Search Result

Results for "

Murine

" in MedChemExpress (MCE) Product Catalog:

By Targets:	BMI1 (1) 11β-HSD (1) ADC Cytotoxin (2) Adenosine Receptor (1) Adenylate Cyclase (1) Adrenergic Receptor (1) Aldose Reductase (2) Angiotensin-converting Enzyme (ACE) (3) Antibiotic (18) Antibody-Drug Conjugates (ADCs) (1) Antifolate (1) Apoptosis (45) Arp2/3 Complex (1) Autophagy (7) Bacterial (32) Bcl-2 Family (5) Bcr-Abl (5) Beta-lactamase (2) Biochemical Assay Reagents (8) Btk (2) Calcium Channel (3) Cannabinoid Receptor (3) Carbonic Anhydrase (1) Caspase (3) Cathepsin (2) CCR (2) CD20 (1) CD28 (2) CD3 (3) Cholinesterase (ChE) (1) CMV (1) Complement System (1) COX (11) CXCR (3) Dihydroorotate Dehydrogenase (1) Dipeptidyl Peptidase (1) DNA Alkylator/Crosslinker (1) DNA Methyltransferase (2) DNA/RNA Synthesis (9) Drug Derivative (3) Drug Metabolite (1) E1/E2/E3 Enzyme (5) EGFR (1) Elastase (2) Endogenous Metabolite (19) Epigenetic Reader Domain (2) Epoxide Hydrolase (4) ERK (3) Estrogen Receptor/ERR (3) FAK (1) Ferroptosis (3) FGFR (1) Fungal (10) GCGR (1) GHSR (1) Glyoxalase (GLO) (2) GPR139 (1) Guanylate Cyclase (3) HDAC (5) HIF/HIF Prolyl-Hydroxylase (1) Histamine Receptor (1) Histone Methyltransferase (3) HIV (5) HIV Integrase (1) HOXA (1) HSV (2) HuR (1) IFNAR (5) IGF-1R (1) iGluR (4) IKK (2) Influenza Virus (2) Integrin (6) Interleukin Related (9) Isotope-Labeled Compounds (8) JAK (4) JNK (2) Keap1-Nrf2 (2) Leukotriene Receptor (2) Liposome (1) LPL Receptor (2) Macrophage migration inhibitory factor (MIF) (1) MAGL (1) MAP4K (1) MAPKAPK2 (MK2) (1) Mas-related G-protein-coupled Receptor (MRGPR) (1) MDM-2/p53 (5) Melanocortin Receptor (1) MicroRNA (3) Microtubule/Tubulin (2) MMP (6) Monoamine Oxidase (4) mTOR (2) Mucin (1) nAChR (3) Necroptosis (1) NF-κB (15) NO Synthase (15) NOD-like Receptor (NLR) (2) Notch (1) Nucleoside Antimetabolite/Analog (1) Organoid (2) Orthopoxvirus (2) P-glycoprotein (1) p38 MAPK (2) PAI-1 (1) Parasite (7) PARP (1) Peptide-Drug Conjugates (PDCs) (1) PGE synthase (3) Phosphatase (2) Phosphodiesterase (PDE) (2) Phospholipase (1) Pim (1) PKA (2) PKC (1) PPAR (18) Progesterone Receptor (2) Prostaglandin Receptor (4) PROTACs (1) Protein Arginine Deiminase (4) Radionuclide-Drug Conjugates (RDCs) (1) RAR/RXR (1) Ras (2) Reactive Oxygen Species (3) Reverse Transcriptase (1) RIP kinase (2) ROCK (2) ROR (1) SARS-CoV (4) Ser/Thr Protease (1) Sirtuin (4) Src (1) STAT (7) STING (4) Tau Protein (1) TGF-beta/Smad (2) Thrombin (1) Tie (2) TNF Receptor (7) Toll-like Receptor (TLR) (11) Topoisomerase (3) Transmembrane Glycoprotein (3) Tyrosinase (3) VEGFR (3) Wnt (1)
By Research Areas:	Cancer (160) Cardiovascular Disease (30) Endocrinology (11) Infection (81) Inflammation/Immunology (114) Metabolic Disease (33) Neurological Disease (35)
Click Chemistry:	Azide (1)
Oligonucleotides:	Nucleosides and their Analogs (1) CpG ODNs (3) Antisense Oligonucleotides (1)

362

Inhibitors & Agonists

Biochemical Assay Reagents

Peptides

Inhibitory Antibodies

Natural
Products

Recombinant Proteins

Isotope-Labeled Compounds

Antibodies

Click Chemistry

Oligonucleotides

Targets Recommended: BMI1

Cat. No.	Product Name	Target	Research Areas	Chemical Structure

HY-132582A

*Tau ASO-12 (murine) (sodium)*	Tau Protein	Cancer
Tau ^ASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (Tau ^ASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )

HY-125864B

Murine Fibrinogen	Biochemical Assay Reagents	Cardiovascular Disease
Murine Fibrinogen is a native fibrinogen from murine plasma .

HY-P2821B

Murine Plasminogen	Biochemical Assay Reagents	Cardiovascular Disease
Murine Plasminogen is purified from freshly collected murine plasma and is an inactive precursor of the protease plasmin. It is activated to the serine protease plasmin by urokinase, streptokinase, or tissue plasminogen activator.

HY-114164G

Murine Thrombin	Thrombin	Cardiovascular Disease
Murine Thrombin is a Na ⁺-activated, allosteric serine protease that plays opposing functional roles in blood coagulation. Thrombin recognition sequence and can be used to digest GST-tagged proteins .

HY-E70547A

Murine Factor XIII	Biochemical Assay Reagents	Cardiovascular Disease
Murine Factor XIII is a natural coagulation factor present in plasma, composed of two identical α subunits and two identical β subunits .

HY-P2728A

Murine Antithrombin III	Biochemical Assay Reagents	Cardiovascular Disease
Murine Antithrombin III is a blood coagulation inhibitory enzyme with high catalytic efficiency, high specificity, mild action conditions, etc., and can be used in the pharmaceutical industry, industrial production, food manufacturing, aquaculture and other industries .

HY-E70085

*Moloney murine* leukemia virus RT**	DNA/RNA Synthesis	Infection
Moloney murine leukemia virus RT is a monomeric reverse transcriptase from Moloney murine leukemia virus (MMLV). Moloney murine leukemia virus RT is a replicative polymerase that play an essential role in the life cycle of the retrovirus .

HY-NP145

*Epidermal Growth Factor,murine* submaxillary gland**	Biochemical Assay Reagents	Metabolic Disease
Epidermal Growth Factor, murine submaxillary gland is a biologically active polypeptide isolated from mouse submandibular gland. Epidermal Growth Factor, murine submaxillary gland is a mitogen that stimulates the growth of epithelial cells, fibroblasts and glial cells under various experimental conditions .

HY-NP143

*Nerve Growth Factor 2.5S,murine* submaxillary gland**	Biochemical Assay Reagents	Neurological Disease
Nerve Growth Factor 2.5S, murine submaxillary gland is a neurotrophic polypeptide required for normal growth and development of sympathetic and embryonic sensory neurons and certain cholinergic neurons in the central nervous system. Nerve Growth Factor 2.5S, murine submaxillary gland has only β-subunit , and shows nerve growth-promoting activity .

HY-155288

DosatiLink-1	Bcr-Abl	Cancer
DosatiLink-1 is an Abelson murine leukemia (ABL) enzyme inhibitor .

HY-NP144

*Nerve Growth Factor 7S,murine* submaxillary gland**	Biochemical Assay Reagents	Neurological Disease
Nerve Growth Factor 7S, murine submaxillary gland is an α2β2γ2 complex in which the β-NGF dimer (the active neurotrophin) is associated with two α-NGF and two γ-NGF subunits .

HY-N1713

29-Nor-20-oxolupeol	Others	Neurological Disease
29-Nor-20-oxolupeol, extracted from Impatiens basamina, reduces NO levels in LPS-activated murine microglial cells with an IC₅₀ of 44.21 µM .

HY-P2975

*Laminin β2 (Engelbreth-Holm-Swarm murine* sarcoma basement membrane)** Mouse laminin (Engelbreth-Holm-Swarm Murine sarcoma basement membrane)	Endogenous Metabolite Biochemical Assay Reagents	Neurological Disease
Laminin β2 (Engelbreth-Holm-Swarm murine sarcoma basement membrane) is a crucial structural element in animal tissues, forming part of the scaffolding that supports tissue architecture. It interacts with type IV collagen through entactin and perlecan, connects to cell membranes via integrin receptors, dystroglycan complexes, and Lutheran blood group glycoproteins, and contains functional domains that facilitate collagen binding, cell adhesion, heparin interaction, and promote neurite outgrowth.

HY-N10445

Maydispenoid A	CD28 CD3	Inflammation/Immunology
Maydispenoid A is a potent immunosuppressor. Maydispenoid A can inhibit anti-CD3/anti-CD28 mAbs activated and lipopolysaccharide activated murine splenocyte proliferation .

HY-N10446

Maydispenoid B	CD28 CD3	Inflammation/Immunology
Maydispenoid B is a potent immunosuppressor. Maydispenoid B can inhibit anti-CD3/anti-CD28 mAbs activated and lipopolysaccharide activated murine splenocyte proliferation .

HY-146345

Antiviral agent 18	Antibiotic	Infection
Antiviral agent 18 (Compound 5) is an anti-infection agent. Antiviral agent 18 results in good antiviral activity against murine norovirus. Antiviral agent 18 has the potential for the research of infectious and malignant diseases .

HY-P1293

Conantokin G	iGluR	Neurological Disease
Conantokin G, a 17-amino-acid peptide, is a potent, selective and competitive antagonist of N-methyl-D-aspartate (NMDA) receptors. Conantokin G inhibits NMDA-evoked currents in murine cortical neurons with an IC₅₀ of 480 nM. Conantokin G has neuroprotective properties .

HY-117365

MI-1481	Epigenetic Reader Domain	Cancer
MI-1481 is a highly potent inhibitor of the Menin-MLL1 interaction with IC₅₀ of 3.6 nM. MI-1481 markedly reduces cell growth of murine bone marrow cells transformed and inhibits leukemia progression .

HY-P1293A

Conantokin G TFA	iGluR	Neurological Disease
Conantokin G TFA, a 17-amino-acid peptide, is a potent, selective and competitive antagonist of N-methyl-D-aspartate (NMDA) receptors. Conantokin G TFA inhibits NMDA-evoked currents in murine cortical neurons with an IC₅₀ of 480 nM. Conantokin G TFA has neuroprotective properties .

