Crohn's disease-like experimental colitis in mice .
Tominersen sodium is a second-generation 2′-O-(2-methoxyethyl) antisense oligonucleotide that targets huntingtin protein (HTT) mRNA and potently suppresses HTT production. Tominersen improves survival and reduces brain atrophy in mice. Tominersen sodium can be used for the research of Huntington’s disease (HD) .
Mongersen (GED-0301) is a specific and orally active SMAD7 antisense oligonucleotide. Mongersen restores TGF-β1 activity leading to inhibition of inflammatory signals. Mongersen can attenuate Crohn's disease-like experimental colitis in mice .
Tominersen (RG6042) is a second-generation 2′-O-(2-methoxyethyl) antisense oligonucleotide that targets huntingtin protein (HTT) mRNA and potently suppresses HTT production. Tominersen improves survival and reduces brain atrophy in mice. Tominersen can be used for the research of Huntington’s disease (HD) .
Fomivirsen (ISIS-2922) sodium is an antisense 21 mer phosphorothioate oligonucleotide. Fomivirsen sodium is an antiviral agent that is used cytomegalovirus retinitis (CMV) research, incluiding in AIDs. Fomivirsen sodium binds to and degrades the mRNAs encoding CMV immediate-early 2 protein, thus inhibiting virus proliferation .
Trabedersen sodium is an antisense oligodeoxynucleotide that specifically inhibits TGF-β2 (TGF-beta/Smad). Trabedersen sodium can be used for the study of malignant brain tumors and other solid tumors overexpressing TGF-β2, such as those of the skin, pancreas and colon .
Tofersen sodium is an antisense oligonucleotide that mediates RNase H-dependent degradation of superoxide dismutase 1 (SOD1) mRNA to reduce the synthesis of SOD1 protein. Tofersen sodium can be used for the research of amyotrophic lateral sclerosis (ALS) .
Inotersen (ISIS-420915) sodium is a 2′-O-methoxyethyl-modified antisense oligonucleotide. Inotersen sodium inhibits the production of transthyretin (TTR) protein by targeting the TTR RNA transcript and reduces the levels of the TTR transcript. Inotersen sodium can be used for the research of hereditary TTR amyloidosis polyneuropathy .
Trabedersen (AP 12009) is an antisense oligodeoxynucleotide that specifically inhibits TGF-β2 (TGF-beta/Smad). Trabedersen can be used for the study of malignant brain tumors and other solid tumors overexpressing TGF-β2, such as those of the skin, pancreas and colon .
Tofersen (BIIB067) is an antisense oligonucleotide that mediates RNase H-dependent degradation of superoxide dismutase 1 (SOD1) mRNA to reduce the synthesis of SOD1 protein. Tofersen can be used for the research of amyotrophic lateral sclerosis (ALS) .
ISIS 449884 sodium is a 2'-O-methoxyethyl antisense oligonucleotide that targets GCGR. ISIS 449884 sodium has an ability to reduce hepatic glucose output and lower the blood glucose level. ISIS 449884 sodium can be used for the study of type 2 diabetes mellitus (T2DM) .
ISIS 449884 is a 2'-O-methoxyethyl antisense oligonucleotide that targets GCGR. ISIS 449884 has an ability to reduce hepatic glucose output and lower the blood glucose level. ISIS 449884 can be used for the study of type 2 diabetes mellitus (T2DM) .
IONIS PTP1BRx (ISIS 404173) sodium is an antisense inhibitor of protein tyrosine phosphatase 1B (PTP-1B). IONIS PTP1BRx sodium shows antidiabetic activity, and can be used for the study of insulin resistance and type 2 diabetes mellitus associated with obesity .
IONIS PTP1BRx (ISIS 404173) is an antisense inhibitor of protein tyrosine phosphatase 1B (PTP-1B). IONIS PTP1BRx shows antidiabetic activity, and can be used for the study of insulin resistance and type 2 diabetes mellitus associated with obesity .
Dmt-2'fluoro-da(bz) amidite, an uniformly modified 2'-deoxy-2'-fluoro phosphorothioate oligonucleotide, is a nuclease-resistant antisense compound with high affinity and specificity for RNA targets. Dmt-2'fluoro-da(bz) amidite is also an intermediate for 5’-DMT-3’-phosphoramidite synthesis .
Viltolarsen (NS-065/NCNP-01) is a phosphorodiamidate morpholino antisense oligonucleotide. Viltolarsen binds to exon 53 of the dystrophin mRNA precursor and restores the amino acid open-reading frame by skipping exon 53, resulting in the production of a shortened dystrophin protein that contains essential functional portions. Viltolarsen has the potential for Duchenne muscular dystrophy (DMD) research .
