Search Result

Pathways Recommended:	Cell Cycle/DNA Damage

Results for "

DNA binding

" in MedChemExpress (MCE) Product Catalog:

By Targets:	DNA Alkylator/Crosslinker (7) DNA Stain (6) DNA-PK (1) DNA/RNA Synthesis (26) ADC Cytotoxin (6) Androgen Receptor (4) Angiotensin-converting Enzyme (ACE) (2) Antibiotic (14) AP-1 (1) Apoptosis (23) Aryl Hydrocarbon Receptor (1) ATM/ATR (1) Autophagy (7) Bacterial (26) Bcl-2 Family (3) Biochemical Assay Reagents (3) c-Myc (3) Caspase (1) CMV (2) COX (2) Drug-Linker Conjugates for ADC (4) E1/E2/E3 Enzyme (1) Early 2 Factor (E2F) (1) EBV (2) Endogenous Metabolite (11) Epigenetic Reader Domain (1) Estrogen Receptor/ERR (2) Fat Mass and Obesity-associated Protein (FTO) (1) Fluorescent Dye (19) G-quadruplex (1) GABA Receptor (1) Glucocorticoid Receptor (1) Glutathione S-transferase (1) HBV (2) HDAC (2) HIF/HIF Prolyl-Hydroxylase (3) Histone Acetyltransferase (1) Histone Demethylase (4) Histone Methyltransferase (2) HIV (6) HSP (1) HSV (1) IFNAR (1) IGF-1R (2) IKK (1) Influenza Virus (1) Isotope-Labeled Compounds (4) JAK (1) MDM-2/p53 (8) Melatonin Receptor (1) MicroRNA (5) Microtubule/Tubulin (1) Mitophagy (1) MMP (2) NF-κB (12) Nucleoside Antimetabolite/Analog (3) Parasite (10) Progesterone Receptor (1) PROTACs (1) Proteasome (1) RAD51 (1) RAR/RXR (1) Reactive Oxygen Species (4) RET (1) Reverse Transcriptase (1) ROR (1) Sirtuin (1) STAT (6) Survivin (1) TGF-β Receptor (1) Topoisomerase (15)
By Research Areas:	Cancer (133) Cardiovascular Disease (3) Endocrinology (3) Infection (45) Inflammation/Immunology (21) Metabolic Disease (3) Neurological Disease (7)
Click Chemistry:	Azide (2)
Oligonucleotides:	Nucleosides and their Analogs (1) Nucleoside Phosphoramidites (1) Aptamers (3) Antisense Oligonucleotides (2)

207

Inhibitors & Agonists

Screening Libraries

Fluorescent Dye

Biochemical Assay Reagents

Peptides

MCE Kits

Inhibitory Antibodies

Natural
Products

Recombinant Proteins

Isotope-Labeled Compounds

Antibodies

Click Chemistry

Oligonucleotides

TO-PRO 1	DNA Stain	Cancer
TO-PRO 1 is a DNA binding fluorochrome, that atached to the surface of the Feraheme (FH) nanoparticle (NP), to obtain a fluorochrome-functionalized NP. TO-PRO 1 binds DNA through intercalation, and acts as a vital fluorochrome for necrotic cells .

Ochromycinone 3 Publications Verification (Rac)-STA-21	STAT Bacterial	Infection Cancer
Ochromycinone ((Rac)-STA-21) is a natural antibiotic and a STAT3 inhibitor. Ochromycinone can inhibits STAT3 DNA binding activity, STAT3 dimerization. Ochromycinone has anticancer and antimicrobial activity .

IT-901	NF-κB	Cancer
IT-901 is an orally active and potent NF-κB subunit c-Rel inhibitor with an IC₅₀ of 0.1 µM, 3 μM for NF-κB DNA binding and c-Rel DNA binding, respectively. IT-901, a bioactive naphthalenethiobarbiturate derivative, has the potential for human lymphoid tumors and ameliorate graft-versus-host disease (GVHD) .

Helenalin 5 Publications Verification	NF-κB	Inflammation/Immunology Cancer
Helenalin is an anti-inflammatory sesquiterpene lactone. Helenalin selectively inhibits transcription factor NF-κB by directly targeting p65. Helenalin has alkylating activity, targets the cysteine sulfhydryl groups in the p65 subunit of NF-κB, thereby inhibits its DNA binding .

AK-778-XXMU	Apoptosis	Cancer
AK-778-XXMU is a potent inhibitor of DNA Binding 2 (ID2) antagonist with a K_D of 129 nM. AK-778-XXMU can inhibit cell migration and invasion of glioma cell lines, induce apoptosis, and more importantly, slow down the tumor growth .

Dodecyltrimethylammonium bromide	Biochemical Assay Reagents	Others
Dodecyltrimethylammonium bromide (DTAB) is a surfactant. Dodecyltrimethylammonium bromide interacts with DNA and changes the mechanical properties of DNA on binding and the specific binding parameters of the interaction .

Anthragallol	Others	Cancer
Anthragallol can insert base pairs of DNA. Anthragallol exhibits cytotoxicity by binding to DNA .

Amonafide 3 Publications Verification AS1413	Topoisomerase	Cancer
Amonafide is a topoisomerase II inhibitor and DNA intercalator that induces apoptotic signaling by blocking the binding of Topo II to DNA.

DNA crosslinker 6	Parasite	Infection Cancer
DNA crosslinker 6 (compound 1) is an anti-kinetoplastid compound. DNA crosslinker 6 has a strong ability to bind AT-DNA and can inhibit the binding of AT-hook 1 to DNA (IC₅₀=0.03 µM). In addition, DNA crosslinker 6 also has antiprotozoal activity, with an EC₅₀ value of 0.83 µM for the inhibition of T. brucei .

3-Methyl-8-(2'-deoxy-β-D-ribofuranosyl)isoxanthopterin	Fluorescent Dye	Others
3-Methyl-8-(2'-deoxy-β-D-ribofuranosyl)isoxanthopterin is a DNA uptake tracer, a pteridine-based fluorescent guanosine analogue. 3-Methyl-8-(2'-deoxy-β-D-ribofuranosyl)isoxanthopterin is widely used in studies of DNA binding and dynamics, with an absorbance maximum at 350 nm and an emission maximum at 430 nm .

Irinotecan 40+ Cited Publications (+)-Irinotecan; CPT-11; VAL-413(free base)	Topoisomerase Autophagy	Cancer
Irinotecan ((+)-Irinotecan) is a topoisomerase I inhibitor, preventing religation of the DNA strand by binding to topoisomerase I-DNA complex .

PK11000	MDM-2/p53 DNA Alkylator/Crosslinker	Cancer
PK11000 is an alkylating agent, and stabilizes the DNA-binding domain of both WT and mutant p53 proteins by covalent cysteine modification without compromising DNA binding. PK11000 has anti-tumor activities .

DNA crosslinker 3 dihydrochloride	DNA Alkylator/Crosslinker	Cancer
DNA crosslinker 3 (dihydrochloride) (compound 1) is a potent DNA minor groove binder with DNA binding affinity (ΔT_m) of 1.4 °C. DNA crosslinker 3 (dihydrochloride) can be used for researching anticancer .

DNA crosslinker 1 dihydrochloride	DNA Alkylator/Crosslinker	Cancer
DNA crosslinker 1 dihydrochloride (Compound 4) is a potent DNA minor groove binder with DNA binding affinity (ΔT_m) of 1.1 °C. DNA crosslinker 1 dihydrochloride can be used for researching anticancer .

Dodecyltrimethylammonium-d25 bromide	Isotope-Labeled Compounds	Others
Dodecyltrimethylammonium-d₂₅ (bromide) is the deuterium labeled Dodecyltrimethylammonium (bromide)[1]. Dodecyltrimethylammonium bromide (DTAB) is a surfactant. Dodecyltrimethylammonium bromide interacts with DNA and changes the mechanical properties of DNA on binding and the specific binding parameters of the interaction[2].

Dodecyltrimethylammonium-d34(bromide)	Isotope-Labeled Compounds	Others
Dodecyltrimethylammonium-d₃₄ (bromide) is the deuterium labeled Dodecyltrimethylammonium (bromide)[1]. Dodecyltrimethylammonium bromide (DTAB) is a surfactant. Dodecyltrimethylammonium bromide interacts with DNA and changes the mechanical properties of DNA on binding and the specific binding parameters of the interaction[2].

p53 CBS p53 Consensus binding sequence	MDM-2/p53	Others
p53 CBS (p53 Consensus binding sequence) is a biological active peptide. (p53 consensus DNA binding site)

Haplopine	Bacterial	Infection
Haplopine possesses photo-activated antimicrobial and DNA binding activities .

Methylproamine 1 Publications Verification	DNA/RNA Synthesis	Others
Methylproamine is a DNA-binding radioprotector, acts by repair of transient radiation-induced oxidative species on DNA. Methylproamine also protects against ionizing radiation by preventing DNA double-strand breaks .