HY-163327

pFBC	Others	Neurological Disease
pFBC ([ ¹⁸F]pEBC) is a covalent CLIP-tag radiotracer for detection of viral reporter gene transfer in the murine brain. pFBC can be used in neurobiological research .

HY-146344

Antiviral agent 17	Antibiotic	Infection
Antiviral agent 17 (Compound 4) is an anti-infection agent. Antiviral agent 17 retains its antiviral effect in a human replicon assay (EC₅₀ = 0.015 μM). Antiviral agent 17 results in good antiviral activity against murine norovirus. Antiviral agent 17 has the potential for the research of infectious and malignant diseases .

HY-P99177

Enibarcimab	SARS-CoV	Infection Cardiovascular Disease
Enibarcimab is a humanised murine monoclonal immunoglobulin G1 (IgG1) antibody, could be used for acute heart failure, COVID-19 infections and septic shock research .

HY-P99336

Enlimomab BI-RR 0001; Anti-Human IL6 Recombinant Antibody	Integrin	Neurological Disease Inflammation/Immunology
Enlimomab (BI-RR 0001), a murine IgG2a monoclonal antibody to the human ICAM-1, inhibits leukocyte adhesion to the vascular endothelium, thereby decreasing leukocyte extravasation and inflammatory tissue injury. Enlimomab has anti-inflammatory effects, and can be used for stroke research .

HY-121726

3HOI-BA-01	mTOR Autophagy	Cardiovascular Disease
3HOI-BA-01 is amTORinhibitor.3HOI-BA-01reduces infarct size and inducedautophagyin a murine myocardial ischemia/reperfusion injury model .

HY-145441

GEM–IB	Drug Derivative	Cancer
GEM–IB is the conjugate of gemcitabine (GEM)-5'-phosphate with ibandronate (IB). GEM–IB as a single agent or in combination with Docetaxel (DTX) demonstrates reduced tumor burden, preservation of the bone architecture, and improved the survival in a murine model of osteosarcoma (OS) .

HY-N0859B

Schisanchinin D	NO Synthase	Neurological Disease
Schisanchinin D is an NO release inhibitor found in the fruits of Schisandra chinensis. Schisanchinin D can inhibit the release of nitric oxide (NO) by lipopolysaccharide (LPS)-activated microglia in primary murine BV2 microglia cells. Schisanchinin D is promising for research of neurodegenerative diseases such as Alzheimer's disease (AD) .

HY-12836A

IFN alpha-IFNAR-IN-1 hydrochloride 20+ Cited Publications	IFNAR	Inflammation/Immunology
IFN alpha-IFNAR-IN-1 hydrochloride is a nonpeptidic, low-molecular-weight inhibitor of the interaction between IFN-α and IFNAR. IFN alpha-IFNAR-IN-1 hydrochloride inhibits modified Vaccinia virus ankara (MVA)-induced IFN-α responses in murine bone-marrow-derived, Flt3- L-differentiated pDC cultures (BM-pDCs) (IC₅₀=2-8 μM) .

HY-151808

JS25	Btk	Cancer
JS25 is a selective and covalent inhibitor of BTK that inactivates BTK with an IC₅₀ value of 5.8 nM by chelating Tyr551. JS25 inhibits cancer cells proliferation, pronounces cell death, and promotes murine xenograft model of Burkitt’s lymphoma. JS25 effectively crosses the blood-brain barrier .

HY-N1649

2,3,2'',3''-Tetrahydroochnaflavone	Others	Cancer
2,3,2'',3''-Tetrahydroochnaflavone is a biflavonoid, which can be isolated from the leaves of Quintinia acutifolia. 2,3,2'',3''-Tetrahydroochnaflavone shows some cytotoxicity against P388 murine lymphocytic leukemia cells, with an IC₅₀ of 8.2 µg/mL .

HY-N1388

Tussilagone 1 Publications Verification	Others	Inflammation/Immunology
Tussilagone, a major active component in Tussilago farfara, has anti-inflammatory effect. Tussilagone ameliorates inflammatory responses in dextran sulphate sodium-induced murine colitis. Tussilagone inhibits the inflammatory response and improves survival in cecal ligation and puncture (CLP)-induced septic mice .

HY-N14957

Clavicoronic acid	Antibiotic	Infection
Clavicoronic acid is an avian myeloblastosis virus and *Moloney murine* leukemia virus reverse transcriptases inhibitor with K_i** values of 130, 68 µM, respectively. Clavicoronic acid inhibits the multiplication of vesicular stomatitis virus by interfering with this virus's RNA-directed RNA-polymerase. Clavicoronic acid shows no cytotoxicity .

HY-W272217

Octacosane n-Octacosane; NSC 5549	Endogenous Metabolite Bacterial	Inflammation/Immunology Cancer
Octacosane is an endogenous metabolite with antibacterial activity. Octacosane shows high cytotoxicity against murine melanoma B16F10-Nex2 cells besides inducing protection against a grafted subcutaneous melanoma. Octacosane has the larvicidal activity against mosquito Culex quinquefasciatus with the LC₅₀ concentration of 7.2 mg/l .

HY-W272217R

Octacosane (Standard)	Endogenous Metabolite Bacterial	Inflammation/Immunology Cancer
Octacosane (Standard) is the analytical standard of Octacosane. This product is intended for research and analytical applications. Octacosane is an endogenous metabolite with antibacterial activity. Octacosane shows high cytotoxicity against murine melanoma B16F10-Nex2 cells besides inducing protection against a grafted subcutaneous melanoma. Octacosane has the larvicidal activity against mosquito Culex quinquefasciatus with the LC50 concentration of 7.2 mg/l .

HY-N1388R

Tussilagone (Standard)	Others	Inflammation/Immunology
Tussilagone (Standard) is the analytical standard of Tussilagone. This product is intended for research and analytical applications. Tussilagone, a major active component in Tussilago farfara, has anti-inflammatory effect. Tussilagone ameliorates inflammatory responses in dextran sulphate sodium-induced murine colitis. Tussilagone inhibits the inflammatory response and improves survival in cecal ligation and puncture (CLP)-induced septic mice .

HY-114366

BC-1485	CXCR	Others
BC-1485 is a small molecule inhibitor of Fibrosis-inducing E3 ligase 1 (FIEL1). BC-1485 protects PIAS4 from ubiquitin-mediated degradation. BC-1485 decreases α-SMA, BAL and CXCL1. BC-1485 ameliorates fibrotic lung injury in murine models .

HY-161921

Antifungal agent 108	Fungal	Infection
Antifungal agent 108 (compound 14d), an original imidazo[1,2-b]pyridazine derivative, shows potent antifungal activity against Madurella mycetomatis (MM55 strain) with an IC₅₀ of 0.9 μM. Antifungal agent 108 exhibits an IC₅₀ of 14.3 μM on cell viability of NIH-3T3 murine fibroblast .

HY-19577

Ambamustine PTT119	DNA Alkylator/Crosslinker	Infection Cancer
Ambamustine (PTT119) is a new bifunctional alkylating agent and induces DNA damage by alkylating mechanisms. Ambamustine interferes with late steps in murine mammary tumor virus (MuMTV) processing and maturation and reduces production of the B-type retrovirus MuMTV. Ambamustine possesses cytolytic and antiviral activities .

HY-170835

NDM-1 inhibitor-7	Beta-lactamase Bacterial	Infection Inflammation/Immunology
NDM-1 inhibitor-7 (Compound A8) is a NDM-1 inhibitor, with IC₅₀ of 10.284 μM. NDM-1 inhibitor-7 restores the ability of MEM to penetrate the cell wall of gram-negative bacteria. NDM-1 inhibitor-7 effectively restores the antibacterial activity of MEM against NDM-1-positive Escherichia coli. NDM-1 inhibitor-7 demonstrates strong efficacy in both the Galleria mellonella infection model and murine peritonitis infection model .

HY-160142

UBX-382	Btk	Cancer
UBX-382 is an orally available proteolysis-targeting chimeras (PROTACs) that target BTK to inactivate B-cell receptor signaling. UBX-382 shows superior degradation activity for wild-type and mutant BTK proteins and shows anti-cancer activity in murine xenograft models of TMD-8 cells .

HY-N10337

Norjuziphine (-)-Norjuziphine	Drug Derivative	Cancer
Norjuziphine is an alkaloid found in the lotus flower (Nelumbo nucifera). Norjuziphine inhibits the melanogenesis of murine B16 melanoma 4A5 cells stimulated by Theophylline (HY-B0809) (IC₅₀=14.4 μM). Norjuziphine is promising for research of skin whitening and related skin pigmentation diseases .

HY-120241

Reticulol K 251-1	Phosphodiesterase (PDE)	Cancer
Reticulol (K 251-1) is an inhibitor of cyclic adenosine 3', 5'-monophosphate phosphodiesterase. Reticulol shows antitumor activity independent with cell cycle arrest or apoptosis. Reticulol inhibits cell growth of murine melanoma cells and human lung tumor cells. Reticulol protects its lung metastasis via the bloodstream by inhibiting the growth of B16F10 melanoma .

HY-112041

Unesbulin 3 Publications Verification PTC596	BMI1 Apoptosis	Cancer
Unesbulin (PTC596) is an orally active and selective B-cell-specific Moloney murine leukemia virus integration site 1 (BMI-1) inhibitor. Unesbulin downregulates MCL-1 and induces p53-independent mitochondrial apoptosis in acute myeloid leukemia (AML) cells. Unesbulin has anti-leukemic activity .

HY-125662A

BMX-001	Reactive Oxygen Species Apoptosis	Metabolic Disease
BMX-001, a novel redox-active metalloporphyrin, improves islet function and engraftment in a murine transplant model. BMX-001 reduces apoptosis in human and murine islets. BMX-001 significantly improves static-glucose stimulated insulin secretion (sGSIS) responses in murine islets. BMX-001 can significantly restore euglycemia in murine islet studies in the presence of the MnSOD. BMX-001 reduces the generation of ROS in a murine islet isolation and culture model .

HY-111662

Fc 11a-2	NOD-like Receptor (NLR)	Inflammation/Immunology
Fc 11a-2, a benzimidazole compound, is an orally active and potent NLRP3 inflammasome inhibitor. Fc 11a-2 restrains the formation of NLRP3 inflammasome by inhibiting activation of caspase-1 and thus the activation of IL-1b/IL-18. Fc 11a-2 prevents the development of Dextran sulfate sodium (DSS; HY-116282C)-induced murine experimental colitis .