Ulefnersen (ION363) is an Antisense Oligonucleotide (ASO) directed against the 6th intron of the fused-in sarcoma (FUS) transcript to silence FUS in a non-allele-specific manner. Ulefnersen can reduce postnatal levels of FUS protein in the brain and spinal cord in disease-relevant mouse model of ALS-FUS , delaying motor neuron degeneration. Ulefnersen can be used in the research of Amyotrophic Lateral Sclerosis (ALS) .
Ulefnersen sodium (ION363) is an Antisense Oligonucleotide (ASO) directed against the 6th intron of the fused-in sarcoma (FUS) transcript to silence FUS in a non-allele-specific manner. Ulefnersen sodium can reduce postnatal levels of FUS protein in the brain and spinal cord in disease-relevant mouse model of ALS-FUS , delaying motor neuron degeneration. Ulefnersen sodium can be used in the research of Amyotrophic Lateral Sclerosis (ALS) .
Viltolarsen (NS-065/NCNP-01) sodium is a phosphorodiamidate morpholino antisense oligonucleotide. Viltolarsen sodium binds to exon 53 of the dystrophin mRNA precursor and restores the amino acid open-reading frame by skipping exon 53, resulting in the production of a shortened dystrophin protein that contains essential functional portions. Viltolarsen sodium has the potential for Duchenne muscular dystrophy (DMD) research .
Eplontersen is a triantennary N-acetyl galactosamine (GalNAc3-7a)-conjugated antisense oligonucleotide targeting transthyretin (TTR) mRNA to inhibit production of both variant and wild-type TTR protein. Misfolded TTR induces amyloid fibrils formation in the heart and peripheral nerves, leads to amyloid TTR (ATTR) amyloidosis diseases .
Eplontersen sodium is a triantennary N-acetyl galactosamine (GalNAc3-7a)-conjugated antisense oligonucleotide targeting transthyretin (TTR) mRNA to inhibit production of both variant and wild-type TTR protein. Misfolded TTR induces amyloid fibrils formation in the heart and peripheral nerves, leads to amyloid TTR (ATTR) amyloidosis diseases .
Custirsen is a highly specific antisense oligonucleotide that inhibits the production of clusterin , an antiapoptotic protein that is upregulated in response to chemotherapy and that confers treatment resistance.
Baliforsen (sodium) is an antisense oligonucleotide (16 nucleotides) designed to target myotonic dystrophy protein kinase (DMPK) mRNA and research myotonic dystrophy.
Baliforsen is an antisense oligonucleotide (16 nucleotides) designed to target myotonic dystrophy protein kinase (DMPK) mRNA and research myotonic dystrophy.
Custirsen sodium is a highly specific antisense oligonucleotide that inhibits the production of clusterin , an antiapoptotic protein that is upregulated in response to chemotherapy and that confers treatment resistance.
Volanesorsen sodium is an antisense oligonucleotide thay targes Apolipoprotein C-III (APOC3)
mRNA. Volanesorsen sodium is used for the study of familial chylomicronemia syndrome.
FITC-Trecovirsen (sodium) is a FITC labeled Trecovirsen. Trecovirsen is a 25-mer antisense phosphorothioate oligonucleotide targeted at the gag site of the HIV gene .
ISIS 104838 is an antisense oligonucleotide agent that reduces the production of tumor necrosis factor (TNF-alpha), a substance that contributes to joint pain and swelling in rheumatoid arthritis.
ISIS 104838 sodium is an antisense oligonucleotide agent that reduces the production of tumor necrosis factor (TNF-alpha), a substance that contributes to joint pain and swelling in rheumatoid arthritis.
DOPE-PEG-Azide, MW 2000 is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
Vupanorsen is an N-acetyl galactosamine-conjugated antisense oligonucleotide that inhibits Angiopoietin-like 3 (ANGPTL3) protein synthesis. Vupanorsen lowers triglycerides and atherogenic lipoproteins.
Vupanorsen (sodium) is an N-acetyl galactosamine-conjugated antisense oligonucleotide that inhibits Angiopoietin-like 3 (ANGPTL3) protein synthesis. Vupanorsen (sodium) lowers triglycerides and atherogenic lipoproteins.
GTI-2501, an antisense oligonucleotide targeting R1, the large subunit of human ribonucleotide reductase, shows potent anti-tumor activity against a variety of tumors
GTI-2501 sodium, an antisense oligonucleotide targeting R1, the large subunit of human ribonucleotide reductase, shows potent anti-tumor activity against a variety of tumors
DOTAP chloride is a useful and effective cationic lipid for transient and stable transfection DNA (plasmids, bacmids) and modified nucleic acids (antisense oligonucleotides) with out the use of helper lipid .
Nusinersen is an antisense oligonucleotide agent that modifies pre–messenger RNA splicing of the SMN2 gene and thus promotes increased production of full-length SMN protein .
Alicaforsen is a 20-base antisense oligonucleotide inhibiting ICAM-1 production, which is an important adhesion molecule involved in leukocyte migration and trafficking to the site of inflammation.