Mycro1	Others	Cancer
Mycro1 is an inhibitor of c-Myc/Max dimer and DNA binding, with an IC₅₀ value of 30 μM for the inhibition of Myc/Max DNA binding activity. Mycro1 can inhibit c-myc-dependent cell proliferation, gene transcription and oncogenic transformation .

Mycro2	Others	Cancer
Mycro2 is an inhibitor of c-Myc/Max dimer and DNA binding, with an IC₅₀ value of 23 μM for the inhibition of Myc/Max DNA binding activity. Mycro2 can inhibit c-myc-dependent cell proliferation, gene transcription and oncogenic transformation .

Ametantrone NSC 196473; NSC 290813	DNA/RNA Synthesis	Cancer
Ametantrone (NSC 196473) is an antitumor agent that intercalates into DNA and induces topoisomerase II (TOP2)-mediated DNA break .

Ametantrone acetate NSC 196473 acetate; NSC 290813 acetate	DNA/RNA Synthesis	Cancer
Ametantrone acetate (NSC 196473 acetate) is an antineoplastic drug with topoisomerase II inhibitory activity. Ametantrone acetate causes covalent cross-linking of DNA. The pharmacokinetic profile of Ametantrone acetate has been confirmed in clinical trials, and its elimination pathway in the body indicates the existence of a major metabolic pathway .

DNA gyrase B-IN-1	DNA/RNA Synthesis Bacterial	Infection
DNA gyrase B-IN-1 (compound 13) is a potent DNA gyrase B inhibitor. DNA gyrase B-IN-1 shows inhibition of P. aeruginosa DNA gyrase B, with an IC₅₀ of 2.2 μM. DNA gyrase B-IN-1 has good binding affinity and stability .

Deoxyribonucleic acid sodium, from calf thymus, Type I, fibers 1 Publications Verification ctDNA sodium, Type I, fibers; DNA sodium, from calf thymus, Type I, fibers; Thymonucleic acid sodium, Type I, fibers	Biochemical Assay Reagents	Others Cancer
Deoxyribonucleic acid sodium, from calf thymus, Type I, fibers is the sodium salts form of Calf thymus DNA (HY-109517). Calf thymus DNA is a double-stranded template DNA isolated from calf thymus. It can be used to study the interaction between DNA and DNA binding agents, as well as the structure and function of DNA, for DNA quantification and used as a substrate for DNA polymerase analysis, etc .

Lexitropsin	Others	Others
Lexitropsin is a netropsin derivative which is determined the binding and specificity properties in interaction with DNA and synthetic polynucleotides .

DNA2 inhibitor C5 5+ Cited Publications	Others	Cancer
DNA2 inhibitor C5 is a potent, competitive and specific inhibitor of DNA2 nuclease activity with an IC₅₀ of 20 μM. DNA2 inhibitor C5 inhibits nuclease, DNA dependent ATPase, helicase, and DNA binding activities of DNA2. DNA2 inhibitor C5 is a promising lead compound to develop sensitizers for cancer chemotherapeutics that cause replication stress .

Irinotecan-d10 hydrochloride	Isotope-Labeled Compounds Topoisomerase Autophagy	Cancer
Irinotecan-d₁₀ (hydrochloride) is the deuterium labeled Irinotecan. Irinotecan ((+)-Irinotecan) is a topoisomerase I inhibitor, preventing religation of the DNA strand by binding to topoisomerase I-DNA complex[1][2].

Irinotecan-d10 (+)-Irinotecan-d₁₀; CPT-11-d₁₀; VAL-413-d₁₀	Topoisomerase Autophagy	Cancer
Irinotecan-d₁₀ is a deuterium labeled Irinotecan ((+)-Irinotecan). Irinotecan ((+)-Irinotecan) is a topoisomerase I inhibitor, preventing religation of the DNA strand by binding to topoisomerase I-DNA complex[1].

DNA crosslinker 2 dihydrochloride	DNA Alkylator/Crosslinker	Cancer
DNA crosslinker 2 (dihydrochloride) is a potent DNA minor groove binder with DNA binding affinity (ΔT_m) of 1.2 °C. DNA crosslinker 2 (dihydrochloride) has certain inhibitory activity against cancer cells NCI-H460, A2780 and MCF-7. DNA crosslinker 2 (dihydrochloride) can be used for researching anticancer .

Irinotecan (Standard)	Topoisomerase Autophagy	Cancer
Irinotecan (Standard) is the analytical standard of Irinotecan. This product is intended for research and analytical applications. Irinotecan ((+)-Irinotecan) is a topoisomerase I inhibitor, preventing religation of the DNA strand by binding to topoisomerase I-DNA complex .

NSC15520	Others	Cancer
NSC15520 is a small molecular inhibitor of Replication Protein A (RPA). NSC15520 specifically recognizes the RPA N-terminal DNA binding domain (DBD), and blocks the interaction of RPA with p53 or RAD9. NSC15520 also inhibtis helix destabilization of a duplex DNA (dsDNA) oligonucleotide, involves in DNA replication, DNA repair, DNA recombination, and DNA damage response signaling .

Demycarosyl-3D-β-D-digitoxosylmithramycin SK	DNA/RNA Synthesis	Cancer
Demycarosyl-3D-β-D-digitoxosylmithramycin SK is a Mithramycin analog with good anti-tumor activity, which can prevent the proliferation and growth of tumor cells by binding and inhibiting DNA-binding proteins .

Thiacloprid	Parasite DNA Stain	Infection
Thiacloprid, a chloronicotinyl insecticide, is targeted chiefly to control aphid pest species in orchards and vegetables . Thiacloprid destabilizes DNA. Thiacloprid changes the structure and stability of DNA through binding into the minor groove by hydrophobic or hydrogen interactions .

3-Deaza-2'-deoxyadenosine	HSV	Infection
3-Deaza-2 '-deoxyadenosine is a nucleoside analog synthesized from 2' -deoxyadenosine. 3-Deaza-2 '-deoxyadenosine inhibits RNA synthesis by binding to ribose fragments of ribonucleotides, thereby preventing the formation of enzyme-substrate complexes, thereby preventing chain elongation, It can also inhibit DNA synthesis by binding deoxyribose fragments of DNA and preventing DNA polymerase from adding nucleotides to the growth chain. 3-Deaza-2 '-deoxyadenosine has antiviral activity .

MC-DOXHZN (E/Z)-Aldoxorubicin; Doxorubicin(6-maleimidocaproyl)hydrazone	Topoisomerase Drug-Linker Conjugates for ADC	Cancer
MC-DOXHZN ((E/Z)-Aldoxorubicin) is an albumin-binding proagent of Doxorubicin (DNA topoisomerase II inhibitor), with acid-sensitive properties .

MC-DOXHZN hydrochloride 5 Publications Verification (E/Z)-Aldoxorubicin hydrochloride; Doxorubicin(6-maleimidocaproyl)hydrazone hydrochloride	Topoisomerase Drug-Linker Conjugates for ADC	Cancer
MC-DOXHZN ((E/Z)-Aldoxorubicin) hydrochloride is an albumin-binding proagent of Doxorubicin (DNA topoisomerase II inhibitor), with acid-sensitive properties .

Antitrypanosomal agent 7	Parasite	Infection
Antitrypanosomal agent 7 (compound 18c) is a potent and antitrypanosomal agent with favorable ADME properties. Antitrypanosomal agent 7 is > 2-fold more potent against *Trypanosoma brucei* (T. brucei) than Nifurtimox, with an IC₅₀ value of 0.71 μM. Antitrypanosomal agent 7 has strong interaction to DNA and can bind with high selectivity to AT-rich DNA .

Antitrypanosomal agent 6	Parasite	Infection
Antitrypanosomal agent 6 (compound 18a) is a potent and antitrypanosomal agent with favorable ADME properties. Antitrypanosomal agent 6 is > 2-fold more potent against *Trypanosoma brucei* (T. brucei) than Nifurtimox, with an IC₅₀ value of 0.47 μM. Antitrypanosomal agent 6 has strong interaction to DNA and can bind with high selectivity to AT-rich DNA .

ST166 free acid	Bacterial	Infection
ST166 free acid is a inhibitor of formation of the PhoP-DNA complex with the IC₅₀ values of 18 and 24 μM against PhoP and MtrAC binding with DNA, respectively. ST166 free acid shows antibacterial activity against Macrobacterium marinum .

Amonafide dihydrochloride AS1413 dihydrochloride	Topoisomerase	Others
Amonafide dihydrochloride (AS1413 dihydrochloride) is a topoisomerase II (Topo II) inhibitor and DNA intercalator with activity in inducing apoptotic signaling. Amonafide dihydrochloride can inhibit the binding of Topo II to DNA, thereby preventing the synthesis of DNA and RNA. Amonafide dihydrochloride maintains cytotoxic activity in the presence of P-glycoprotein-mediated multidrug resistance (MDR) .