HY-120944

BAY-7598	MMP	Inflammation/Immunology
BAY-7598 is a potent, orally bioavailable, and selective MMP12 inhibitor with IC₅₀s of 0.085, 0.67 and 1.1 nM for human MMP12, murine MMP12, and rat MMP12, respectively .

HY-106382

PMEDAP	HIV CMV	Infection Cancer
PMEDAP is a potent inhibitor of human immunodeficiency virus (HIV) replication. PMEDAP has anti-murine cytomegalovirus (MCMV) activity. PMEDAP is a very potent inhibitor of Moloney murine sarcoma virus (MSV)-induced tumor formation and associated mortality .

HY-W104379

Arprinocid	Parasite	Infection
Arprinocid is a purine analog with activity against murine Toxoplasma gondii .

HY-155289

DosatiLink-2	Bcr-Abl	Cancer
DosatiLink-2 is an Abelson murine leukemia (ABL) enzyme inhibitor .

HY-125138

ω-Muricholic Acid 1 Publications Verification	Endogenous Metabolite	Metabolic Disease
ω-Muricholic acid (ω-MCA) is a murine-specific secondary bile acid .

HY-155290

PonatiLink-1-24	Bcr-Abl	Cancer
PonatiLink-1-24 is an Abelson murine leukemia (ABL) enzyme inhibitor .

Cat. No.	Product Name	Type

HY-P2975

Laminin β2 (Engelbreth-Holm-Swarm murine sarcoma basement membrane)

Mouse laminin (Engelbreth-Holm-Swarm Murine sarcoma basement membrane)

Native Proteins

Laminin β2 (Engelbreth-Holm-Swarm murine sarcoma basement membrane) is a crucial structural element in animal tissues, forming part of the scaffolding that supports tissue architecture. It interacts with type IV collagen through entactin and perlecan, connects to cell membranes via integrin receptors, dystroglycan complexes, and Lutheran blood group glycoproteins, and contains functional domains that facilitate collagen binding, cell adhesion, heparin interaction, and promote neurite outgrowth.

HY-W104379

Arprinocid	Cell Assay Reagents
Arprinocid is a purine analog with activity against murine Toxoplasma gondii .

HY-139413

β-D-Glucan	Carbohydrates
β-D-glucan is a natural non-digestible polysaccharide and high biocompatibility that can be selectively recognized by recognition receptors such as Dectin-1 and Toll-like receptors as well as being easily internalized by murine or human macrophages, which is likely to attribute to a target delivery . β-d-glucan is an enteric delivery vehicle for probiotics .

HY-W749867

Ca(II)-EDTA disodium dihydrate Calcium disodium EDTA dihydrate	Chelators
CaⅡ-EDTA disodium dihydrate (Calcium disodium EDTA dihydrate) is an orally active metal chelating reagent, exhibits bactericidal activities against periodontal pathogens Aggregatibacter actinomycetemcomitans, Prevotella intermedia and Porphyromonas gingivalis . CaⅡ-EDTA disodium dihydrate is effective chelating antidotes for lead- and cadmium poisoning .

HY-NP145

*Epidermal Growth Factor,murine* submaxillary gland**	Native Proteins
Epidermal Growth Factor, murine submaxillary gland is a biologically active polypeptide isolated from mouse submandibular gland. Epidermal Growth Factor, murine submaxillary gland is a mitogen that stimulates the growth of epithelial cells, fibroblasts and glial cells under various experimental conditions .

HY-NP143

*Nerve Growth Factor 2.5S,murine* submaxillary gland**	Native Proteins
Nerve Growth Factor 2.5S, murine submaxillary gland is a neurotrophic polypeptide required for normal growth and development of sympathetic and embryonic sensory neurons and certain cholinergic neurons in the central nervous system. Nerve Growth Factor 2.5S, murine submaxillary gland has only β-subunit , and shows nerve growth-promoting activity .

HY-NP144

*Nerve Growth Factor 7S,murine* submaxillary gland**	Native Proteins
Nerve Growth Factor 7S, murine submaxillary gland is an α2β2γ2 complex in which the β-NGF dimer (the active neurotrophin) is associated with two α-NGF and two γ-NGF subunits .

HY-120973

Butaprost free acid	Biochemical Assay Reagents
Butaprost free acid is a selective prostaglandin E receptor (EP2) agonist with an EC₅₀ of 33 nM and a K_i of 2.4 μM for murine EP2 receptor. Butaprost free acid is less activity against murine EP1, EP3 and EP4 receptors. Butaprost free acid attenuates fibrosis by hampering TGF-β/Smad2 signalling .

Cat. No.	Product Name	Target	Research Area

HY-P2476

Peripheral Myelin P0 Protein (180-199), mouse 2 Publications Verification	Peptides	Neurological Disease Inflammation/Immunology
Peripheral Myelin P0 Protein (180-199), mouse, a neuritogenic peptide, is a purified component of murine peripheral nerve myelin .

HY-P1811

Iα52	Peptides	Inflammation/Immunology
Iα52 is a naturally processed peptide encompassed the residues 52-68 of the murine I-Eα chain and may contribute to selection of immature T cells .

HY-P2136

COG1410 2 Publications Verification	Apoptosis	Neurological Disease Inflammation/Immunology
COG1410 is an apolipoprotein E-derived peptide and an apoptosis inhibitor. COG1410 exerts neuroprotective and antiinflammatory effects in a murine model of traumatic brain injury (TBI). COG1410 can be used for the research of neurological disease .

HY-P1785

Abl Cytosolic Substrate Abltide	Bcr-Abl	Cancer
Abl Cytosolic Substrate is a substrate for Abelson tyrosine kinase (Abl ). Abl Protein Tyrosine Kinase (AbI) is a truncated form of the v-AbI Protein Tyrosine Kinase, a partner in the Gag-Abl fusion protein of the Abelson murine leukemia virus .

HY-P1293

Conantokin G	iGluR	Neurological Disease
Conantokin G, a 17-amino-acid peptide, is a potent, selective and competitive antagonist of N-methyl-D-aspartate (NMDA) receptors. Conantokin G inhibits NMDA-evoked currents in murine cortical neurons with an IC₅₀ of 480 nM. Conantokin G has neuroprotective properties .

HY-P1293A

Conantokin G TFA	iGluR	Neurological Disease
Conantokin G TFA, a 17-amino-acid peptide, is a potent, selective and competitive antagonist of N-methyl-D-aspartate (NMDA) receptors. Conantokin G TFA inhibits NMDA-evoked currents in murine cortical neurons with an IC₅₀ of 480 nM. Conantokin G TFA has neuroprotective properties .

HY-122357

Bestim	Adenylate Cyclase	Inflammation/Immunology
Bestim is a dipeptide, which exhibits high affinity to murine peritoneal macrophages, thymocytes, and plasma membranes isolated from these cells, with K_ds of 3.1, 2.1, 18.6 and 16.7 nM, respectively. Bestim inhibits adenylate cyclase in the membranes of murine macrophages and thymocytes. Bestim exhibits immunomodulatory efficacy .

HY-W746708

FK-565	NOD-like Receptor (NLR)	Inflammation/Immunology
FK-565 is a nucleotide oligomerization domain-1 (NOD1) ligand. FK-565 induces murine model with arteritis .

HY-P3818

PKCδ Peptide Substrate	PKC	Others
PKCδ Peptide Substrate is an absolutely specific substrate for the δ-type of PKC, with a sequence corresponding to sequence 422-443 of murine eEF-1α and containing Thr-431 .

HY-P5949

AMPR-22	Bacterial	Infection
AMPR-22 is an antimicrobial peptide. AMPR-22 can bind to the bacterial membrane and induces membrane permeabilization. AMPR-22 is effective against murine model of sepsis induced by MDR strains

HY-P5426

Abl protein tyrosine kinase substrate	Bcr-Abl	Others
Abl protein tyrosine kinase substrate is a biological active peptide. (Abltide is a peptide substrate for Abl Kinase (Abl protein tyrosine kinase), a partner in the gag-Abl fusion protein of the Abelson murine leukemia virus. Used in Western blot and kinase assay.)

HY-P10384A

SPSB2-iNOS inhibitory cyclic peptide-2 TFA	NO Synthase	Infection
SPSB2-iNOS inhibitory cyclic peptide-2 TFA is the TFA salt form of SPSB2-iNOS inhibitory cyclic peptide-2 (HY-P10384). SPSB2-iNOS inhibitory cyclic peptide-2 TFA is an inhibitor for the interaction of SPRY domain and SOCS-box protein 2 (SPSB2) and iNOS, through binding SPSB2 on iNOS site with K_D of 21 nM. SPSB2-iNOS inhibitory cyclic peptide-2 TFA is reduction-resistant and oxidatively stable .

HY-P10385A

SPSB2-iNOS inhibitory cyclic peptide-3 TFA	NO Synthase	Infection
SPSB2-iNOS inhibitory cyclic peptide-3 TFA is the TFA salt form of SPSB2-iNOS inhibitory cyclic peptide-3 (HY-P10385). SPSB2-iNOS inhibitory cyclic peptide-3 TFA is an inhibitor for the interaction of SPRY domain and SOCS-box protein 2 (SPSB2) and iNOS, through binding SPSB2 on iNOS site with K_D of 7 nM .

HY-P10384

SPSB2-iNOS inhibitory cyclic peptide-2	NO Synthase	Infection
SPSB2-iNOS inhibitory cyclic peptide-2 (Compound CP2) is an inhibitor for the interaction of SPRY domain and SOCS-box protein 2 (SPSB2) and iNOS, through binding SPSB2 on iNOS site with K_D of 21 nM. SPSB2-iNOS inhibitory cyclic peptide-2 is reduction-resistant and oxidatively stable .

HY-P10385

SPSB2-iNOS inhibitory cyclic peptide-3	NO Synthase	Infection
SPSB2-iNOS inhibitory cyclic peptide-3 (Compound CP3) is an inhibitor for the interaction of SPRY domain and SOCS-box protein 2 (SPSB2) and iNOS, through binding SPSB2 on iNOS site with K_D of 7 nM .

HY-P4104

pVEC (Cadherin-5)	Peptides	Others
pVEC (Cadherin-5) is a cell-penetrating 18-amino acid-long peptide derived from the murine sequence of the cell adhesion molecule vascular endothelial cadherin. pVEC (Cadherin-5) is efficiently and rapidly taken up into cells, it can be used as a carrier peptide .

HY-108741

Plecanatide	Guanylate Cyclase	Inflammation/Immunology Cancer
Plecanatide, an analogue of Uroguanylin, is an orally active guanylate cyclase-C (GC-C) receptor agonist. Plecanatide activates GC-C receptors to stimulate cGMP synthesis with an EC₅₀ of 190 nM in T84 cells assay. Plecanatide shows anti-inflammatory activity in models of murine colitis .