Donidalorsen is an antisense oligonucleotide designed to reduce the production of prekallikrein (PKK). PKK plays an important role in the activation of inflammatory mediators associated with acute attacks of Hereditary angioedema (HAE).
Donidalorsen (sodium) is an antisense oligonucleotide designed to reduce the production of prekallikrein (PKK). PKK plays an important role in the activation of inflammatory mediators associated with acute attacks of Hereditary angioedema (HAE).
Alicaforsen sodium is a 20-base antisense oligonucleotide inhibiting ICAM-1 production, which is an important adhesion molecule involved in leukocyte migration and trafficking to the site of inflammation.
Nusinersen sodium is an antisense oligonucleotide agent that modifies pre–messenger RNA splicing of the SMN2 gene and thus promotes increased production of full-length SMN protein .
SPC4061 an antisense nucleotide, is a potent PCSK9 inhibitor. SPC4061 targets the lock-in nucleic acid (LNA) of PCSK9 for the study of hypercholesterolemia and related diseases .
SPC4061 an antisense nucleotide, sodium is a potent PCSK9 inhibitor. SPC4061 targets the lock-in nucleic acid (LNA) of PCSK9 for the study of hypercholesterolemia and related diseases .
EZN-2968 sodium is an antisense oligonucleotide that specifically binds and inhibits the expression of HIF-1α mRNA. EZN-2968 sodium, inhibits tumor cell growth.
IONIS-FGFR4Rx (ISIS 463588) is an antisense inhibitor of fibroblast growth factor receptor 4 (FGFR4), which is promising for research of renal diseases .
IONIS-FGFR4Rx (ISIS 463588) sodium is an antisense inhibitor of fibroblast growth factor receptor 4 (FGFR4), which is promising for research of renal diseases .
Drisapersen, a antisense oligonucleotide, induces exon 51 skipping during dystrophin pre-mRNA splicing and allows synthesis of partially functional dystrophin in Duchenne muscular dystrophy (DMD) patients with amenable mutations.
5'-ODMT cEt G Phosphoramidite Amidite is a potent nucleic acid analog. 5'-ODMT cEt G Phosphoramidite Amidite shows excellent safety and antisense activity .
ISIS 329993 sodium is an antisense oligonucleotide targeting to C-reactive protein (CRP). ISIS-CRPRx sodium has been tested in a rodent model of rheumatoid arthritis (RA) and was shown to improve the clinical signs of arthritis
Zorevunersen sodium is an antisense oligonucleotide that is intended to increase the level of productive SCN1A mRNA and consequently increase the expression of the sodium channel Nav1.1 protein. Zorevunersen sodium is used for the study of Dravet syndrome.
Drisapersen sodium, a antisense oligonucleotide, induces exon 51 skipping during dystrophin pre-mRNA splicing and allows synthesis of partially functional dystrophin in Duchenne muscular dystrophy (DMD) patients with amenable mutations.
ISIS 329993 (ISIS-CRPRx) is an antisense oligonucleotide targeting to C-reactive protein (CRP). ISIS-CRPRx has been tested in a rodent model of rheumatoid arthritis (RA) and was shown to improve the clinical signs of arthritis
Mipomersen sodium (ISIS 301012) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has anti-HCV effect and reduces the infectivity of the HCV. Mipomersen sodium can be used for the research of homozygous familial hypercholesterolemia (HoFH) .
Zorevunersen (STK-001) is an antisense oligonucleotide that is intended to increase the level of productive SCN1A mRNA and consequently increase the expression of the sodium channel Nav1.1 protein. Zorevunersen is used for the study of Dravet syndrome.
Sepofarsen (QR-110) is an RNA antisense oligonucleotide targeting to the p.Cys998X mutation (also known as the c.2991+1655A>G mutation) in the CEP290 gene.
ISIS 14803 is a 20-unit antisense phosphorothioate oligodeoxynucleotide that binds to hepatitis C virus (HCV) RNA at the translation initiation region of the internal ribosome entry site (IRES) and inhibits protein expression in cell culture.
Tau ASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (Tau ASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )
ISIS 14803 sodium is a 20-unit antisense phosphorothioate oligodeoxynucleotide that binds to hepatitis C virus (HCV) RNA at the translation initiation region of the internal ribosome entry site (IRES) and inhibits protein expression in cell culture.
Monarsen sodium is a synthetic 20-base antisense oligodeoxynucleotide directed against the human AChE gene. Monarsen sodium is used in the study of Autoimmune myasthenia gravis (MG), a neuromuscular disorder caused by autoantibodies directed against the acetylcholine receptor (AChR).
Sepofarsen (QR-110) sodium is an RNA antisense oligonucleotide targeting to the p.Cys998X mutation (also known as the c.2991+1655A>G mutation) in the CEP290 gene.