7-Acetoxy-4-methylcoumarin 4-Methylumbelliferyl acetate	Glutathione S-transferase	Others
7-Acetoxy-4-methylcoumarin is an inhibitor of GST.7-Acetoxy-4-methylcoumarin inhibits AFB1-DNA binding in vitro with 36.7% inhibition .

FUBP1-IN-1 2 Publications Verification	Others	Cancer
FUBP1-IN-1 is a potent *FUSE binding* protein 1 (FUBP1)** inhibitor which interferes with the binding of FUBP1 to its single stranded target DNA FUSE sequence , with an IC₅₀ value of 11.0 μM .

Coralyne chloride	Topoisomerase	Cancer
Coralyne chloride is a protoberberine alkaloid with potent anti-cancer activities. Coralyne chloride acts as a potent topoisomerase I poison and induces Top I mediated DNA cleavage . Coralyne chloride can be used for preparing coralyne derivatives as DNA binding fluorescent probes .

E-982 1 Publications Verification	Others	Others
E-982 is a steroid used for the on-line screening of the DNA unwinding element binding protein (DUE-B) immobilized protein column .

5'-O-DMT-ibu-rG 5'-O-DMT-N2-isobutyrylguanosine	Nucleoside Antimetabolite/Analog	Others Cancer
5'-O-DMT-ibu-rG is a useful model for a new class of DNA binding molecules for the development of potent and selective anti-cancer agents .

Cat. No.	Product Name

HY-L008

JAK/STAT Compound Library

439 compounds

The Janus kinase (JAK)/signal transducer and activator of transcription (STAT) pathway is central to signaling by cytokine receptors, a superfamily of more than 30 transmembrane proteins that recognize specific cytokines, and is critical in blood formation and immune response. Canonical JAK/STAT signaling begins with the association of cytokines and their corresponding transmembrane receptors. Activated JAKs then phosphorylate latent STAT monomers, leading to dimerization, nuclear translocation, and DNA binding. In mammals, there are four JAKs (JAK1, JAK2, JAK3, TYK2) and seven STATs (STAT1, STAT2, STAT3, STAT4, STAT5a, STAT5b, STAT6). Since the JAK/STAT pathway plays a major role in many fundamental processes, such as apoptosis and inflammation, dysfunctional proteins in the pathway may lead to a number of diseases. For example, alterations in JAK/STAT signalling can result in cancer and diseases affecting the immune system, such as severe combined immunodeficiency disorder (SCID).

MCE provides 439 compounds that can be used in the study of the JAK/STAT signaling pathway and related diseases.

Cat. No.	Product Name	Type

HY-D0917

TO-PRO 1	DNA Stain
TO-PRO 1 is a DNA binding fluorochrome, that atached to the surface of the Feraheme (FH) nanoparticle (NP), to obtain a fluorochrome-functionalized NP. TO-PRO 1 binds DNA through intercalation, and acts as a vital fluorochrome for necrotic cells .

HY-135009

2-Di-1-ASP DASPI	Fluorescent Dyes/Probes
2-Di-1-ASP (DASPI; Compound 18a) is a mono-stryryl dye, and widely used as mitochondrial stain and groove-binding fluorescent probes for double-stranded DNA. 2-Di-1-ASP is selective for G-quadruplex (G4) and double-stranded DNA .

HY-147114

3-Methyl-8-(2'-deoxy-β-D-ribofuranosyl)isoxanthopterin	Fluorescent Dyes/Probes
3-Methyl-8-(2'-deoxy-β-D-ribofuranosyl)isoxanthopterin is a DNA uptake tracer, a pteridine-based fluorescent guanosine analogue. 3-Methyl-8-(2'-deoxy-β-D-ribofuranosyl)isoxanthopterin is widely used in studies of DNA binding and dynamics, with an absorbance maximum at 350 nm and an emission maximum at 430 nm .

HY-D1773

YOYO-3	Fluorescent Dyes/Probes
YOYO-3 is a cell-impermeant dye with far-red fluorescence used as nulear counterstain and dead cell indicator. It generates bright fluorescence upon binding to DNA.

HY-D1337

Cyanine7 carboxylic acid chloride	Fluorescent Dyes/Probes
Cyanine7 carboxylic acid chloride belongs to the cyanine dye series and is a common fluorescent marker for biomolecules that can interact with biomolecules. Cyanine dyes may also bind to double-helical DNA through intercalation and exhibit enhanced fluorescence upon binding.

HY-D1326

Cyanine3 carboxylic acid	Fluorescent Dyes/Probes
Cyanine3 carboxylic acid belongs to the cyanine dye series and is a common fluorescent marker for biomolecules that can interact with biomolecules. Cyanine dyes may also bind to double-helical DNA through intercalation and exhibit enhanced fluorescence upon binding.

HY-D1316

Cyanine7 azide chloride	Fluorescent Dyes/Probes
Cyanine7 azide chloride belongs to the cyanine dye series and is a common fluorescent marker for biomolecules that can interact with biomolecules. Cyanine dyes may also bind to double-helical DNA through intercalation and exhibit enhanced fluorescence upon binding.

HY-D1097

Cyanine 3.18	Dyes
Cyanine 3.18 belongs to the cyanine dye series and is a common fluorescent marker for biomolecules that can interact with biomolecules. Cyanine dyes may also bind to double-helical DNA through intercalation and exhibit enhanced fluorescence upon binding.

HY-D1095

Cy7 DiAcid	Dyes
Cy7 DiAcid belongs to the cyanine dye series and is a common fluorescent marker for biomolecules that can interact with biomolecules. Cyanine dyes may also bind to double-helical DNA through intercalation and exhibit enhanced fluorescence upon binding.

HY-D1339

Cyanine7 hydrazide dichloride	Fluorescent Dyes/Probes
Cyanine7 hydrazide dichloride belongs to the cyanine dye series and is a common fluorescent marker for biomolecules that can interact with biomolecules. Cyanine dyes may also bind to double-helical DNA through intercalation and exhibit enhanced fluorescence upon binding.

HY-D1047

Cy2 DiC18	Dyes
Cy2 DiC18 belongs to the cyanine dye series and is a common fluorescent marker for biomolecules that can interact with biomolecules. Cyanine dyes may also bind to double-helical DNA through intercalation and exhibit enhanced fluorescence upon binding.

HY-D0968A

Cy 3 (Non-Sulfonated) (potassium) Cyanine3 potassium	Dyes
Cy 3 (Non-Sulfonated) potassium belongs to the cyanine dye series and is a common fluorescent marker for biomolecules that can interact with biomolecules. Cyanine dyes may also bind to double-helical DNA through intercalation and exhibit enhanced fluorescence upon binding.

HY-D1415

Cyanine 5 Bisfunctional MTSEA Dye potassium	Fluorescent Dyes/Probes
Cyanine 5 Bisfunctional MTSEA Dye potassium belongs to the cyanine dye series and is a common fluorescent marker for biomolecules that can interact with biomolecules. Cyanine dyes may also bind to double-helical DNA through intercalation and exhibit enhanced fluorescence upon binding.

HY-D1414

Cyanine 3 Bisfunctional MTSEA Dye potassium	Fluorescent Dyes/Probes
Cyanine 3 Bisfunctional MTSEA Dye potassium belongs to the cyanine dye series and is a common fluorescent marker for biomolecules that can interact with biomolecules. Cyanine dyes may also bind to double-helical DNA through intercalation and exhibit enhanced fluorescence upon binding.

HY-D1097A

Cyanine 3.18 TEA	Dyes
Cyanine 3.18 TEA belongs to the cyanine dye series and is a common fluorescent marker for biomolecules that can interact with biomolecules. Cyanine dyes may also bind to double-helical DNA through intercalation and exhibit enhanced fluorescence upon binding .

HY-D1322

Cyanine5.5 NHS ester tetrafluoroborate	Fluorescent Dyes/Probes
Cyanine5.5 NHS ester tetrafluoroborate belongs to the cyanine dye series and is a common fluorescent marker for biomolecules that can interact with biomolecules. Cyanine dyes may also bind to double-helical DNA through intercalation and exhibit enhanced fluorescence upon binding.

HY-D2208

SYTM Green	Fluorescent Dyes/Probes
SYTM Green is a permeable DNA dye that fluoresces green by binding to dsDNA. SYTM Green can also be used to stain bacteria, including Gram-positive and Gram-negative bacteria. Note: SYTM Green cannot penetrate living cells, and this product is equivalent to SYTOX Green .

HY-D0916

Thiazole orange dimer YOYO 1

YOYO 1; YOYO1

Dyes

Thiazole orange dimer YOYO 1 is a green fluorescent dye used for DNA staining. It belongs to the monomethine cyanine dye family and is a tetracationic homodimer of oxazole yellow (abbreviated as YO, hence the name YOYO), usually provided as a tetraiodide salt. In aqueous buffer, the free YOYO-1 dye (λmax 458 nm; λmax 564 nm) has a very low fluorescence quantum yield, but after binding to double-stranded DNA through diintercalation, the fluorescence intensity is increased by 3200 times (λmax 489 nm; λmax 509 nm).