HY-P5457

BMP-2 Epitope (73-92)	Peptides	Others
BMP-2 Epitope (73-92) is a biological active peptide. (This is amino acids 73 to 92 fragment of bone morphogenetic protein (BMP) knuckle epitope. It is a member of transforming growth factor beta (TGF-b). This peptide fragment is able to raise alkaline phosphate activity in murine multipotent mesenchymal cells.)

HY-P5489

IGRP(206-214)	IFNAR	Metabolic Disease Inflammation/Immunology
IGRP(206-214) is a biological active peptide. (This peptide corresponds to residues 206–214 of murine islet-specific glucose-6-phosphatase catalytic subunit–related protein (IGRP). This peptide is T cells specific for proinsulin and IGRP induces diabetes in non-obese diabetic (NOD) mice.)

HY-P1827

mTRP-2 (180-188)	Tyrosinase	Cancer
mTRP-2 (180-188) is a murine tyrosinase-related protein 2 (TRP-2) -derived peptide, corresponding to residues 180-188. TRP-2 (180-188) is identified as the major reactive epitope within TRP-2 recognized by anti-B16 CTLs .

HY-P10383

SPSB2-iNOS inhibitory cyclic peptide-1	NO Synthase	Infection
SPSB2-iNOS inhibitory cyclic peptide-1 is an inhibitor for the interaction of SPRY domain and SOCS-box protein 2 (SPSB2) and iNOS, through binding SPSB2 on iNOS site with K_D of 4.4 nM. SPSB2-iNOS inhibitory cyclic peptide-1 is resistant to the proteases pepsin, trypsin and α-chymotrypsin. SPSB2-iNOS inhibitory cyclic peptide-1 is stable in human plasma and in oxidative environment .

HY-P10383A

SPSB2-iNOS inhibitory cyclic peptide-1 TFA	NO Synthase	Infection
SPSB2-iNOS inhibitory cyclic peptide-1 TFA is the TFA salt form of SPSB2-iNOS inhibitory cyclic peptide-1(HY-P10383). SPSB2-iNOS inhibitory cyclic peptide-1 is an inhibitor for the interaction of SPRY domain and SOCS-box protein 2 (SPSB2) and iNOS, through binding SPSB2 on iNOS site with K_D of 4.4 nM. SPSB2-iNOS inhibitory cyclic peptide-1 is resistant to the proteases pepsin, trypsin and α-chymotrypsin. SPSB2-iNOS inhibitory cyclic peptide-1 is stable in human plasma and in oxidative environment .

HY-P2136F

Biotin-COG1410 TFA	Apoptosis	Neurological Disease Inflammation/Immunology Cancer
Biotin-COG1410 TFA is a biotin labled COG1410 (HY-P2136). COG1410 is an apolipoprotein E-derived peptide and an apoptosis inhibitor. COG1410 exerts neuroprotective and antiinflammatory effects in a murine model of traumatic brain injury (TBI). COG1410 can be used for the research of neurological disease .

HY-P5545

Lynronne-1	Bacterial	Infection
Lynronne-1 is an antimicrobial peptide. Lynronne-1 is active against Gram-positive bacterials, including MDR strains (MIC: 8-32 μg/mL for methicillin-resistant MRSA strains). Lynronne-1 reduces the bacterial load in MRSA infected wound murine model. Lynronne-1 is also effective against P. aeruginosa infection .

HY-108741A

Plecanatide acetate	Guanylate Cyclase	Inflammation/Immunology Cancer
Plecanatide acetate, an analogue of Uroguanylin, is an orally active guanylate cyclase-C (GC-C) receptor agonist. Plecanatide acetate activates GC-C receptors to stimulate cGMP synthesis with an EC₅₀ of 190 nM in T84 cells assay. Plecanatide acetate can be used for the research of chronic idiopathic constipation, and it also shows anti-inflammatory activity in models of murine colitis .

HY-P10710

BMP-4	IFNAR Interleukin Related COX	Inflammation/Immunology
BMP-4 is a penetrating heparin-binding peptide with anti-inflammatory and anti-chondrogenic functions. In murine chondrocytes and macrophages, BMP-4 regulates the iNOS-IFN-IL6 signaling pathway to inhibit the expression of inflammatory proteins such as iNOS, COX2, IFN, and IL6 in a dose-dependent manner, effectively suppressing inflammation and alleviating various arthritis symptoms .

HY-108741R

Plecanatide (Standard)	Guanylate Cyclase	Inflammation/Immunology
Plecanatide (Standard) is the analytical standard of Plecanatide. This product is intended for research and analytical applications. Plecanatide, an analogue of Uroguanylin, is an orally active guanylate cyclase-C (GC-C) receptor agonist. Plecanatide activates GC-C receptors to stimulate cGMP synthesis with an EC₅₀ of 190 nM in T84 cells assay. Plecanatide shows anti-inflammatory activity in models of murine colitis .

HY-P10760

PhAc-ALGP-Dox	Peptide-Drug Conjugates (PDCs)	Cancer
PhAc-ALGP-Dox, a peptide-drug conjugate, is a novel anticancer prodrug, with IC₅₀ values ranged from 311 nM to 34.25 μM for TNBC (E0771), normal murine epithelium (HC-11), human TNBC (MDA-MB-231 and MDA-MB-468), human CrC (LS 174T), normal human epithelium (HME-1) cells .

HY-P10833

VGB3	VEGFR	Cardiovascular Disease Cancer
VGB3 is an antagonist peptide of vascular endothelial growth factor receptor 1 (VEGFR1)/VEGFR2 with antiangiogenic and antitumor effects. VGB3 binds to both VEGFR1 and VEGFR2, thereby inhibits VEGF-driven proliferation, migration and tube formation of endothelial cells, and tumor growth and metastasis in murine 4T1 mammary carcinoma tumor model .

HY-13545B

ABT-510 acetate	Apoptosis	Inflammation/Immunology Cancer
ABT-510 acetate is an anti-angiogenic TSP peptide (Thrombospondin-1 analogue) that induces apoptosis and inhibits ovarian tumour growth in an orthotopic, syngeneic model of epithelial ovarian cancer. ABT-510 acetate also reduces angiogenesis and inflammatory responses in a murine model of inflammatory bowel disease. ABT-510 acetate can be used in studies of cancer (particularly epithelial ovarian cancer) and inflammatory bowel disease (IBD) .

HY-13545

ABT-510	Apoptosis	Inflammation/Immunology Cancer
ABT-510 is an anti-angiogenic TSP peptide (Thrombospondin-1 analogue) that induces apoptosis and inhibits ovarian tumour growth in an orthotopic, syngeneic model of epithelial ovarian cancer. ABT-510 also reduces angiogenesis and inflammatory responses in a murine model of inflammatory bowel disease. ABT-510 can be used in studies of cancer (particularly epithelial ovarian cancer) and inflammatory bowel disease (IBD) .

HY-P10793

Cyclic(YCDGFYACYMDV)	EGFR Apoptosis	Cancer
Cyclic(YCDGFYACYMDV) is a HER2 signaling pathway inhibitor with anti-cancer activity. This compound self-assembles into nanoparticles in aqueous solution and transforms into nanofibers upon specific binding to HER2 on cancer cells. This transformation disrupts HER2 dimerization and subsequent downstream signaling events, leading to cancer cell apoptosis (Apoptosis). The inhibitory effects on HER2 positive breast cancer have been demonstrated to be effective in a murine xenograft model .

HY-P10109

G6PI 325-339 (human)	Peptides	Inflammation/Immunology
G6PI 325-339 (human) is an efficient inducer of arthritis in B10.Q mice. G6PI 325-339 (human) primes Th1 and Th17 cells cross-reacted with the murine G6PI protein. G6PI 325-339 (human) induces arthritis model operating through a T and B cell-dependent pathway but without antibody effector mechanisms .

HY-P10109A

G6PI 325-339 (human) hydrochloride hG6PI (325-339) hydrochloride	Peptides	Inflammation/Immunology
G6PI 325-339 (human) hydrochloride is an efficient inducer of arthritis in B10.Q mice. G6PI 325-339 (human) hydrochloride primes Th1 and Th17 cells cross-reacted with the murine G6PI protein. G6PI 325-339 (human) hydrochloride induces arthritis model operating through a T and B cell-dependent pathway but without antibody effector mechanisms .

HY-P5350

FN-A208 fusion peptide	Peptides	Others
FN-A208 is a biological active peptide. (This peptide is a fusion of A208, derived from murine laminin a1, and the active site of fibronectin (GRGDS), with a glycine spacer. This peptide forms amyloid-like fibrils and promotes formation of actin stress fibers that mediate fibroblast cell attachment, offering it potential as a bioadhesive for tissue regeneration and engineering. FN-A208 interacts with IKVAV receptors and integrins. Its activity is disrupted by the presence of EDTA.)

HY-P2379

His-Cys-Lys-Phe-Trp-Trp	HIV Integrase	Infection
His-Cys-Lys-Phe-Trp-Trp is an inhibitor for the human immunodeficiency virus (HIV) integrase with an IC₅₀ of 2 μM .

HY-P10580

Vasculotide	Tie	Infection Metabolic Disease Inflammation/Immunology Cancer
Vasculotide, an angiopoietin-1 mimetic, is a Tie-2 activator and induces Tie-2 phosphorylation. Vasculotide has anti-inflammatiory effect and anti-permeability. Vasculotide ameliorates endotoxin-induced endothelial barrier dysfunction. Vasculotide promotes angiogenesis in a mouse model of diabetic ulcer. Vasculotide protects mice from vascular leakage and reduces mortality in murine abdominal sepsis. Vasculotide decreases microvascular leakage and improves microcirculatory perfusion in a rat model of hemorrhagic shock .

HY-P10580A

Vasculotide TFA	Tie	Infection Metabolic Disease Inflammation/Immunology Cancer
Vasculotide TFA, an angiopoietin-1 mimetic, is a Tie-2 activator and induces Tie-2 phosphorylation. Vasculotide has anti-inflammatiory effect and anti-permeability. Vasculotide TFA ameliorates endotoxin-induced endothelial barrier dysfunction. Vasculotide TFA promotes angiogenesis in a mouse model of diabetic ulcer. Vasculotide TFA protects mice from vascular leakage and reduces mortality in murine abdominal sepsis. Vasculotide TFA decreases microvascular leakage and improves microcirculatory perfusion in a rat model of hemorrhagic shock .