Cepadacursen sodium is a liver-targeting antisense oligonucleotide (ASO), inhibits proprotein convertase subtilisin/kexin type 9 (PCSK9) protein synthesis. Cepadacursen sodium can be used for hypercholesterolemia treatment and the prevention of atherosclerotic cardiovascular disease (ASCVD).
Olezarsen is an N-acetyl-galactosamine-conjugated antisense oligonucleotide targeted to hepatic APOC3 mRNA to inhibit apolipoprotein C-III (apoC-III) production, in lowering triglyceride levels in patients at high risk for or with established cardiovascular disease.
Olezarsen sodium is an N-acetyl-galactosamine-conjugated antisense oligonucleotide targeted to hepatic APOC3 mRNA to inhibit apolipoprotein C-III (apoC-III) production, in lowering triglyceride levels in patients at high risk for or with established cardiovascular disease.
IONIS-FB-LRx sodium is a specific antisense oligonucleotide (ASO) targeting complement factor B (CFB). IONIS-FB-LRx sodium effectively reduces circulating levels of CFB, and can be used for geographic atrophy (GA) research .
5'-ODMT cEt m5U Phosphoramidite Amidite is a locked nucleic acid (LNA) analog. 5'-ODMT cEt m5U Phosphoramidite Amidite shows excellent safety and antisense activity .
Monarsen (EN101) is a synthetic 20-base antisense oligodeoxynucleotide directed against the human AChE gene. Monarsen is used in the study of Autoimmune myasthenia gravis (MG), a neuromuscular disorder caused by autoantibodies directed against the acetylcholine receptor (AChR).
(R/S)-Alicaforsen is the racemate of Alicaforsen composed of R and S configurations. Alicaforsen is a 20-base antisense oligonucleotide inhibiting ICAM-1 production, which is an important adhesion molecule involved in leukocyte migration and trafficking to the site of inflammation.
ISTH0036, an antisense oligonucleotide selectively targeting transforming growth factor beta 2 (TGF-β2), can be use in the study of primary open angle glaucoma (POAG), and wet age-related macular degeneration.
ISTH0036 sodium, an antisense oligonucleotide selectively targeting transforming growth factor beta 2 (TGF-β2), can be use in the study of primary open angle glaucoma (POAG) , and wet age-related macular degeneration.
Danvatirsen is an antisense oligonucleotide targeting STAT3 with potential antitumor activity. Danvatirsen binds to STAT3 mRNA, thereby inhibiting translation of the transcript. Suppression of STAT3 expression induces tumor cell apoptosis and decreases tumor cell growth.
5'-ODMT cEt N-Bzm5 C Phosphoramidite Amidite is a potent nucleic acid analog. 5'-ODMT cEt N-Bzm5 C Phosphoramidite Amidite blongs to modified antisense oligonucleotide .
FITC-labeled Drisapersen (sodium) is Drisapersen labeled with FITC. Drisapersen, a antisense oligonucleotide, induces exon 51 skipping during dystrophin pre-mRNA splicing and allows synthesis of partially functional dystrophin in Duchenne muscular dystrophy (DMD) patients with amenable mutations.
Danvatirsen sodium is an antisense oligonucleotide targeting STAT3 with potential antitumor activity. Danvatirsen sodium binds to STAT3 mRNA, thereby inhibiting translation of the transcript. Suppression of STAT3 expression induces tumor cell apoptosis and decreases tumor cell growth.
DOTAP chloride Excipient is a cationic lipid with good membrane fusion ability and biocompatibility. DOTAP chloride Excipient can be used as an excipient for transient and stable transfection DNA (plasmids, bacmids) and modified nucleic acids (antisense oligonucleotides) without the use of helper lipid .
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
IONIS-FB-LRx is a specific antisense oligonucleotide (ASO) targeting complement factor B (CFB). IONIS-FB-LRx effectively reduces circulating levels of CFB. IONIS-FB-LRx can be used for geographic atrophy (GA) research .
Volanesorsen (ISIS 304801) is an antisense oligonucleotide inhibitor of apolipoprotein CIII (apo-CIII) mRNA that reduces triglyceride levels and improves insulin resistance. Volanesorsen is being studied in the treatment of hypertriglyceridemia, familial chylosiderosis syndrome, and type 2 diabetes .
Miravirsen sodium is a potent miR-122 inhibitor and inhibits the biogenesis of miR-122. Miravirsen sodium is a 15-nucleotide locked nucleic acid-modified phosphorothioate antisense oligonucleotide. Miravirsen sodium inhibits HCV replication, and can be used in research of HCV infection .
SSOe26 sodium is a 15mer antisense oligonucleotide targeting?HER4. SSOe26 sodium induces exon 26 skipping, leading to the generation of a novel mRNA transcript that excludes exon 26 (CYT2 isoform). SSOe26 sodium decreases tumour growth in mouse xenografts.