HY-D1444

Propidium monoazide

DNA Stain

Propidium monoazide is a photoreactive DNA-binding dye that preferentially binds to dsDNA. Propidium monoazide (PMA) prevents DNA from dead bacteria from being amplified during the PCR. PMA-PCR enhanced both the specificity and the sensitivity of PCR . Propidium monoazide is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. It can also undergo strain-promoted alkyne-azide cycloaddition (SPAAC) reactions with molecules containing DBCO or BCN groups.

HY-D0996

LDS-751

DNA Stain

Lds-751 is a nucleic acid stain that mainly detects DNA. Lds-751 is a nucleic acid stain that mainly detects DNA. Lds-751 has a high affinity for DNA and fluorescence is enhanced after binding, but the maximum emission wavelength is 670nm. Lds-751 and Thiazole orange can be used for the differentiation of red blood cells, platelets, reticulocytes, and nucleated cells and can be stimulated at 488nm. Studies have shown that LDS-751 binds almost exclusively to mitochondria when incubated with nucleated living cells. After nucleated Acridine Orange (HY-101879) staining and LDS-751 treatment of cells, confocal microscopy revealed almost no co-location of the cells. Staining with Rhodamine 123 (HY-D0816), a dye known to bind polarized mitochondria, was almost identical to the pattern observed with LDS-751 .

Cat. No.	Product Name	Type

HY-D0838

Dodecyltrimethylammonium bromide	Biochemical Assay Reagents
Dodecyltrimethylammonium bromide (DTAB) is a surfactant. Dodecyltrimethylammonium bromide interacts with DNA and changes the mechanical properties of DNA on binding and the specific binding parameters of the interaction .

HY-15620

Methylproamine 1 Publications Verification	Gene Sequencing and Synthesis
Methylproamine is a DNA-binding radioprotector, acts by repair of transient radiation-induced oxidative species on DNA. Methylproamine also protects against ionizing radiation by preventing DNA double-strand breaks .

Cat. No.	Product Name	Target	Research Area

HY-126327A

UNC4976 TFA	Histone Methyltransferase	Cancer
UNC4976 TFA is a positive allosteric modulator (PAM) peptidomimetic of CBX7 chromodomain binding to nucleic acids. UNC4976 TFA simultaneously antagonizes H3K27me3-specific recruitment of CBX7 to target genes while increasing non-specific binding to DNA and RNA .

HY-P10280

ATR kinase substrate peptide	ATM/ATR	Cancer
ATR kinase substrate peptide (compound 45) is a potent and selective inhibitor of ATR (Ataxia Telangiectasia and Rad3 related) protein kinase (K_i=6 nM). ATR kinase substrate peptide inhibits ATR activity by competing with ATR kinase ATP-binding sites to block ATR mediated signaling. ATR kinase substrate peptide can be used to study the role of ATR kinase in DNA damage response .

HY-P5343

p53 CBS p53 Consensus binding sequence	MDM-2/p53	Others
p53 CBS (p53 Consensus binding sequence) is a biological active peptide. (p53 consensus DNA binding site)

HY-119782

L-Argininamide	Fluorescent Dye	Others
L-Argininamide is a hydrophilic amino acid derivative and can be used as a compound for ligand binding DNA aptamers. L-Argininamide has the potential for fluorescent aptasensors development .

HY-126327

UNC4976	Histone Methyltransferase	Cancer
UNC4976 is a positive allosteric modulator (PAM) peptidomimetic of CBX7 chromodomain binding to nucleic acids. UNC4976 simultaneously antagonizes H3K27me3-specific recruitment of CBX7 to target genes while increasing non-specific binding to DNA and RNA .

HY-P4161

KWWCRW	DNA/RNA Synthesis	Cancer
KWWCRW is a Holliday linker inhibitory peptide with anticancer activity. KWWCRW inhibits homologous recombination repair (HDR) during DNA repair by binding to the reactive Holliday linker intermediate and preventing its degradation, and inhibits site-specific recombination by bacteriophage in vitro .

Cat. No.	Product Name

HY-KE8006

Terminal Deoxynucleotidyl Transferase (TdT)
Terminal Deoxynucleotidyl Transferase (TdT) is a template-independent DNA polymerase that catalyzes the binding of deoxynucleotides to the 3' hydroxyl end of oligonucleotides, single-stranded DNA, or double-stranded DNA.

Cat. No.	Product Name	Target	Research Area

HY-P99666

Interferon alfa	IFNAR	Infection Cancer
Albinterferon alfa-2b is a type I interferon that activates novel genes and exerts potent antiviral and antiproliferative activity on target cells. Signaling by Albinterferon alfa-2b requires receptor-dependent activation of Stat1 and Stat2 to form a heterodimeric STAT that binds to the DNA-binding protein IRF-9 (p48) and forms ISGF-3 (IFN-stimulated gene factor 3). The driver genes are then further activated by ISGF-3 to achieve antiviral function .

HY-P990021

Calpurbatug	Inhibitory Antibodies	Others
Calpurbatug is an immunoglobulin G1 antibody. Calpurbatug has activity with anti-bacterial DNA-binding protein DNABII family and anti-human monoclonal TRL1068 γ1-chain .

Species:	Human (24) Mouse (1) Xenopus laevis (1) E.coli (1)
Tag:	SUMO (2) His (19) Strep (6) Tag Free (8) Avi (3) Myc (1) GST (1) Flag (1)
Source:	HEK293 (3) P. pastoris (2) Sf9 insect cells (3) E. coli (23)

Cat. No.	Compare	Product Name	Species	Source

HY-P71497

	DNA-binding protein HU-alpha Protein, E.coli (His-SUMO) hupA; Z5576; ECs4923DNA-binding protein HU-alpha; HU-2; NS2	E.coli	E. coli
	DNA-binding protein HU-alpha, a histone-like DNA-binding protein, wraps DNA, offering stabilization and preventing denaturation in challenging conditions. Comprising alpha and beta chains in a heterodimer, it demonstrates versatile DNA binding and protective functions. DNA-binding protein HU-alpha Protein, E.coli (His-SUMO) is the recombinant E. coli-derived DNA-binding protein HU-alpha protein, expressed by E. coli , with N-SUMO, N-6*His labeled tag.

HY-P71788

	TARDBP Protein, Human (P.pastoris, His) ALS10; TAR DNA binding protein 43; TAR DNA binding protein; TAR DNA-binding protein 43; TARDBP; TDP 43; TDP-43; TDP43	Human	P. pastoris
	TARDBP protein is an RNA-binding factor with RRM1 and RRM2 that binds GU repeats and regulates RNA splicing in long introns and 3'UTRs.It affects proteins critical for neuronal survival and neurodegenerative diseases.TARDBP Protein, Human (P.pastoris, His) is the recombinant human-derived TARDBP protein, expressed by P.pastoris , with N-6*His labeled tag.

HY-P702825

	CRBN-DDB1 Protein, Human (sf9, His, Avi) Protein cereblon; CRBN; AD-006; DNA damage-binding protein 1; DDB p127 subunit; XAP1; UV-damaged DNA-binding factor; HBV X-associated protein 1 (XAP-1); Damage-specific DNA-binding protein 1; DDBa	Human	Sf9 insect cells
	CRBN-DDB1 Protein, Human (sf9, His, Avi) is the recombinant human-derived CRBN-DDB1, expressed by Sf9 insect cells , with N-His, N-Avi labeled tag. ,

HY-P703506

	DNA polymerase Protein, Pyrococcus woesei (His) fusion Pfu DNA polymerase-GTH-Sso7d; DNA polymerase; Pwo polymerase; pol; Pyrococcus woesei; DNA-binding; DNA-directed DNA polymerase; Endonuclease; Hydrolase; Nuclease; Nucleotidyltransferase; Transferase; 2.7.7.7	Others	E. coli
	DNA polymerase Protein, Pyrococcus woesei (His) is the recombinant DNA polymerase, expressed by E. coli , with His labeled tag. ,

HY-P701614

	WDHD1 Protein, Human (HEK293, FLAG) WDHD1; WD repeat and HMG-box DNA-binding protein 1; Acidic nucleoplasmic DNA-binding protein 1; And-1	Human	HEK293
	WDHD1 Protein is a core replisome component that serves as a replication initiation factor. It directly binds to the CMG complex, acting as a hub to recruit other proteins to the replication fork. WDHD1 interacts with POLA1, MCM10, DNA2, CDC45, and GINS2, linking it to the CMG helicase complex. WDHD1 Protein, Human (HEK293, FLAG) is the recombinant human-derived WDHD1 protein, expressed by HEK293 , with C-Flag labeled tag. The total length of WDHD1 Protein, Human (HEK293, FLAG) is 1128 a.a., .