HY-P1110

AF12198 4 Publications Verification	Interleukin Related	Inflammation/Immunology
AF12198 is a potent, selective and specific peptide antagonist for human type I interleukin-1 receptor (IL1-R1) (IC₅₀=8 nM) but not the human type II receptor (IC₅₀=6.7 µM) or the murine type I receptor (IC₅₀>200 µM). AF12198 inhibits IL-1-induced IL-8 production (IC₅₀=25 nM) and IL-1-induced intercellular adhesion molecule-1 (ICAM-1) expression (IC₅₀=9 nM) in vitro. AF12198 has anti-inflammatory activities and blocks responses to IL-1 in vivo .

Cat. No.	Product Name	Target	Research Area

HY-P99177

Enibarcimab	SARS-CoV	Infection Cardiovascular Disease
Enibarcimab is a humanised murine monoclonal immunoglobulin G1 (IgG1) antibody, could be used for acute heart failure, COVID-19 infections and septic shock research .

HY-P99336

Enlimomab BI-RR 0001; Anti-Human IL6 Recombinant Antibody	Integrin	Neurological Disease Inflammation/Immunology
Enlimomab (BI-RR 0001), a murine IgG2a monoclonal antibody to the human ICAM-1, inhibits leukocyte adhesion to the vascular endothelium, thereby decreasing leukocyte extravasation and inflammatory tissue injury. Enlimomab has anti-inflammatory effects, and can be used for stroke research .

HY-P99611

Faralimomab 64G12	IFNAR	Inflammation/Immunology
Faralimomab (64G12) is an immunomodulator, and a murine anti-IFNA1 IgG1 mAb .

HY-P99294

Ganitumab AMG 479; Human Anti-IGF1R Recombinant Antibody	IGF-1R	Cancer
Ganitumab (AMG 479) is a recombinant human monoclonal antibody to the human type 1 insulin-like growth factor receptor (IGF1R). Ganitumab recognizes murine IGF1R with sub-nanomolar affinity (K_D=0.22 nM) and inhibits the interaction of murine IGF1R with IGF1 and IGF2. Ganitumab can be used in research of cancer .

HY-P99326

Tositumomab Anti-Human CD20 Recombinant Antibody	Radionuclide-Drug Conjugates (RDCs) CD20	Cancer
Tositumomab is a murine IgG2a lambda monoclonal antibody directed against the CD20 antigen, which is found on the surface of normal and malignant B lymphocytes .

HY-P99707

Lilotomab HH1	Apoptosis	Cancer
Lilotomab (HH1) is a murine anti-CD37 monoclonal antibody. Lilotomab reduces clonogenic survival. Lilotomab shows anti-tumor activity .

HY-P99732

Minretumomab CC-49	Mucin	Cancer
Minretumomab (CC-49) is a murine monoclonal antibody against TAG-72 (tumor-associated glycoprotein 72). Minretumomab is used in cancer and immunity research .

HY-108852

Basiliximab CHI 621	Interleukin Related	Inflammation/Immunology Cancer
Basiliximab (CHI 621) is a recombinant chimeric murine/human IgG1 monoclonal anti-interleukin-2 receptor antibody. Basiliximab can be used for the research of renal transplantation .

HY-P99726

Maslimomab	Inhibitory Antibodies	Inflammation/Immunology
Maslimomab is a murine monoclonal antibody targeting T-cell receptor. Maslimomab is an immunosuppressive agent .

HY-P9937

Arcitumomab	Transmembrane Glycoprotein	Cancer
Arcitumomab is a murine anti-carcinoembryonic antigen (CEA) monoclonal antibody Fab’ fragment. Arcitumomab can be labeled with technetium-99m and can be used for single-photon emission computed tomography (SPECT) imaging .

HY-P99231

Edrecolomab Panorex; CO17-1A	Inhibitory Antibodies	Cancer
Edrecolomab (Panorex) is a murine monoclonal antibody to the cell-surface glycoprotein 17-1A, expressed on epithelial tissues and on various carcinomas. Edrecolomab shows anti-tumor activity and can be used in colorectal carcinoma research .

HY-P99466

Begelomab SAND-26	Dipeptidyl Peptidase	Inflammation/Immunology
Begelomab (SAND-26) is a murine IgG2b monoclonal antibody against DPP-4/CD26. Begelomab can be used for the research of severe refractory idiopathic inflammatory myopathy .

HY-P99636

Gavilimomab ABX-CBL	Complement System	Inflammation/Immunology
Gavilimomab (ABX-CBL) is an IgM murine monoclonal antibody that recognizes CD147 on the cell surface and initiates cell killing through complement-mediated lysis. Gavilimomab can be used for the research of graft-versus-host disease (GVHD) .

HY-P9942

Sulesomab	Inhibitory Antibodies	Inflammation/Immunology
Sulesomab (IMMU-MN3) is a murine monoclonal antibody fragment of the IgG1 class that binds to Normal Cross-Reactive Antigen-90 present on leukocytes. Sulesomab is cleared into infection nonspecifically through increased capillary membrane permeability .

HY-P99566

Tenatumomab ST2146	Transmembrane Glycoprotein	Cancer
Tenatumomab (ST2146) is a murine monoclonal antibody against tenascin-C. And tenascin-C, the large extracellular glycoprotein, is overexpressed in cancer. Tenatumomab has been used for Pretargeted Antibody Guided Radioimmunoresearch (PAGRIT), and delivering radionuclides to tumors via PAGRIT and direct 131Iodine labeling approach .

HY-141607

Indatuximab ravtansine BT-062; nBT062-DM4	Antibody-Drug Conjugates (ADCs) Bacterial	Cancer
Indatuximab ravtansine (BT-062) is an antibody-drug conjugate (ADC) (Antibody-Drug Conjugates (ADCs)) based on a murine/human chimeric form of B-B4 (specific for CD138), linked to the maytansinoid agent DM4 by disulphide bonds. Indatuximab ravtansine shows anti-tumor activities .

HY-P99837

Dafsolimab SPV-T3a	CD3	Infection
Dafsolimab (SPV-T3a) is an IgG2a murine monoclonal antibody (anti-CD3). Dafsolimab can induce cell death through modulation and activation of the CD3/T cell receptor complex. Dafsolimab can be used for the research of graft-versus-host disease (GVHD) .

HY-P99436

Anatumomab mafenatox ABR-214936	Transmembrane Glycoprotein	Cardiovascular Disease Inflammation/Immunology Cancer
Anatumomab mafenatox (ABR-214936) is a 73 KDa recombinant protein to recognize the tumor-associated antigen 5T4, which is widely expressing in malignancy. Anatumomab mafenatox is between a modified form of SEA and a murine Fab. The main side effects of Anatumomab mafenatox are reported to include fever, low blood pressure, pain, nausea and drowsiness .

HY-P99276

Abagovomab Anti-Human CA-125 Recombinant Antibody	Inhibitory Antibodies	Cancer
Abagovomab (Anti-Human CA-125 Recombinant Antibody) is a murine monoclonal anti-idiotypic antibody, against the tumor-associated antigen, CA-125. Abagovomab is generated by a mouse hybridoma, can imitate the human TAA, CA-125. Abagovomab can elicit humoral and cellular immune responses against ovarian cancer (oc) .

HY-P9933

Dinutuximab APN-311	Inhibitory Antibodies	Cancer
Dinutuximab (Unituxin; APN-311) is a chimeric, human-murine, anti-GD2 monoclonal antibody. Dinutuximab potently enlongs event-free survival and overall survival, in high-risk neuroblastoma treatment, in combination with granulocyte-macrophage colony-stimulating factor (GM-CSF), aldesleukin (interleukin-2 [IL-2]), and isotretinoin (13-cis-retinoic acid [RA]) .

HY-P99333

Volociximab 1 Publications Verification M200; Eos 200-4	Integrin	Cardiovascular Disease Cancer
Volociximab (M200) is a chimeric human/murine IgG4 antibody IIA1 targeting integrin α5β1 (EC₅₀=0.2 nM). Integrin α5β1 is a major fibronectin receptor involved in angiogenesis. Volociximab has antiangiogenic and antitumor activities and inhibits the proliferation of human umbilical vein vascular endothelial cells (HUVECs) .

HY-P99023

Girentuximab 1 Publications Verification G250; cG250	Carbonic Anhydrase	Cancer
Girentuximab (G250) is a chimeric monoclonal antibody that binds carbonic anhydrase IX (CAIX), a cell surface glycoprotein ubiquitously expressed in clear cell renal cell carcinoma (ccRCC) .

HY-P99008

Atibuclimab 1 Publications Verification	Toll-like Receptor (TLR)	Inflammation/Immunology
Atibuclimab, is a chimeric monoclonal antibody directed against CD14 and is composed of murine variable and human IgG4 Fc regions. Atibuclimab can be used for the research of amyotrophic lateral sclerosis . Atibuclimab attenuates LPS-induced symptoms and strongly inhibits LPS-induced proinflammatory cytokine release, while only delaying the release of the anti-inflammatory cytokines soluble TNF receptor type I and IL-1 receptor antagonist .

HY-P9948

Alemtuzumab Campath-IH	Apoptosis	Cancer
Alemtuzumab (Campath-IH) is a humanized monoclonal antibody against CD52. Alemtuzumab does not cross-react with murine CD52. Alemtuzumab selectively targets the CD52 antigen to induce profound lymphocyte depletion, followed by recovery of T and B cells with regulatory phenotypes. Alemtuzumab is capable of complement-dependent cytotoxicity and antibody-dependent cell-mediated cytotoxicity (ADCC), as well as induction of apoptosis. Alemtuzumab has the potential for B-cell chronic lymphocytic leukaemia research .

HY-P99287

Elsilimomab B-E8; Anti-IL-6 MAB B-E8	Interleukin Related	Inflammation/Immunology Cancer
Elsilimomab (B-E8) is a IgG1 monoclonal antibody against interleukin-6 (IL-6), with a K_D of 22 pM and an IC₅₀ of 1.4 nM. Elsilimomab can be used for the research of multiple myeloma, renal cell carcinoma, and rheumatoid arthritis (RA) .

HY-P99379

Nidanilimab (Nadunolimab) CAN04; Anti-IL-1RAP/IL-1R3 Reference Antibody (nidanilimab)	Interleukin Related	Cancer
Nidanilimab (CAN04) is a fully humanized monoclonal anti-IL1RAP antibody with a K_d value of 1.10 pM. Nidanilimab blocks IL1α and IL1β signaling and stimulates the immune system to destroy tumour cells. Nidanilimab can be used in research of non-small lung cancer (NSCLC) and pancreatic ductal adenocarcinoma (PDAC) .