SPC5001 is a locked nucleic acid (LNA)-modifed antisense oligonucleotide (ASO) complementary to human PCSK9 (proprotein convertase subtilisin/kexin type 9) mRNA. SPC5001 can be used for the research of hypercholesterolemia. SPC5001 sequence: 5′-TGmCTACAAAACmCmCA-3′ .
GEM231 sodium is an 18mer antisense oligonucleotide targeting the mRNA of the PKA-I (RIα regulatory subunit of cAMP dependent protein kinase type I ). GEM231 sodium induces cell growth arrest, apoptosis, and differentiation in a variety of cancer cell lines in vitro and in tumors in vivo.
GEM231 is an 18mer antisense oligonucleotide targeting the mRNA of the PKA-I (RIα regulatory subunit of cAMP dependent protein kinase type I ). GEM231 induces cell growth arrest, apoptosis, and differentiation in a variety of cancer cell lines in vitro and in tumors in vivo.
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .
SPC5001 sodium is a locked nucleic acid (LNA)-modifed antisense oligonucleotide (ASO) complementary to human PCSK9 (proprotein convertase subtilisin/kexin type 9) mRNA. SPC5001 sodium can be used for the research of hypercholesterolemia. SPC5001 sequence: 5′-TGmCTACAAAACmCmCA-3′ .
AZD8233 sodium, a liver-targeting antisense oligonucleotide (ASO), inhibits subtilisin/kexin type 9 (PCSK9) protein synthesis. AZD8233 sodium increases the available LDL receptors by reducing PCSK9 levels, thereby clearing LDL from the blood and decreasing LDL-C levels.
Miravirsen (SPC-3649) is a potent miR-122 inhibitor and inhibits the biogenesis of miR-122. Miravirsen is a 15-nucleotide locked nucleic acid-modified phosphorothioate antisense oligonucleotide. Miravirsen inhibits HCV replication. Miravirsen can be used in research of HCV infection .
AS-Patisiran sodium is an antisense strand of Patisiran. Patisiran is a double-stranded small interfering RNA that targets a sequence within the transthyretin (TTR) messenger RNA. Patisiran specifically inhibits hepatic synthesis of mutant and wild-type TTR. Patisiran can be used for the research of hereditary TTR amyloidosis .
Casimersen sodium is an antisense oligonucleotide of the phosphorodiamidate morpholino oligomer subclass. Casimersen sodium binds to exon 45 of dystrophin pre-mRNA, restores the open-reading frame (by skipping exon 45) resulting in the production of an internally truncated but functional dystrophin protein. Casimersen sodium can be used for the research of Duchenne muscular dystrophy (DMD) .
AZD8233, a liver-targeting antisense oligonucleotide (ASO), inhibits proprotein convertase subtilisin/kexin type 9 (PCSK9) protein synthesis. AZD8233 increases the available LDL receptors by reducing PCSK9 levels, thereby clearing LDL from the blood and decreasing LDL-C levels.
Rugonersen sodium is a locked-nucleic acid (LNA)- modified antisense oligonucleotides (ASOs), and results in reduction of ubiquitin-protein ligase E3A (UBE3A) silencing. Angelman syndrome (AS) sodium is a severe neurodevelopmental disorder caused by the loss of neuronal E3 ligase UBE3A, Rugonersen has been used for AS reasearch .
Aprinocarsen (ISIS 3521) sodium, a specific antisense oligonucleotide inhibitor of protein kinase C-alpha (PKC-α). Aprinocarsen sodium is a 20-mer oligonucleotide, it regulates cell differentiation and proliferation. Aprinocarsen sodium inhibits the growth of human tumor cell lines in nude mice. Aprinocarsen sodium shows the value as a chemotherapeutic compound of human cancers .
Casimersen (SRP-4045) is an antisense oligonucleotide of the phosphorodiamidate morpholino oligomer subclass. Casimersen binds to exon 45 of dystrophin pre-mRNA, restores the open-reading frame (by skipping exon 45) resulting in the production of an internally truncated but functional dystrophin protein. Casimersen can be used for the research of Duchenne muscular dystrophy (DMD) .
Rugonersen (RG6091; RO7248824) is a locked-nucleic acid (LNA)- modified antisense oligonucleotides (ASOs), and results in reduction of ubiquitin-protein ligase E3A (UBE3A) silencing. Angelman syndrome (AS) is a severe neurodevelopmental disorder caused by the loss of neuronal E3 ligase UBE3A, Rugonersen has been used for AS reasearch .
FITC-labeled Tominersen (sodium) is the Tominersen labeled with FITC. Tominersen (RG6042) is a second-generation 2′-O-(2-methoxyethyl) antisense oligonucleotide that targets huntingtin protein (HTT) mRNA and potently suppresses HTT production. Tominersen improves survival and reduces brain atrophy in mice. Tominersen can be used for the research of Huntington’s disease (HD).