HY-P702851

	CRBN-DDB1 Protein, Human (sf9, Avi) Protein cereblon; CRBN; AD-006; DNA damage-binding protein 1; DDB p127 subunit; XAP1; UV-damaged DNA-binding factor; HBV X-associated protein 1 (XAP-1); Damage-specific DNA-binding protein 1; DDBa	Human	Sf9 insect cells
	CRBN-DDB1 Protein, Human (sf9, Avi) is the recombinant human-derived CRBN-DDB1, expressed by Sf9 insect cells , with Avi labeled tag. ,

HY-P701615

	WDHD1 Protein, Human (HEK293, His, Strep) WDHD1; WD repeat and HMG-box DNA-binding protein 1; Acidic nucleoplasmic DNA-binding protein 1; And-1	Human	HEK293
	WDHD1 Protein is a core replisome component that serves as a replication initiation factor. It directly binds to the CMG complex, acting as a hub to recruit other proteins to the replication fork. WDHD1 interacts with POLA1, MCM10, DNA2, CDC45, and GINS2, linking it to the CMG helicase complex. WDHD1 Protein, Human (HEK293, His, Strep) is the recombinant human-derived WDHD1 protein, expressed by HEK293 , with N-10*His, N-Strep labeled tag. The total length of WDHD1 Protein, Human (HEK293, His, Strep) is 1128 a.a., .

HY-P702850

	CRBN-DDB1 Protein, Human (Biotinylated, sf9, Avi) Protein cereblon; CRBN; AD-006; DNA damage-binding protein 1; DDB p127 subunit; XAP1; UV-damaged DNA-binding factor; HBV X-associated protein 1 (XAP-1); Damage-specific DNA-binding protein 1; DDBa	Human	Sf9 insect cells

HY-P703358

	SOX17 Protein, Human Transcription factor SOX-17; SOX17; Homo sapiens; Human; Activator; DNA-binding	Human	E. coli
	SOX17 Protein, Human is the recombinant human-derived SOX17, expressed by E. coli , with tag Free labeled tag. ,

HY-P703133

	GATA2 Protein, Human (His, Strep) Endothelial transcription factor GATA-2; GATA-binding protein 2; GATA2; Homo sapiens; Human; Activator; DNA-binding	Human	E. coli
	GATA2 Protein, Human (His, Strep) is the recombinant human-derived GATA2, expressed by E. coli , with Strep, His labeled tag. The total length of GATA2 Protein, Human (His, Strep) is 110 a.a.,

HY-P71177

	Nucleobindin-2 Protein, Human Nucleobindin-2; DNA-binding protein NEFA; Gastric cancer antigen Zg4; Prepronesfatin; Nesfatin-1; NUCB2; NEFA	Human	E. coli
	Nucleobindin-2 protein is a calcium-binding molecule that may contribute to calcium homeostasis and act as a non-receptor guanine nucleotide exchange factor. Its interaction with the guanine nucleotide-binding protein (G protein) α subunit GNAI3 suggests its role in activating the G protein signaling pathway. Nucleobindin-2 Protein, Human is the recombinant human-derived Nucleobindin-2 protein, expressed by E. coli , with tag free.

HY-P703440

	RAD51 Protein, Pyrococcus furiosus DNA repair and recombination protein RadA; radA; Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1); DNA-binding	Others	E. coli
	RAD51 Protein, Pyrococcus furiosus is the recombinant RAD51, expressed by E. coli , with tag Free labeled tag. ,

HY-P703460

	Histone-H3 Protein, Xenopus laevis Histone H3; LOC121398065; LOC108703785; LOC121398067; Xenopus laevis; African clawed frog; DNA-binding	Xenopus laevis	E. coli
	Histone-H3 Protein, Xenopus laevis is the recombinant Xenopus laevis-derived Histone-H3, expressed by E. coli , with tag Free labeled tag. The total length of Histone-H3 Protein, Xenopus laevis is 136 a.a.,

HY-P703152

	IRF1 Protein, Human (His, Strep) Interferon regulatory factor 1; IRF1; Homo sapiens; Human; IRF-1; Activator; DNA-binding; Repressor	Human	E. coli
	IRF1 Protein, Human (His, Strep) is the recombinant human-derived IRF1, expressed by E. coli , with Strep, His labeled tag. ,

HY-P71588

	CHD1L Protein, Human (His-SUMO) ALC1; Amplified in liver cancer 1; Amplified in liver cancer protein 1; chd1l; CHD1L_HUMAN; CHDL; Chromodomain helicase DNA binding protein 1 like; Chromodomain-helicase-DNA-binding protein 1-like; FLJ22530	Human	E. coli
	CHD1L protein is the ATP-binding subunit of the mitochondrial potassium channel and cooperates with CCDC51/MITOK to form a complex to promote ATP-dependent potassium current across the inner membrane (mitoK(ATP) channel). ABCB8 is essential for mitochondrial iron transport, affects cardiac function, and regulates the maturation of cytosolic iron-sulfur-containing enzymes. CHD1L Protein, Human (His-SUMO) is the recombinant human-derived CHD1L protein, expressed by E. coli , with N-His, N-SUMO labeled tag. The total length of CHD1L Protein, Human (His-SUMO) is 194 a.a., with molecular weight of ~37.3 kDa.

HY-P703439

	RAD51 Protein, Pyrococcus furiosus(del R288-G301) DNA repair and recombination protein RadA; radA; Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1); DNA-binding	Others	E. coli
	RAD51 Protein, Pyrococcus furiosus(del R288-G301) is the recombinant RAD51, expressed by E. coli , with tag Free labeled tag. ,

HY-P71135

	NFYA Protein, Human Nuclear Transcription Factor Y Subunit Alpha; CAAT Box DNA-binding Protein Subunit A; Nuclear Transcription Factor Y Subunit A; NF-YA; NFYA	Human	E. coli
	The NFYA protein is a component of the NF-Y transcription factor and recognizes the 5'-CCAAT-3' box motif in gene promoters. NFYA functions as an activator or repressor depending on the interacting cofactors. NFYA Protein, Human is the recombinant human-derived NFYA protein, expressed by E. coli , with tag free. The total length of NFYA Protein, Human is 318 a.a., with molecular weight of 40 & 60 & 70 kDa, respectively.

HY-P702630

	FUS Protein, Human (His, Myc) RNA-binding protein FUS; 75 kDa DNA-pairing protein; Oncogene FUS; Oncogene TLS; POMp75; Translocated in liposarcoma protein; TLS	Human	E. coli
	FUS Protein, Human (His, Myc) is the recombinant human-derived FUS, expressed by E. coli , with N-10*His, C-Myc labeled tag. The total length of FUS Protein, Human (His, Myc) is 526 a.a.,

HY-P702822

	YBX1 Protein, Mouse (P.pastoris, His) Ybx1; Msy-1; Msy1; Nsep1; Yb1; Y-box-binding protein 1; YB-1; CCAAT-binding transcription factor I subunit A; CBF-A; DNA-binding protein B; DBPB; Enhancer factor I subunit A; EFI-A; Nuclease-sensitive element-binding protein 1; Y-box transcription factor	Mouse	P. pastoris
	YBX1 Protein, Mouse (P.pastoris, His) is the recombinant mouse-derived YBX1, expressed by P. pastoris , with N-6*His labeled tag. ,

HY-P71124

	NFKB1 Protein, Human (His) DNA-binding factor KBF1; EBP-1; Nuclear factor of kappa light polypeptide gene enhancer in B-cells 1	Human	E. coli
	The NFKB1 protein is a subunit of NF-kappa-B and regulates transcription in a variety of biological processes. It forms homodimeric or heterodimeric complexes with RELA/p65, RELB, and NFKB2/p52. NFKB1 Protein, Human (His) is the recombinant human-derived NFKB1 protein, expressed by E. coli , with N-6*His labeled tag. The total length of NFKB1 Protein, Human (His) is 434 a.a., with molecular weight of 45-55 kDa.

HY-P71436

	ZBP1 Protein, Human (His) Z-DNA-binding Protein 1; Tumor Stroma and Activated Macrophage Protein DLM; ZBP1; C20orf183; DLM1	Human	E. coli
	ZBP1 is an important innate sensor that defends against viruses by recognizing Z-RNA structures and inducing PANoptosis. It binds Z-RNA through TNF-α family members and stimulates RIPK3 and MLKL to activate necroptosis. ZBP1 Protein, Human (His) is the recombinant human-derived ZBP1 protein, expressed by E. coli , with C-6*His labeled tag.