Cat. No.	Product Name	Category	Target	Chemical Structure

HY-N1713

29-Nor-20-oxolupeol	Triterpenes Structural Classification Classification of Application Fields Terpenoids Labiatae Source classification Plants Inflammation/Immunology Disease Research Fields Vachellia nilotica (L.) P. J. H. Hurter & Mabb.	Others
29-Nor-20-oxolupeol, extracted from Impatiens basamina, reduces NO levels in LPS-activated murine microglial cells with an IC₅₀ of 44.21 µM .

HY-N1649

2,3,2'',3''-Tetrahydroochnaflavone	Haplopteris anguste-elongata (Hayata) E. H. Crane Flavonoids Classification of Application Fields Source classification Phenols Polyphenols Plants Pteris vittata L. Biflavones Disease Research Fields Cancer	Others
2,3,2'',3''-Tetrahydroochnaflavone is a biflavonoid, which can be isolated from the leaves of Quintinia acutifolia. 2,3,2'',3''-Tetrahydroochnaflavone shows some cytotoxicity against P388 murine lymphocytic leukemia cells, with an IC₅₀ of 8.2 µg/mL .

HY-N1388

Tussilagone 1 Publications Verification	Structural Classification Classification of Application Fields Terpenoids Sesquiterpenes Source classification Plants Compositae Inflammation/Immunology Disease Research Fields Tephrosia purpurea (L.) Pers.	Others
Tussilagone, a major active component in Tussilago farfara, has anti-inflammatory effect. Tussilagone ameliorates inflammatory responses in dextran sulphate sodium-induced murine colitis. Tussilagone inhibits the inflammatory response and improves survival in cecal ligation and puncture (CLP)-induced septic mice .

HY-W272217

Octacosane n-Octacosane; NSC 5549	Structural Classification Natural Products Classification of Application Fields Source classification Endogenous metabolite Inflammation/Immunology Disease Research Fields Cancer	Endogenous Metabolite Bacterial
Octacosane is an endogenous metabolite with antibacterial activity. Octacosane shows high cytotoxicity against murine melanoma B16F10-Nex2 cells besides inducing protection against a grafted subcutaneous melanoma. Octacosane has the larvicidal activity against mosquito Culex quinquefasciatus with the LC₅₀ concentration of 7.2 mg/l .

HY-N10445

Maydispenoid A	Structural Classification Microorganisms Terpenoids Sesquiterpenes Source classification Plants Salicaceae	CD28 CD3
Maydispenoid A is a potent immunosuppressor. Maydispenoid A can inhibit anti-CD3/anti-CD28 mAbs activated and lipopolysaccharide activated murine splenocyte proliferation .

HY-N10446

Maydispenoid B	Structural Classification Microorganisms Terpenoids Sesquiterpenes Source classification	CD28 CD3
Maydispenoid B is a potent immunosuppressor. Maydispenoid B can inhibit anti-CD3/anti-CD28 mAbs activated and lipopolysaccharide activated murine splenocyte proliferation .

HY-P1293

Conantokin G	Structural Classification Natural Products Animals Source classification	iGluR
Conantokin G, a 17-amino-acid peptide, is a potent, selective and competitive antagonist of N-methyl-D-aspartate (NMDA) receptors. Conantokin G inhibits NMDA-evoked currents in murine cortical neurons with an IC₅₀ of 480 nM. Conantokin G has neuroprotective properties .

HY-P1293A

Conantokin G TFA	Natural Products Animals Source classification	iGluR
Conantokin G TFA, a 17-amino-acid peptide, is a potent, selective and competitive antagonist of N-methyl-D-aspartate (NMDA) receptors. Conantokin G TFA inhibits NMDA-evoked currents in murine cortical neurons with an IC₅₀ of 480 nM. Conantokin G TFA has neuroprotective properties .

HY-N0859B

Schisanchinin D	Structural Classification Source classification Lignans Phenylpropanoids Plants Schisandraceae Schisandra chinensis (Turcz.) Baill.	NO Synthase
Schisanchinin D is an NO release inhibitor found in the fruits of Schisandra chinensis. Schisanchinin D can inhibit the release of nitric oxide (NO) by lipopolysaccharide (LPS)-activated microglia in primary murine BV2 microglia cells. Schisanchinin D is promising for research of neurodegenerative diseases such as Alzheimer's disease (AD) .

HY-N14957

Clavicoronic acid	Structural Classification Natural Products Microorganisms Source classification	Antibiotic
Clavicoronic acid is an avian myeloblastosis virus and *Moloney murine* leukemia virus reverse transcriptases inhibitor with K_i** values of 130, 68 µM, respectively. Clavicoronic acid inhibits the multiplication of vesicular stomatitis virus by interfering with this virus's RNA-directed RNA-polymerase. Clavicoronic acid shows no cytotoxicity .

HY-W272217R

Octacosane (Standard)	Structural Classification Natural Products Source classification Endogenous metabolite	Endogenous Metabolite Bacterial
Octacosane (Standard) is the analytical standard of Octacosane. This product is intended for research and analytical applications. Octacosane is an endogenous metabolite with antibacterial activity. Octacosane shows high cytotoxicity against murine melanoma B16F10-Nex2 cells besides inducing protection against a grafted subcutaneous melanoma. Octacosane has the larvicidal activity against mosquito Culex quinquefasciatus with the LC50 concentration of 7.2 mg/l .

HY-N1388R

Tussilagone (Standard)	Structural Classification Terpenoids Sesquiterpenes Source classification Plants Compositae Tephrosia purpurea (L.) Pers.	Others
Tussilagone (Standard) is the analytical standard of Tussilagone. This product is intended for research and analytical applications. Tussilagone, a major active component in Tussilago farfara, has anti-inflammatory effect. Tussilagone ameliorates inflammatory responses in dextran sulphate sodium-induced murine colitis. Tussilagone inhibits the inflammatory response and improves survival in cecal ligation and puncture (CLP)-induced septic mice .

HY-N10337

Norjuziphine (-)-Norjuziphine	Structural Classification Alkaloids Source classification Nelumbo nucifera Gaertn. Quinoline Alkaloids Plants Nymphaeaceae	Drug Derivative
Norjuziphine is an alkaloid found in the lotus flower (Nelumbo nucifera). Norjuziphine inhibits the melanogenesis of murine B16 melanoma 4A5 cells stimulated by Theophylline (HY-B0809) (IC₅₀=14.4 μM). Norjuziphine is promising for research of skin whitening and related skin pigmentation diseases .

HY-120241

Reticulol K 251-1	Structural Classification Microorganisms Source classification Phenols Polyphenols	Phosphodiesterase (PDE)
Reticulol (K 251-1) is an inhibitor of cyclic adenosine 3', 5'-monophosphate phosphodiesterase. Reticulol shows antitumor activity independent with cell cycle arrest or apoptosis. Reticulol inhibits cell growth of murine melanoma cells and human lung tumor cells. Reticulol protects its lung metastasis via the bloodstream by inhibiting the growth of B16F10 melanoma .

HY-125138

ω-Muricholic Acid 1 Publications Verification	Microorganisms Classification of Application Fields Source classification Metabolic Disease Disease Research Fields Steroids	Endogenous Metabolite
ω-Muricholic acid (ω-MCA) is a murine-specific secondary bile acid .

HY-N13878

Anguinomycin B	Structural Classification Natural Products Microorganisms Source classification	Antibiotic Bacterial
Anguinomycin B is an antitumor antibiotic that shows highly cytotoxic to murine P388 leukemia cells .

HY-N10206

11-epi-Chaetomugilin I	Human Gut Microbiota Metabolites Microorganisms Classification of Application Fields Ketones, Aldehydes, Acids Source classification Endogenous metabolite Disease Research Fields Cancer	Endogenous Metabolite
11-epi-Chaetomugilin I is a metabolite found in Chaetomium globosum. 11-epi-Chaetomugilin I exhibits significant cytotoxic activity against the murine P388 leukemia cell line, the human HL-60 leukemia cell line, the murine L1210 leukemia cell line, and the human KB epidermoid carcinoma cell line .

HY-N14697

Cytorhodin X	Quinones Structural Classification Microorganisms Source classification Naphthalene Quinones	Antibiotic
Cytorhodin X is a cytotoxic antibiotic. Cytorhodin X can inhibit the proliferation of L1210 murine leukemia cells, with an ED₅₀ of 0.36 μM .

HY-120333

Antibiotic PF 1052	Infection Structural Classification Microorganisms Anti-inflammation/Immunoregulatory Classification of Application Fields Antibiotics Source classification Disease Research Disease Research Fields Other Antibiotics	Antibiotic Fungal Bacterial
Antibiotic PF 1052 is an antibiotic extracted from a natural product library. Antibiotic PF 1052 has an inhibitory effect on murine neutrophil migration .

HY-129151

Ganoderic acid C1	Triterpenes Structural Classification Classification of Application Fields Terpenoids Polyporaceae Source classification Ganoderma lucidum (Leyss. Ex Fr.) Karst. Plants Inflammation/Immunology Disease Research Fields	TNF Receptor
Ganoderic acid C1, a natural compound that could be isolated from G. lucidum, suppresses TNF-α production by murine macrophages (RAW 264.7 cells) .

HY-N2838

Alismol	Structural Classification Animals Terpenoids Sesquiterpenes Source classification	NO Synthase
Alismol is a natural sesquiterpene. Alismol shows promising inhibitory effects on INF-γ-induced nitric oxide production in murine macrophage RAW264.7 cells .

HY-N3215

Nagilactone C	Structural Classification Terpenoids Source classification Diterpenoids Podocarpus sellowii Klotzsch ex Endl. Plants Podocarpaceae	Others
Nagilactone C is a diterpene dilactone compound isolated from Podocarpus neriifolius. Nagilactone C has potent antiproliferative activity against human fibrosarcoma and murine colon carcinoma tumor cell lines .

HY-N0608

Myrislignan	Monophenols Classification of Application Fields Simple Phenylpropanols Source classification Phenols Myristicaceae Phenylpropanoids Plants Myristica fragrans Houtt. Disease Research Fields Inflammation/Immunology	NF-κB
Myrislignan, a lignan isolated from Myristica fragrans Houtt, possesses anti-inflammatory activities. Myrislignan attenuates LPS-induced inflammation reaction in murine macrophage cells through inhibition of NF-kB signalling pathway activation .

HY-N14180

6-Deoxyilludin M	Structural Classification Microorganisms Antibiotics Source classification Other Antibiotics	Antibiotic
6-Deoxyilludin M is an antitumor antibiotic possessing antileukemic activity. 6-Deoxyilludin M can be isolated from the culture broth of the Basidiomycota Pleurotus japonicas .