2'-F-Bz-dC Phosphoramidite can be used in the synthesis of oligoribonucleotide (such as DNA and RNA). 2'-F-Bz-dC Phosphoramidite also used for synthesis antiviral agent to inhibit the replication of virus. 2'-F-Bz-dC Phosphoramidite contains a phosphorothioate backbone, to synthesise antisense oligonucleotide analogs to induce apoptosis in cancer cells .
SSO111 sodium, a 20mer fully modified antisense oligonucleotide, targets the oncogene?HER2. SSO111 sodium induces exon 15 skipping during splicing, leading to the generation of a novel mRNA transcript that excludes exon 15. SSO111 sodium downregulated HER2 mRNA, which resulted in the inhibition of proliferation and induction of apoptosis in HER2-overexpressing tumor cells.
Inactive ASO (in vivo) sodium is an inactive Antisense Oligonucleotide. ASO is a class of oligonucleotide molecules, usually composed of 20-30 bases, used to interfere with or regulate gene expression. Inactive ASO (in vivo) sodium is not targeted in the rodent genome and can be used as a negative control for Tofersen. Inactive ASO (in vivo) sodium contains thiophosphate skeleton modification and MOE modification. Cytosine in Inactive ASO (in vivo) is 5' methylcytosine. See References for the location of chemical modifications
MDM4-targeting ASO sodium is a 25mer antisense oligonucleotide targeting?MDM4. MDM4-targeting ASO sodium induced exon 6 skipping, leading to nonsense-mediated decay of the mRNA transcript that excludes exon-6. In multiple human melanoma cell lines and in melanoma patient-derived xenograft (PDX) mouse models, MDM4-targeting ASO-mediated skipping of exon 6 decreased MDM4 abundance, inhibited melanoma growth, and enhanced sensitivity to MAPK-targeting therapeutics.
1,2-Dilinoleoyl-sn-glycero-3-phospho-L-serine sodium is a lipid compound that can be used for liposome preparation. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble loads can be captured in the internal aqueous space of liposomes, while lipophilic loads can be distributed into the lipid bilayer and become part of the lipid bilayer. Especially for the delivery of antisense oligonucleotides, it can overcome the problems of inefficient cellular uptake and rapid loss in the body.
1-Stearoyl-2-docosahexaenoyl-sn-glycero-3-phosphoethanolamine (18:0-22:6 PE) is a lipid compound that can be used for liposome preparation. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble loads can be captured in the internal aqueous space of liposomes, while lipophilic loads can be distributed into the lipid bilayer and become part of the lipid bilayer. Especially for the delivery of antisense oligonucleotides, it can overcome the problems of inefficient cellular uptake and rapid loss in the body.
BP Lipid 223 is an pentanolamine lipid (Compound 7) from patent WO2017075531A with both ester bonds located adjacent to C6 relative to the amine head. The introduction of ester linkages can improve the clearance of the lipid in the liver. This compound is analgous to ALC-0315. The lipid can be used to prepare mRNA nanocarriers with good balance of delivery efficiency and pharmakokinetics as well as rapid lipid clearance profile.
1-Myristoyl-2-palmitoyl-sn-glycero-3-phosphocholine (MPPC) is an asymmetrical phosphatidylcholine containing a myristic acid (14:0) at the sn-1 position and a palmitic acid (16:0) at the sn-2 position. It is commonly used in the generation of micelles, liposomes, and other types of artificial membranes.
6-(3-Hydroxypropylamino)hexyl 2-hexyldecanoate is an ionizable lipid which can be used to make ALC-0315. The lipid has an ester bond adjacent to C6 relative to the amine nitrogen. The introduction of ester linkages can improve the clearance of the lipid in the liver.
Cholesterol-PEG-alcohol (MW 2000) is a pegylated lipids which can be used for preparation of liposome or nanoparticle. The lipophilic moiety can encapsulate hydrophobic drugs whereas the hydrophilic PEG chain helps the overal water solubility of the micelles. The amine can react with an activated NHS ester to form a stable amide bond.
Cholesterol-PEG-MAL (MW 2000) is a PEG derivative and can be used to prepare liposome or nanoparticle due to its ability to self-assemble in water. The maleimide moiety is reactive with thiol molecule to form a covalent thioether bond.
1-Myristoyl-2-hydroxy-sn-glycero-3-PG sodium is a lysophospholipid containing myristic acid (14:0) at the sn-1 position. It has been used in the generation of micelles, liposomes, and other types of artificial membranes, including lipid-based drug carrier systems.
1,2-Dipalmitoyl-sn-glycero-3-phospho-N,N-dimethylethanolamine has been used in the generation of liposomes and monolayers for use in the study of membrane permeability and monolayer viscosity, respectively.
BP Lipid 109 is an amine lipid which has long (11 carbons) lipid tail on the primary ester. Both esters are located at C7 position and the head contains ethanolamine. It can be used to prepare liposome or lipid nanoparticles.