HY-P702856

	G3BP1 Protein, Human (His) G3BP-1; ATP-dependent DNA helicase VIII; hDH VIII; GAP SH3 domain-binding protein 1	Human	E. coli
	G3BP1 Protein, Human (His) is the recombinant human-derived G3BP1, expressed by E. coli , with N-6*His labeled tag. The total length of G3BP1 Protein, Human (His) is 466 a.a.,

HY-P703126

	FLI1 Protein, Human Friend leukemia integration 1 transcription factor; Proto-oncogene Fli-1; Transcription factor ERGB; FLI1; Homo sapiens; Human; Activator; DNA-binding	Human	E. coli
	FLI1 Protein, Human is the recombinant human-derived FLI1, expressed by E. coli , with tag Free labeled tag. The total length of FLI1 Protein, Human is 124 a.a.,

HY-P703127

	FLI1 Protein, Human (His, Strep) Friend leukemia integration 1 transcription factor; Proto-oncogene Fli-1; Transcription factor ERGB; FLI1; Homo sapiens; Human; Activator; DNA-binding	Human	E. coli
	FLI1 Protein, Human (His, Strep) is the recombinant human-derived FLI1, expressed by E. coli , with Strep, His labeled tag. The total length of FLI1 Protein, Human (His, Strep) is 124 a.a.,

HY-P703481

	MT-RNR1 Protein, Human (His, GST) Mitochondrial-derived peptide MOTS-c; Mitochondrial open reading frame of the 12S rRNA-c; MT-RNR1; Homo sapiens; Human; DNA-binding	Human	E. coli
	MT-RNR1 Protein, Human (His, GST) is the recombinant human-derived MT-RNR1, expressed by E. coli , with His, GST labeled tag. ,

HY-P703588

	RB1 Protein, Human (Strep) Retinoblastoma-associated protein; p105-Rb; p110-RB1; pRb; Rb; pp110; RB1; Homo sapiens; Human; Rb; Chromatin regulator; DNA-binding; Repressor	Human	E. coli
	RB1 Protein, Human (Strep) is the recombinant human-derived RB1, expressed by E. coli , with Strep labeled tag. ,

HY-P703428

	birA Protein, B. subtilis (His) Bifunctional ligase/repressor BirA; Biotin--[acetyl-CoA-carboxylase] ligase; 6.3.4.15; Biotin--protein ligase; Biotin-[acetyl-CoA carboxylase] synthetase; birA; Bacillus subtilis (strain 168); DNA-binding; Ligase; Repressor	Others	E. coli

HY-P70087

	DTD1 Protein, Human (HEK293, His) rHuD-aminoacyl-tRNA deacylase 1/DTD1, His; D-tyrosyl-tRNA(Tyr) deacylase 1; DNA-unwinding element-binding protein B; DUE-B; Histidyl-tRNA synthase-related; DTD1; C20orf88; DUEB; HARS2	Human	HEK293
	The DTD1 protein, as a potential ATPase, may participate in DNA replication by helping to load CDC45 onto the prereplication complex. In addition, it can also act as an aminoacyl-tRNA editing enzyme, specifically deacylating erroneous D-aminoacyl-tRNA and erroneous glycyl-tRNA (Ala). DTD1 Protein, Human (HEK293, His) is the recombinant human-derived DTD1 protein, expressed by HEK293 , with C-6*His labeled tag. The total length of DTD1 Protein, Human (HEK293, His) is 209 a.a., with molecular weight of ~30.0 kDa.

HY-P703192

	SET Protein, Human (His, Strep) Protein SET; HLA-DR-associated protein II; Inhibitor of granzyme A-activated DNAse; IGAAD; PHAPII; Phosphatase 2A inhibitor I2PP2A; I-2PP2A; Template-activating factor I; TAF-I; SET; Homo sapiens; Human; IGAAD; Chaperone; DNA-binding	Human	E. coli
	SET Protein, Human (His, Strep) is the recombinant human-derived SET, expressed by E. coli , with Strep, His labeled tag. ,

HY-P701528

	HLTF Protein, Human HLTF; Helicase-like transcription factor; DNA-binding protein/plasminogen activator inhibitor 1 regulator; HIP116; RING finger protein 80; RING-type E3 ubiquitin transferase HLTF; SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A member 3; Sucrose nonfermenting protein 2-like 3	Human	E. coli
	HLTF protein has helicase and E3 ubiquitin ligase activities and has intrinsic ATP-dependent nucleosome remodeling ability. It is critical for the transcriptional regulation of specific promoters such as SERPINE1, HIV-1 and SV40. HLTF Protein, Human is the recombinant human-derived HLTF protein, expressed by E. coli , with tag free. The total length of HLTF Protein, Human is 117 a.a., .

HY-P701529

	HLTF Protein, Human (His) HLTF; Helicase-like transcription factor; DNA-binding protein/plasminogen activator inhibitor 1 regulator; HIP116; RING finger protein 80; RING-type E3 ubiquitin transferase HLTF; SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A member 3; Sucrose nonfermenting protein 2-like 3	Human	E. coli
	HLTF protein has helicase and E3 ubiquitin ligase activities and has intrinsic ATP-dependent nucleosome remodeling ability. It is critical for the transcriptional regulation of specific promoters such as SERPINE1, HIV-1 and SV40. HLTF Protein, Human (His) is the recombinant human-derived HLTF protein, expressed by E. coli , with N-6*His labeled tag. The total length of HLTF Protein, Human (His) is 117 a.a., .

Compare Products


Products	In-stock - + Add to Cart
Cat. No.
Species
Source
Tag
Accession
Gene ID
Molecular Weight
Purity
Endotoxin Level
Biological Activity
Appearance
Formulation
Storage & Stability
Shipping
Free Sample	Yes No
Size	* This product has been "discontinued". Optimized version of product available: / In-stock - + Add to Cart Get quote

Cat. No.	Compare	Product Name	Application	Reactivity

HY-P80553

	ATF4 Antibody Cyclic AMP-dependent transcription factor ATF-4; CREB-2; cAMP-responsive element-binding protein 2; DNA-binding protein TAXREB67	WB, IHC-P, ICC/IF, IP, FC	Human, Mouse, Rat
	ATF4 Antibody is a non-conjugated and Rabbit origined polyclonal antibody about 39 kDa, targeting to ATF4. It can be used for WB,IHC-P,ICC/IF,IP,FC assays with tag free, in the background of Human, Mouse, Rat.

HY-P80936

	YB1 Antibody YBX1; NSEP1; YB1; Nuclease-sensitive element-binding protein 1; CCAAT-binding transcription factor I subunit A; CBF-A; DNA-binding protein B; DBPB; Enhancer factor I subunit A; EFI-A; Y-box transcription factor; Y-box-binding protein 1; YB-	WB, IHC-P, ICC/IF, IP, FC	Human, Mouse, Rat
	YB1 Antibody is a non-conjugated and Rabbit origined polyclonal antibody about 36 kDa, targeting to YB1. It can be used for WB,IHC-P,ICC/IF,IP,FC assays with tag free, in the background of Human, Mouse, Rat.

HY-P80737

	Ku80 Antibody (YA714) XRCC5; G22P2; X-ray repair cross-complementing protein 5; 86 kDa subunit of Ku antigen; ATP-dependent DNA helicase 2 subunit 2; ATP-dependent DNA helicase II 80 kDa subunit; CTC box-binding factor 85 kDa subunit; CTC85; CTCBF; DNA repair pr	WB, ICC/IF, IP, ChIP	Human, Monkey
	Ku80 Antibody (YA714) is a non-conjugated and Mouse origined monoclonal antibody about 83 kDa, targeting to Ku80 (8H1). It can be used for WB,ICC/IF,IP,ChIP assays with tag free, in the background of Human, Monkey.

HY-P82687

	G3BP Antibody (YA2432) G3BP1; G3BP; Ras GTPase-activating protein-binding protein 1; G3BP-1; ATP-dependent DNA helicase VIII; hDH VIII; GAP SH3 domain-binding protein 1	WB, IHC-P, ICC/IF, IP, FC	Human, Mouse, Rat
	G3BP Antibody (YA2432) is a rabbit-derived non-conjugated IgG antibody (Clone NO.: YA2432), targeting G3BP, with a predicted molecular weight of 52 kDa (observed band size: 68 kDa). G3BP Antibody (YA2432) can be used for WB, IHC-P, ICC/IF, IP, FC experiment in human, mouse, rat background.

HY-P81409

	SATB1 Antibody (YA1154) DNA-binding protein SATB1 (Special AT-rich sequence-binding protein 1)	IHC-P	Human
	SATB1 Antibody (YA1154) is a rabbit-derived non-conjugated IgG antibody (Clone NO.: YA1154), targeting SATB1. SATB1 Antibody (YA1154) can be used for IHC-P experiment in human background.

HY-P83100

	ID1 Antibody (YA2845) DNA-binding protein inhibitor ID-1; Class B basic helix-loop-helix protein 24; bHLHb24; Inhibitor of DNA binding 1; ID1; BHLHB24; ID	WB, IHC-P, ICC/IF, FC	Human, Mouse, Rat
	ID1 Antibody (YA2845) is a rabbit-derived non-conjugated IgG antibody (Clone NO.: YA2845), targeting ID1, with a predicted molecular weight of 16 kDa (observed band size: 22 kDa). ID1 Antibody (YA2845) can be used for WB, IHC-P, ICC/IF, FC experiment in human, mouse, rat background.