HY-N0589

Dehydrodiisoeugenol 1 Publications Verification	Structural Classification Monophenols Classification of Application Fields Simple Phenylpropanols Source classification Phenols Myristicaceae Phenylpropanoids Plants Myristica fragrans Houtt. Inflammation/Immunology Disease Research Fields	NF-κB COX Bacterial
Dehydrodiisoeugenol is isolated from Myristica fragrans Houtt, shows anti-inflammatory and anti-bacterial actions . Dehydrodiisoeugenol inhibits LPS- stimulated NF-κB activation and cyclooxygenase (COX)-2 gene expression in murine macrophages .

HY-N13898

Alldimycin A	Quinones Structural Classification Natural Products Microorganisms Anthraquinones Source classification	DNA/RNA Synthesis
Alldimycin A is an anthracycline compound that inhibits RNA and DNA syntheses. Alldimycin A inhibits the growth, DNA and RNA synthesis of murine leukemic L1210, with IC₅₀ values of 0.05 μg/mL, 0.92 μg/mL, and 0.47 μg/mL, respectively .

HY-N0608A

(Rac)-Myrislignan	Monophenols Classification of Application Fields Source classification Phenols Myristicaceae Plants Myristica fragrans Houtt. Disease Research Fields Inflammation/Immunology	NF-κB
(Rac)-Myrislignan is the racemate of Myrislignan. Myrislignan, a lignan isolated from Myristica fragrans Houtt, possesses anti-inflammatory activities. Myrislignan attenuates LPS-induced inflammation reaction in murine macrophage cells through inhibition of NF-kB signalling pathway activation .

HY-136386R

N-Acetyl-D-cysteine (Standard)	Microorganisms Source classification	Reactive Oxygen Species
N-Acetyl-D-cysteine (Standard) is the analytical standard of N-Acetyl-D-cysteine. This product is intended for research and analytical applications. N-Acetyl-D-cysteine has antioxidant activities and scavenges ROS through the reaction with its thiol group, but cannot enter the glutathione metabolic pathway .

HY-76200

Voriconazole Maximum Cited Publications 6 Publications Verification UK-109496	Microorganisms Source classification	Fungal Bacterial
Voriconazole (UK-109496) is a second-generation, broad-spectrum triazole antifungal agent that inhibits fungal ergosterol biosynthesis. Voriconazole exerts its antifungal activity by inhibition of 14-α-lanosterol demethylation, which is mediated by fungal cytochrome P450 enzymes .

HY-W573700

Methyl everninate	Structural Classification other families Source classification Plagiochila bifaria (Sw.) Lindenb. Phenols Plants	Others
Methyl everninate is the major constituent of the deuterochloroform. Methyl everninate, rhodomollosides A and B are the derivatives of Methyl everninate, with cytotoxicity against RAW264.7 cells. Both of they shows inhibitory effects with a lipopolysaccharide (LPS)-stimulated murine macrophages RAW 264.7 cells model .

HY-N1622

1-Dehydroxy-23-deoxojessic acid	Triterpenes Combretaceae Source classification Plants Combretum quadrangulare Kurz	Others
1-Dehydroxy-23-deoxojessic acid (compound 10) is a cycloartane-type triterpene. 1-Dehydroxy-23-deoxojessic acid exhibits cytotoxicity against murine colon 26-L5 carcinoma cells, with an EC₅₀ of 62.38 μM .

HY-N12255

COTC	Structural Classification Natural Products Microorganisms Source classification	Glyoxalase (GLO)
COTC is a bacterial metabolite with anticancer activity that is found in S. griseosporeus. COTC inhibits glyoxalase in the presence of glutathione (GSH). COTC also inhibits the proliferation of HeLa cells (IC₅₀ = 18 µg/mL), as well as reduces tumor growth and improves survival in an Ehrlich murine spontaneous adenocarcinoma model .

HY-113262

8-Hydroxyguanosine	Alkaloids Structural Classification Other Alkaloids Source classification Disease markers Nervous System Disorder Endogenous metabolite	Endogenous Metabolite Interleukin Related
8-Hydroxyguanosine, an oxidized nucleoside, is a marker of RNA oxidative damage and oxidative stress. 8-Hydroxyguanosine stimulates proliferation and differentiation of murine B cells with immunostimulatory activity. 8-Hydroxyguanosine is promising for research of Alzheimer’s disease and Down’s syndrome .

HY-130430

Neplanocin A (-)-Neplanocin A	Structural Classification Natural Products Microorganisms Source classification	Antibiotic Orthopoxvirus
Neplanocin A ((-)-Neplanocin A) is an antitumor antibiotic with significant antitumor activity against murine L1210 leukemia. Neplanocin A is also an irreversible inhibitor of AdoHcy hydrolase (K_i=8.39 nM). Neplanocin A also has antiviral activity and is effective against vaccinia virus. Neplanocin A is obtained from Ampulariella regularis .

HY-N2350

Cynaropicrin	Saussurea costus (Falc.) Lipsch. Structural Classification Classification of Application Fields Source classification Phenols Plants Compositae Disease Research Fields Cancer	MMP NF-κB TNF Receptor
Cynaropicrin is a sesquiterpene lactone which can inhibit tumor necrosis factor (TNF-α) release with IC₅₀s of 8.24 and 3.18 μM for murine and human macrophage cells, respectively. Cynaropicrin also inhibits the increase of cartilage degradation factor (MMP13) and suppresses NF-κB signaling.

HY-N0589R

Dehydrodiisoeugenol (Standard)	Structural Classification Monophenols Simple Phenylpropanols Source classification Phenols Myristicaceae Phenylpropanoids Plants Myristica fragrans Houtt.	NF-κB COX Bacterial
Dehydrodiisoeugenol (Standard) is the analytical standard of Dehydrodiisoeugenol. This product is intended for research and analytical applications. Dehydrodiisoeugenol is isolated from Myristica fragrans Houtt, shows anti-inflammatory and anti-bacterial actions . Dehydrodiisoeugenol inhibits LPS-stimulated NF-κB activation and cyclooxygenase (COX)-2 gene expression in murine macrophages .

HY-N2106

Dehydroevodiamine 1 Publications Verification	Alkaloids Structural Classification Classification of Application Fields Evodia rutaecarpa (Juss.) Benth. Source classification Rutaceae Plants Inflammation/Immunology Disease Research Fields Indole Alkaloids	NF-κB COX PGE synthase NO Synthase
Dehydroevodiamine is a major bioactive quinazoline alkaloid isolated from Evodiae Fructus, has an antiarrhythmic effect in guinea-pig ventricular myocytes . Dehydroevodiamine inhibits LPS-induced iNOS, COX-2, prostaglandin E2 (PGE2) and nuclear factor-kappa B (NF-κB) expression in murine macrophage cells .

HY-N2939

Bis-5,5-Nortrachelogenin	Structural Classification Thymelaeaceae Source classification Lignans Phenylpropanoids Plants Wikstroemia indica	Others
Bis-5,5-Nortrachelogenin is isolated from active extract of root of Wikstroemia indica. Bis-5,5-Nortrachelogenin inhibits nitric oxide (NO) production in a lipopolysaccharide (LPS) and recombinant mouse interferon-γ(IFN-γ) activated murine macrophage-like cell line, RAW 264.7 with an IC₅₀ value of 48.6 mM .

HY-167860

BE-12406B	Structural Classification Natural Products Microorganisms Source classification	Others
BE-12406B is an antitumor agent that can be found in the culture broth of a streptomycete. BE-12406B can inhibit the growth of Vincristine (HY-N0488)-resistant or Doxorubicin (HY-15142A)-resistant P388 murine leukemia cell lines as well as their parent sensitive cell line .

HY-121619

Jacaric acid	Structural Classification Caprifoliaceae Ketones, Aldehydes, Acids Source classification Plants Centranthus ruber (L.) DC	Apoptosis
Jacaric acid is a conjugated linolenic acid, which inhibits viability in cells PC-3 (IC₅₀ is 11.8 μM), LNCaP (IC₅₀ is 2.2 μM) and DLD-1, induces apoptosis and necrosis . Jacaric acid exhibits anticaner activity against prostate cancer and adenocarcinoma . Jacaric acid exhibits immunomodulating activity in murine peritoneal macrophages as an immunopotentiator . Jacaric acid is orally active.

HY-N13095

(+)-Plakevulin A	Structural Classification Animals Ketones, Aldehydes, Acids Source classification	DNA/RNA Synthesis Apoptosis
(+)-Plakevulin A (Plakevulin A) is an oxylipin and can be isolated from an Okinawan sponge Plakortis sp. (+)-Plakevulin A inhibits the enzymatic activity of DNA polymerases α and δ. (+)-Plakevulin A induces apoptosis and shows anticancer activity .

HY-N2350R

Cynaropicrin (Standard)	Saussurea costus (Falc.) Lipsch. Structural Classification Source classification Phenols Plants Compositae	MMP NF-κB TNF Receptor
Cynaropicrin (Standard) is the analytical standard of Cynaropicrin. This product is intended for research and analytical applications. Cynaropicrin is a sesquiterpene lactone which can inhibit tumor necrosis factor (TNF-α) release with IC₅₀s of 8.24 and 3.18 μM for murine and human macrophage cells, respectively. Cynaropicrin also inhibits the increase of cartilage degradation factor (MMP13) and suppresses NF-κB signaling.

HY-N6703

ar-Turmerone (+)-ar-Turmerone	Structural Classification Natural Products Classification of Application Fields Source classification Plants Curcuma longa Inflammation/Immunology Disease Research Fields Zingiberaceae	Apoptosis
ar-Turmerone ((+)-ar-Turmerone) is an orally active and major bioactive compound of the herb Curcuma longa with anti-tumorigenesis and anti-inflammatory activities. ar-Turmerone induces apoptosis in U937 cells. ar-Turmerone exerts positive modulation on murine DCs. ar-Turmerone induces NSC proliferation in vitro and in vivo, and can be used for various neurologic disorders study .

HY-112661

PC-766B Antibiotic PC-766B	Infection Structural Classification Microorganisms Macrolide Antibiotics Classification of Application Fields Antibiotics Source classification Disease Research Fields Cancer	Antibiotic Bacterial Fungal
PC-766B is a macrolide antibiotic. PC-766B is active against Gram-positive bacteria, and some fungi and yeasts, but inactive against Gram-negative bacteria. PC-766B shows antitumor activity against murine tumor cells. PC-766B has weak inhibitory activity against Na ⁺, K ⁺-ATPase .