Cholesterol-PEG-Azide (MW 2000) is a pegylated lipids which can be used for preparation of liposome or nanoparticle. The lipophilic moiety can encapsulate hydrophobic drugs whereas the hydrophilic PEG chain helps the overal water solubility of the micelles. Cholesterol-PEG-Azide (MW 2000) can be reacted with alkyne via CuAAC or SPAAC click chemistry.
BP Lipid 126 is an amino ionizable lipid (Compound 143) from patent WO2017201333A1 with ester bonds located at C8 and C7 position relative to nitrogen. The ester linkages are introduced to improve tissue clearance. The ethanolamine head can effectively enhance mRNA encapsulation. BP Lipid 126 can be used in the generation of liposomes.
1,3-Dipalmitoyl-glycero-2-phosphoethanolamine is a phospholipid containing the saturated long-chain (16:0) stearic acid inserted at the sn-1 and sn-3 positions and PE at the sn-2 site. It can be used in the generation of micelles, liposomes, and other types of artificial membranes.
Cholesterol-PEG-Amine (MW 2000) is a pegylated lipids which can be used for preparation of liposome or nanoparticle. The lipophilic moiety can encapsulate hydrophobic drugs whereas the hydrophilic PEG chain helps the overal water solubility of the micelles.
2H-Cho-Arg (TFA) is a steroid-based cationic lipid that contains a 2H-cholesterol skeleton coupled to an L-arginine head group and can be used to facilitate gene transfection.
Cholesterol-PEG-Acid (MW 2000) is a polydisperse PEG derivative which can be used to create liposome as drug carrier for delivering therapeutic agents into tissues.
Bis(2-butyloctyl) 10-oxononadecanedioate is an ionizable lipid-like compound containing four hydrophobic tails bound by esters. It can be used to build lipids for mRNA encapsulation and delivery.
Cholesterol-PEG-methoxy, MW 2000 is a PEG derivative which self-assembles in water to form micelle-like structure. The cholesterol tail can be used to encapsulate hydrophobic drugs while the PEG chain ehances the water solubility of the micelles.
1,2-Dimyristoyl-sn-glycero-3-phospho-L-serine sodium is an anionic phospholipid with myristic acid tails (14:0) and contains a carboxylic acid (COOH) and amine (NH2) in their head group. It has been used in the preparation of liposome.
1-Palmitoyl-2-oleoyl-sn-glycero-3-phosphate is a phospholipid containing saturated palmitic acid (16:0) and monounsaturated oleic acid (18:1) inserted at the sn-1 and sn-2 positions, respectively. It can be used in the generation of micelles, liposomes, and other types of artificial membranes.
BP Lipid 112 is an amine lipid with two ester linkages at C6 and C7 position. The C6 ester has a long 11 carbons lipid tail. It can be used to prepare liposome or lipid nanoparticles.
Cholesterol-PEG-Vinylsulfone (MW 2000) is a thiol reactive polyPEG via thiol-ene reaction to form a thioether bond. It can self-assemble in water and is used to prepare liposome as drug vehicle for targeted delivery into tissues.
Cholesterol-PEG-Thiol (MW 3400) is an amphiphatic PEG derivative which forms micelles in water and can be used to prepare liposomes or nanoparticles for drug delivery system. The thiol moiety is reactive with maleimide to form a stable thioether bond.
SPPC is a phospholipid with different length of fatty acid. The sn-1 position contains a stearic acid (18:0) while the sn-2 position is occupied by a palmitic acid (16:0).
Bis(bis(2-carboxyethyl)aminopropyl)methylamine is a symmetrical branched linker featuring three tertiary amines and four carboxylic acids. Each carboxylic acid is open to forming esters or amides. It can be used in developing lipid nanoparticles.
BP Lipid 209 is an amine lipid which has a 9-carbons lipid tail on the primary ester. Both esters are located at C8 and C10 position relative to the amine nitrogen. It can be used to prepare liposome or lipid nanoparticles.
1-Palmitoyl-2-stearoyl-sn-glycero-3-phosphocholine is an assymetrical phospholipid containing saturated palmitic and stearic acid at the sn-1 and sn-2 position respectively. The phosphate group is attached to choline.
MPEG2000-DMG is a synthetic lipid comprised of polyPEG and dimyristoyl glycerol. It is used in the creation of lipid nanoparticles (LNPs) for mRNA vaccines.
DSPE-PEG-COOH, MW 2000 is a phospholipid polyPEG which can be used to prepare liposomes or nanoparticles. The terminal carboxylic acid can react with primary amine groups to form a stable amide bond.
DLPS is an anionic phospholipid with lauric acid tails (12:0) and contains a carboxylic acid (COOH) and amine (NH2) in their head group. It has been used in the preparation of lipid-mixing vesicles, liposome, or artificial membrane. Due to the medium size of fatty acid chain, DLPS is used to form thinner membranes/walls.