HY-P83667

	Phospho-ATF4 (Ser219) Antibody Cyclic AMP-dependent transcription factor ATF-4; CREB-2; cAMP-responsive element-binding protein 2; DNA-binding protein TAXREB67	WB	Human

HY-P81842

	GATA1 Antibody (YA1587) GATA1; ERYF1; GF1; Erythroid transcription factor; Eryf1; GATA-binding factor 1; GATA-1; GF-1; NF-E1 DNA-binding protein	WB, ICC/IF, IP, ChIP	Human
	GATA1 Antibody (YA1587) is a rabbit-derived non-conjugated IgG antibody (Clone NO.: YA1587), targeting GATA1, with a predicted molecular weight of 43 kDa (observed band size: 43 kDa). GATA1 Antibody (YA1587) can be used for WB, ICC/IF, IP, ChIP experiment in human background.

HY-P81374

	FUBP1 Antibody (YA1119) DNA helicase V; FBP; FUBP; Fubp1; Fubp4; FUSE-binding protein 1; HDH V	IHC-P	Human
	FUBP1 Antibody (YA1119) is a rabbit-derived non-conjugated IgG antibody (Clone NO.: YA1119), targeting FUBP1. FUBP1 Antibody (YA1119) can be used for IHC-P experiment in human background.

HY-P81651

	NFYA Antibody (YA1396) NFYA; Nuclear transcription factor Y subunit alpha; CAAT box DNA-binding protein subunit A; Nuclear transcription factor Y subunit A; NF-YA	WB, IP	Human, Mouse, Rat
	NFYA Antibody (YA1396) is a rabbit-derived non-conjugated IgG antibody (Clone NO.: YA1396), targeting NFYA, with a predicted molecular weight of 37 kDa (observed band size: 37 kDa). NFYA Antibody (YA1396) can be used for WB, IP experiment in human, mouse, rat background.

HY-P82753

	Phospho-KIF22 (Ser427) Antibody (YA2498) KIF22; KID; KNSL4; Kinesin-like protein KIF22; Kinesin-like DNA-binding protein; Kinesin-like protein 4	WB	Human
	Phospho-KIF22 (Ser427) Antibody (YA2498) is a biotin-conjugated non-conjugated IgG antibody, targeting Phospho-KIF22 (Ser427), with a predicted molecular weight of 73 kDa (observed band size: 73 kDa). Phospho-KIF22 (Ser427) Antibody (YA2498) can be used for WB experiment in human background.

HY-P81265

	CHD4 Antibody (YA946) CHD4; Chromodomain-helicase-DNA-binding protein 4; CHD-4; ATP-dependent helicase CHD4; Mi-2 autoantigen 218 kDa protein; Mi2-beta	WB, IP	Human
	CHD4 Antibody (YA946) is a mouse-derived non-conjugated IgG2b antibody (Clone NO.: YA946), targeting CHD4, with a predicted molecular weight of 218 kDa (observed band size: 260 kDa). CHD4 Antibody (YA946) can be used for WB, IP experiment in human background.

HY-P81265A

	CHD4 Antibody (YA947) CHD4; Chromodomain-helicase-DNA-binding protein 4; CHD-4; ATP-dependent helicase CHD4; Mi-2 autoantigen 218 kDa protein; Mi2-beta	WB, ICC/IF, FC	Human
	CHD4 Antibody (YA947) is a rabbit-derived non-conjugated IgG antibody (Clone NO.: YA947), targeting CHD4, with a predicted molecular weight of 218 kDa (observed band size: 260 kDa). CHD4 Antibody (YA947) can be used for WB, ICC/IF, FC experiment in human background.

HY-P82011

	MSH6 Antibody (YA1756) MSH6; GTBP; DNA mismatch repair protein Msh6; hMSH6; G/T mismatch-binding protein; GTBP; GTMBP; MutS-alpha 160 kDa subunit; p160	WB, IHC-F, IHC-P, ICC/IF	Human, Mouse, Rat
	MSH6 Antibody (YA1756) is a rabbit-derived non-conjugated IgG antibody (Clone NO.: YA1756), targeting MSH6, with a predicted molecular weight of 153 kDa (observed band size: 163 kDa). MSH6 Antibody (YA1756) can be used for WB, IHC-F, IHC-P, ICC/IF experiment in human, mouse, rat background.

HY-P83600

	TBP Like 1 Antibody (YA3345) 21 kDa TBP-like protein; Second TBP of unique DNA protein; STUD; TATA box-binding protein-related factor 2; TBPL1; TLF; TLP; TLP21	WB, IHC-P, ICC/IF, IP, FC	Human, Mouse, Rat
	TBP Like 1 Antibody (YA3345) is a rabbit-derived non-conjugated IgG antibody (Clone NO.: YA3345), targeting TBP Like 1, with a predicted molecular weight of 21 kDa (observed band size: 21 kDa). TBP Like 1 Antibody (YA3345) can be used for WB, IHC-P, ICC/IF, IP, FC experiment in human, mouse, rat background.

HY-P81264

	CHD3 Antibody (YA944) CHD3; Chromodomain-helicase-DNA-binding protein 3; CHD-3; ATP-dependent helicase CHD3; Mi-2 autoantigen 240 kDa protein; Mi2-alpha; Zinc finger helicase; hZFH	WB, ICC/IF, IP	Human, Mouse, Rat
	CHD3 Antibody (YA944) is a mouse-derived non-conjugated IgG1 antibody (Clone NO.: YA944), targeting CHD3, with a predicted molecular weight of 227 kDa (observed band size: 260 kDa). CHD3 Antibody (YA944) can be used for WB, ICC/IF, IP experiment in human, mouse, rat background.

HY-P81264A

	CHD3 Antibody (YA945) CHD3; Chromodomain-helicase-DNA-binding protein 3; CHD-3; ATP-dependent helicase CHD3; Mi-2 autoantigen 240 kDa protein; Mi2-alpha; Zinc finger helicase; hZFH	WB, IHC-P, ICC/IF, FC	Human, Mouse, Rat
	CHD3 Antibody (YA945) is a rabbit-derived non-conjugated IgG antibody (Clone NO.: YA945), targeting CHD3, with a predicted molecular weight of 227 kDa (observed band size: 260 kDa). CHD3 Antibody (YA945) can be used for WB, IHC-P, ICC/IF, FC experiment in human, mouse, rat background.

HY-P80764

	NF-KB p105 Antibody (YA700) NFKB1; Nuclear factor NF-kappa-B p105 subunit; DNA-binding factor KBF1; EBP-1; Nuclear factor of kappa light polypeptide gene enhancer in B-cells 1	WB	Human, Mouse, Rat
	NF-KB p105 Antibody (YA700) is a non-conjugated and Mouse origined monoclonal antibody about 105 kDa, targeting to NF-KB p105 (5E3). It can be used for WB assays with tag free, in the background of Human, Mouse, Rat.

HY-P80244

	NF-KB p105/p50 Antibody DKFZp686C01211 antibody; DNA binding factor KBF1 antibody; DNA binding factor KBF1 EBP1 antibody; DNA-binding factor KBF1 antibody; EBP 1 antibody; EBP-1 antibody; EBP1 antibody; KBF1 antibody; MGC54151 antibody; NF kappa B antibody; NF kappaB antibody; NF kappabeta antibody; NF kB1 antibody; NFkappaB antibody; NFKB 1 antibody; NFKB p105 antibody; NFKB p50 antibody; Nfkb1 antibody; NFKB1_HUMAN antibody; Nuclear factor kappa B DNA binding subunit antibody; Nuclear factor kappa-B, subunit 1 antibody; Nuclear factor NF kappa B p105 subunit antibody; Nuclear factor NF kappa B p50 subunit antibody; Nuclear factor NF-kappa-B p50 subunit antibody; Nuclear factor of kappa light chain gene enhancer in B cells 1 antibody; Nuclear factor of kappa light polypeptide gene enhancer in B cells 1 antibody; Nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 antibody; p105 antibody; p50 antibody; p84/NF-kappa-B1 p98 antibody; Transcription factor NFKB1 antibody	WB, ICC/IF, IHC-P	Human, Mouse
	NF-κB p105/p50 Antibody is a non-conjugated and Mouse origined monoclonal antibody about 50 kDa, targeting to NF-κB p105/p50. It can be used for WB,ICC,IHC-P assays with tag free, in the background of Human, Mouse.