DOPE-PEG-Amine (MW 2000) is a polydisperse PEG covalently attached to a phospholipid. The polymer is an amphiphilic molecule with hydrophobic fatty acid chains and hydrophilic PEG head which enables lipid bilayer or micelle formation in water. The phospholipid PEG can be used to prepare liposome or nanoparticles for targeted drug delivery and is reactive with alkyne to form a triazole ring.
DOPE-PEG-Mal (MW 2000) is a phospholipid polyPEG which can be used to prepare liposomes or nanoparticles. It is also reactive with thiol at pH 6.5 tp 7.5 to form a stable thioether bond.
Amino-Gly-Gly-DSPE (hydrochloride) is a specially modified phospholipid that has been used to synthesize liposomes. The terminal amine is reactive with an NHS ester compound or carboxylic acid molecule in the presence of activator, such as HATU or EDC.
2-Arachidonoyl-sn-glycero-3-phosphocholine is a phospholipid molecule that is a major component of the plasma membrane. It is a phospholipid molecule that is involved in the regulation of membrane fluidity, signal transduction, cell-cell communication, and mediator of inflammation.
19:0 PC is a saturated phospholipid that has been used as a standard for the quantification of phosphatidylcholines in human synovial fluid. It has also been used to study dynamics of lipid bilayer phase transition.
1,2-PLPC is a phospholipid containing palmitoyl (16:0) and lauryl (12:0) acyl substituents at the sn-1 and sn-2 positions, respectively. It can be used in the generation of micelles, liposomes, and other types of artificial membranes.
Thiol-PEG-DMG, MW 2000 is a phospholipid polyPEG which can be used to prepare liposomes or nanoparticles. The terminal thiol group reacts with maleimide, OPSS, vinylsulfone and transition metal surfaces including gold, silver, etc.
mPEG-Cholesterol,MW 2000 is a PEG derivative which self-assembles in water to form micelle-like structure. The cholesterol tail can be used to encapsulate hydrophobic drugs while the PEG chain ehances the water solubility of the micelles.
DMPE-mPEG, MW 2000 is a PEGylated 1,2-Dimyristoyl-sn-glycero-3-phosphoethanolamine (14:0 PE) compound with a methyl group at the other end of the PEG chain. The PEG polymer exhibits amphiphatic behavior and helps to form stable micelles in an aqueous solution. It can be used to prepare nanoparticles or liposomes for targeted drug delivery applications.
DLPG is a phospholipid containing lauric acid (12 chain fatty acid) inserted at the sn-1 and sn-2 positions. Its phosphate group is attached to glycerol. It is used in the generation of micelles, liposomes, and other artificial membranes.
16:0 MPB PE is a maleimide-functionalized thiol-reactive lipid with a phosphoethanolamine linked to two palmitic acid tails and a phenyl maleimide group.
BP Lipid 227 is an ionizable lipid. It has primary esters at C5 position relative to the amine nitrogen. The primary lipid tail has an 8 carbon tail. BP Lipid 227 can be used in the generation of liposomes.
DOPE-Mal is a synthetic analog of naturally-occurring PE containing 18:1 fatty acids at the sn-1 and sn-2 positions with a terminal maliemide group. The maleimide group will react with a thiol group to form a covalent bond. The hydrophilic PEG spacer increases solubility in aqueous media.
BP Lipid 308 has a terminal tertiary amine group, a linoleic group, and a 4,4-bis(octyloxy)butanoic acid sodium salt tail. This compound can be useful for the building or modification of lipid nanoparticles.
Octadecanedioic Acid Mono-L-carnitine ester is a cationic lipid which may be used in combination with other lipids in the formation of lipid nanoparticles (LNPs). Its terminal carboxylic acid can react with primary amine groups in the presence of activators (e.g. HATU) to form a stable amide bond.
BP Lipid 229 is an amino ionizable lipid. It has primary esters at C7 position relative to the amine nitrogen. The primary lipid tail has 8 carbon tail. BP Lipid 229 can be used in the generation of liposomes.
BP Lipid 314 is an ionizable amino lipid featuring a dimethylamino head group, a carbamate linking to a central tertiary carbon with two other branches, a linoleate ester, and an aliphatic acetal ester.
tert-Butyl 3-(7-((undecan-3-yloxy)carbonyl)heptylamino)propylcarbamate is an aminolipid featuring a Boc-protected primary amine, a propylamine spacer attached to an octanoate chain and a C11 chain.
BP Lipid 315 is a cationic ionizable lipid ALC-0315 analogue featuring a Boc-protected primary amine, a central tertiary amine, and two ester tails located at the C8 position relative to the amine. One of these esters features a symmetrical branched C17 tail, while the other is an asymmetric C11 tail.
Inquiry Online
Your information is safe with us. * Required Fields.
![23:2 Diyne PE [DC(8,9)PE]](http://file.medchemexpress.eu/product_pic/hy-w800784.gif)