HY-P82486

	TNFAIP3 Antibody (YA2231) TNFAIP3; OTUD7C; Tumor necrosis factor alpha-induced protein 3; TNF alpha-induced protein 3; OTU domain-containing protein 7C; Putative DNA-binding protein A20; Zinc finger protein A20	WB, IHC-F, IHC-P, ICC/IF	Human
	TNFAIP3 Antibody (YA2231) is a rabbit-derived non-conjugated IgG antibody (Clone NO.: YA2231), targeting TNFAIP3, with a predicted molecular weight of 90 kDa (observed band size: 82 kDa). TNFAIP3 Antibody (YA2231) can be used for WB, IHC-F, IHC-P, ICC/IF experiment in human background.

HY-P81049

	Phospho-NFKB1(Ser337) Antibody NFKB1; NF-KB; Nuclear factor NF-kappa-B p105 subunit; DNA-binding factor KBF1; EBP-1; Nuclear factor of kappa light polypeptide gene enhancer in B-cells 1; DNA-binding factor KBF1; EBP-1; Nuclear factor of kappa light polypeptide gene enhancer in B-cells 1; Nuclear factor NF-kappa-B p50 subunit; NFkB p105 / p50; NFkB p105/p50; nuclear factor kappa B subunit 1; NF-kB; CVID12; NF-kB1; NFKB-p50; NFkappaB; NF-kappaB; NFKB-p105; NF-kappa-B1; NF-kappabeta	WB, IHC-P, IHC-F, FC, ICC/IF, ELISA	Human, Mouse
	Phospho-NFKB1 p105/p50 (Ser337) Antibody is an unconjugated, approximately 50&120 kDa, rabbit-derived, anti-NFKB1 p105/p50 (Ser337) polyclonal antibody. Phospho-NFKB1 p105/p50 (Ser337) Antibody can be used for: WB, IHC-P, ICC/IF expriments in human, mouse, rat background without labeling.

HY-P80763

	NF-KB p100 Antibody NFKB2; LYT10; Nuclear factor NF-kappa-B p100 subunit; DNA-binding factor KBF2; H2TF1; Lymphocyte translocation chromosome 10 protein; Nuclear factor of kappa light polypeptide gene enhancer in B-cells 2; Oncogene Lyt-10; Lyt10	WB, ICC/IF, IP	Human, Mouse, Rat
	NF-KB p100 Antibody is a non-conjugated and Rabbit origined monoclonal antibody about 97 kDa, targeting to NF-KB p100. It can be used for WB,ICC/IF,IP assays with tag free, in the background of Human, Mouse, Rat.

HY-P81173

	TWIST Antibody ACS3; B-HLH DNA binding protein; bHLHa38; BPES2; BPES3; Class A basic helix-loop-helix protein 38; CRS1; H-twist; OTTHUMP00000116043; SCS; Twist basic helix loop helix transcription factor 1; Twist homolog 1 (Drosophila); Twist homolog 1; TWIST homolog of drosophila; Twist related protein 1; Twist-related protein 1; Twist1; TWST1_HUMAN.	WB, IHC-P, ICC/IF, FC	Human, Mouse
	TWIST Antibody is an unconjugated, approximately 23 kDa, mouse-derived, anti-TWIST monoclonal antibody. TWIST Antibody can be used for: WB, IHC-P, ICC/IF, FC expriments in human, mouse background without labeling.

HY-P81282

	Ikaros Antibody (YA987) CLL associated antigen KW 6; DNA-binding protein Ikaros; hIk 1; hIk-1; Hs.54452; IK1; Ikaros (zinc finger protein); IKAROS; IKAROS family zinc finger 1 (Ikaros); Ikaros family zinc finger protein 1; Ikzf1; IKZF1_HUMAN; LYF1; Lymphoid transcription factor LyF-1; PRO0758; Zinc finger protein subfamily 1A 1 (Ikaros); zinc finger protein subfamily 1A 1; Zinc finger protein; subfamily 1A; member 1; ZNFN1A1.	WB, IP	Human
	Ikaros Antibody (YA987) is a mouse-derived non-conjugated IgG1 antibody (Clone NO.: YA987), targeting Ikaros, with a predicted molecular weight of 58 kDa (observed band size: 58 kDa). Ikaros Antibody (YA987) can be used for WB, IP experiment in human background.

HY-P81282A

	Ikaros Antibody (YA988) CLL associated antigen KW 6; DNA-binding protein Ikaros; hIk 1; hIk-1; Hs.54452; IK1; Ikaros (zinc finger protein); IKAROS; IKAROS family zinc finger 1 (Ikaros); Ikaros family zinc finger protein 1; Ikzf1; IKZF1_HUMAN; LYF1; Lymphoid transcription factor LyF-1; PRO0758; Zinc finger protein subfamily 1A 1 (Ikaros); zinc finger protein subfamily 1A 1; Zinc finger protein; subfamily 1A; member 1; ZNFN1A1.	IHC-P	Human
	Ikaros Antibody (YA988) is a rabbit-derived non-conjugated IgG antibody (Clone NO.: YA988), targeting Ikaros. Ikaros Antibody (YA988) can be used for IHC-P experiment in human background.

Compare Products


Products	In-stock - + Add to Cart
Cat. No.
Host
Reactivity
Application
Dilution Ratio
Molecular Weight
Conjugation
Clonality
Immunogen
Appearance
Isotype
Gene ID
SwissProt ID
Purity
Formulation
Free Sample	Yes No
Size	* This product has been "discontinued". Optimized version of product available: / In-stock - + Add to Cart Get quote

Cat. No.	Product Name		Classification

HY-D1444

Propidium monoazide		Azide
Propidium monoazide is a photoreactive DNA-binding dye that preferentially binds to dsDNA. Propidium monoazide (PMA) prevents DNA from dead bacteria from being amplified during the PCR. PMA-PCR enhanced both the specificity and the sensitivity of PCR . Propidium monoazide is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. It can also undergo strain-promoted alkyne-azide cycloaddition (SPAAC) reactions with molecules containing DBCO or BCN groups.

HY-D1316

Cyanine7 azide chloride		Azide
Cyanine7 azide chloride belongs to the cyanine dye series and is a common fluorescent marker for biomolecules that can interact with biomolecules. Cyanine dyes may also bind to double-helical DNA through intercalation and exhibit enhanced fluorescence upon binding.

Cat. No.	Product Name		Classification

HY-43058

5'-O-DMT-ibu-rG 5'-O-DMT-N2-isobutyrylguanosine		Nucleoside Phosphoramidites
5'-O-DMT-ibu-rG is a useful model for a new class of DNA binding molecules for the development of potent and selective anti-cancer agents .

HY-147217A

Bepirovirsen sodium ISIS 505358 sodium		Antisense Oligonucleotides
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-W406070

2'-O,4'-C-Methyleneguanosine LNA-G		Nucleosides and their Analogs
2′-O,4′-C-Methyleneguanosine (LNA-G) is a reverse guanine analogue, where LNA (locked nucleic acid) is a nucleic acid analogue. LNA modification can be used in a variety of applications such as effective binding affinity to complementary sequences and greater nuclease resistance than natural nucleotides, offering great potential for applications in disease diagnosis and research. LNA-G is also available via KOD DNA polymerase, which allows the integration of LNA-G nucleotides into the DNA strand .

HY-160066

SYL3C aptamer sodium		Aptamers
SYL3C aptamer sodium is a DNA aptamer that targets the epithelial cell adhesion molecule (EpCAM) on the surface of cancer cells. SYL3C aptamer sodium targets multiple human cancer cell lines including MDA-MB-231, Kato III, HT-29, T47D and SW480. The Kd of SYL3C aptamer sodium against breast cancer cell line MDA-MB-231 and gastric cancer cell line Kato III is 38 nM and 67 nM, respectively. SYL3C aptamer sodium provides stability, high binding affinity, and selectivity for targeted cancer therapy, cancer cell imaging, and circulating tumor cell detection .

HY-147217

Bepirovirsen ISIS 505358		Antisense Oligonucleotides
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-160050

CD63-1 aptamer sodium		Aptamers
CD63-1 aptamer sodium is a high-affinity and specific DNA aptamer targeting the CD63 protein (Kd: 38.71 nM). CD63-1 aptamer sodium efficiently binds to CD63-positive cells, including breast cancer MDA-MB-231 cells and CD63-overexpressing HEK293T cells, with moderate binding affinity (Kd~100 nM) as assessed by flow cytometry .

HY-160051

CD63-2 aptamer sodium		Aptamers
CD63-2 aptamer sodium is a high-affinity and specific DNA aptamer targeting the CD63 protein (Kd: 78.43 nM). CD63-1 aptamer sodium efficiently binds to CD63-positive cells, including breast cancer MDA-MB-231 cells and CD63-overexpressing HEK293T cells, with moderate binding affinity (Kd~100 nM) as assessed by flow cytometry .

Inquiry Online

Your information is safe with us. * Required Fields.

MCE Japan Authorized Agent ナミキ商事株式会社コスモ・バイオ株式会社
Salutation			Country or Region *
Applicant Name *			Organization Name *
Department *
Email Address *			Product Name *
Cat. No.			Requested quantity *
Phone Number *
Remarks