HY-N7241

Saudin	Clutia lanceolata Forssk. Structural Classification Other Monoterpenes Terpenoids Source classification Euphorbiaceae Plants	Others
Saudin, derived from Clutia lanceolata, is a hypoglycemic compound that significantly enhances glucose-triggered insulin release from murine pancreatic islets. It belongs to a group of new diterpenoids with a distinct tetracyclic core, suggesting potential as a therapeutic agent for diabetes treatment. Proposed biosynthetic pathways outline alternative cyclization routes from a common precursor, with Lanceolide P (16) identified as a promising lead compound for further development in managing diabetes .

HY-B1971

Deltamethrin 1 Publications Verification Decamethrin	Structural Classification Natural Products Classification of Application Fields Source classification Endogenous metabolite Inflammation/Immunology Disease Research Fields Cancer	Endogenous Metabolite Calcium Channel Caspase Apoptosis Bcl-2 Family NF-κB Interleukin Related
Deltamethrin (Decamethrin) is an orally active synthetic pyrethroid insecticide. Deltamethrin induces oxidative stress and results in inflammation and apoptosis via inhibiting Nrf2/HO-1 pathway. Deltamethrin has an anticancer effect by inducing apoptosis. Deltamethrin can be used extensively in pest control .

HY-B1971R

Deltamethrin (Standard)	Structural Classification Natural Products Source classification Endogenous metabolite	Endogenous Metabolite Calcium Channel Caspase Apoptosis Bcl-2 Family NF-κB Interleukin Related
Deltamethrin (Standard) is the analytical standard of Deltamethrin. This product is intended for research and analytical applications. Deltamethrin (Decamethrin) is an orally active synthetic pyrethroid insecticide. Deltamethrin induces oxidative stress and results in inflammation and apoptosis via inhibiting Nrf2/HO-1 pathway. Deltamethrin has an anticancer effect by inducing apoptosis. Deltamethrin can be used extensively in pest control .

HY-126052

Gnetol	Structural Classification Stilbenes Classification of Application Fields Source classification Phenols Polyphenols Gnetaceae Metabolic Disease Plants Disease Research Fields Gnetum montanum Markgr.	COX Tyrosinase HDAC
Gnetol is a phenolic compound isolated from the root of Gnetum montanum . Gnetol potently inhibits COX-1 (IC₅₀ of 0.78 μM) and HDAC. Gnetol is a potent tyrosinase inhibitor with an IC₅₀ of 4.5 μM for murine tyrosinase and suppresses melanin biosynthesis. Gnetol has antioxidant, antiproliferative, anticancer and hepatoprotective activity. Gnetol also possesses concentration-dependent α-Amylase, α-glucosidase, and adipogenesis activities .

HY-117037

FR900359	Structural Classification Ardisia crenata Sims Ketones, Aldehydes, Acids Source classification Plants Myrsinaceae	Apoptosis ERK
FR900359 is a depsipeptide selective inhibitor of Gα_q/11/14 in mammalia, can inhibits ERK pathway. FR900359 suppresses the proliferation of melanoma cells and decreases of blood pressure. FR900359 also protected against airway hyperreactivity in murine models of allergen sensitization in Ovalbumins(HY-W250978)–induced sensitization model of asthma. FR900359 can be used for cancer and cardiovascular disease research .

HY-N6703R

ar-Turmerone (Standard) (+)-ar-Turmerone (Standard)	Structural Classification Natural Products Source classification Plants Curcuma longa Zingiberaceae	Apoptosis
ar-Turmerone (Standard) is the analytical standard of ar-Turmerone. This product is intended for research and analytical applications. ar-Turmerone ((+)-ar-Turmerone) is an orally active and major bioactive compound of the herb Curcuma longa with anti-tumorigenesis and anti-inflammatory activities. ar-Turmerone induces apoptosis in U937 cells. ar-Turmerone exerts positive modulation on murine DCs. ar-Turmerone induces NSC proliferation in vitro and in vivo, and can be used for various neurologic disorders study.

Species:	Virus (1) Human (9) Mouse (1)
Tag:	His (4) Tag Free (1) GST (8)
Source:	Sf9 insect cells (9) P. pastoris (1) E. coli (1)

Cat. No.	Compare	Product Name	Species	Source

HY-P72307

	*Major capsid protein VP1 Protein, Murine* polyomavirus (Sf9, His)** Major structural protein VP1	Virus	Sf9 insect cells
	The major capsid protein, the VP1 protein, is a 40 nm diameter icosahedral capsid composed of 72 pentamers linked by disulfide bonds. During infection, VP1 participates in nucleosome rearrangement and encapsulates replicated genomic DNA. Major capsid protein VP1 Protein, Murine polyomavirus (Sf9, His) is the recombinant Virus-derived Major capsid protein VP1 protein, expressed by Sf9 insect cells , with C-His labeled tag. The total length of Major capsid protein VP1 Protein, Murine polyomavirus (Sf9, His) is 372 a.a., with molecular weight of ~42.5 kDa.

HY-P702921

	BRAF Protein, Human (sf9, GST, His) BRAF1; RAFB; Proto-oncogene B-Raf; p94; v-Raf Murine sarcoma viral oncogene homolog B1	Human	Sf9 insect cells
	BRAF Protein, Human (sf9, GST, His) is the recombinant human-derived BRAF, expressed by Sf9 insect cells .

HY-P71685

	ABL1 Protein, Human (GST) Abelson Murine leukemia viral oncogene homolog 1; Abelson tyrosine protein kinase 1; Abl 1; ABL; JTK7; p150; Proto oncogene tyrosine protein kinase ABL1	Human	E. coli
	ABL1, Human (GST) is a non-receptor tyrosine-protein kinase. ABL1, Human is implicated in a wide range of cellular processes, including regulation of cell growth and survival, oxidative stress and DNA-damage responses, actin dynamics and cell migration, transmission of information about the cellular environment through integrin signaling.

HY-P702716

	ABL1 Protein, Human (sf9) Abelson Murine leukemia viral oncogene homolog 1; Abelson tyrosine protein kinase 1; Abl 1; ABL; JTK7; p150; Proto oncogene tyrosine protein kinase ABL1	Human	Sf9 insect cells
	ABL1 is a non-receptor tyrosine protein kinase that coordinates key cellular processes for growth and survival. It affects cytoskeletal remodeling, cell motility, and receptor endocytosis. ABL1 Protein, Human (sf9) is the recombinant human-derived ABL1, expressed by Sf9 insect cells , with tag Free labeled tag. The total length of ABL1 Protein, Human (sf9) is 1104 a.a.,

HY-P77308

	ABL1 Protein, Human (sf9, GST) Abelson Murine leukemia viral oncogene homolog 1; Abelson tyrosine protein kinase 1; Abl 1; ABL; JTK7; p150; Proto oncogene tyrosine protein kinase ABL1	Human	Sf9 insect cells
	ABL1 is a non-receptor tyrosine protein kinase that coordinates key cellular processes for growth and survival. It affects cytoskeletal remodeling, cell motility, and receptor endocytosis. ABL1 Protein, Human (sf9, GST) is the recombinant human-derived ABL1 protein, expressed by Sf9 insect cells , with N-GST labeled tag. The total length of ABL1 Protein, Human (sf9, GST) is 418 a.a., with molecular weight of ~65 kDa.

HY-P702631

	AKT1 Protein, Human (Active, sf9, GST) AKT1; v-akt Murine thymoma viral oncogene homolog 1; RAC-alpha serine/threonine-protein kinase; AKT; PKB; PRKBA; RAC; PKB alpha; RAC-PK-alpha; proto-oncogene c-Akt; protein kinase B alpha; rac protein kinase alpha; PKB-ALPHA; RAC-ALPHA; MGC99656	Human	Sf9 insect cells
	The AKT1 protein is part of the AKT kinase family and is critical for metabolism, proliferation, survival, growth, and angiogenesis. It phosphorylates more than 100 substrates, coordinates insulin-induced SLC2A4/GLUT4 translocation, affects glucose uptake, and controls glycogen storage through inhibition of GSK3A/B. AKT1 Protein, Human (Active, sf9, GST) is the recombinant human-derived AKT1, expressed by Sf9 insect cells , with GST labeled tag. The total length of AKT1 Protein, Human (Active, sf9, GST) is 480 a.a.,

HY-P702632

	AKT2 Protein, Human (Active, sf9, GST) AKT2; v-akt Murine thymoma viral oncogene homolog 2; PKBB; PRKBB; PKBBETA; RAC-BETA; AKT2 kinase; rac protein kinase beta; Murine thymoma viral (v-akt) homolog-2; EC 2.7.11.1; RAC-beta serine/threonine-protein kinase; RAC-PK-beta; Protein kinase Akt-2; Protein kinase B, beta; PKB beta	Human	Sf9 insect cells
	The AKT2 protein is a serine/threonine protein kinase in the AKT family that is critical for metabolism, proliferation, survival, growth, and angiogenesis. It phosphorylates more than 100 substrates, coordinates insulin-induced SLC2A4/GLUT4 translocation, affects glucose uptake, and controls glycogen storage. AKT2 Protein, Human (Active, sf9, GST) is the recombinant human-derived AKT2, expressed by Sf9 insect cells , with GST labeled tag. The total length of AKT2 Protein, Human (Active, sf9, GST) is 480 a.a.,

HY-P702578

	Sialidase-2 Protein, Mouse (P.pastoris, His) Neu2; Sialidase-2; EC 3.2.1.18; Cytosolic sialidase; Mouse skeletal muscle sialidase; MSS; Murine thymic sialidase; MTS; N-acetyl-alpha-neuraminidase 2	Mouse	P. pastoris
	Sialidase-2 Protein, Mouse (P.pastoris, His) is the recombinant mouse-derived Sialidase-2, expressed by P. pastoris , with N-10*His labeled tag. ,

HY-P702733

	RAF1 Protein, Human (Y340D,Y341D, sf9, His, GST) RAF1; Raf-1 proto-oncogene, serine/threonine kinase; NS5; CRAF; Raf-1; c-Raf; CMD1NN; RAF proto-oncogene serine/threonine-protein kinase; C-Raf proto-oncogene, serine/threonine kinase; Oncogene RAF1; proto-oncogene c-RAF; raf proto-oncogene serine/threonine protein kinase; v-raf-1 Murine leukemia viral oncogene homolog 1; v-raf-1 Murine leukemia viral oncogene-like protein 1; EC 2.7.11.1	Human	Sf9 insect cells
	RAF1 is a kinase that links Ras GTPases to the MAPK/ERK cascade, influencing cell fate decisions. Activated RAF1 initiates the MAPK cascade and phosphorylates MEK1/2 and ERK1/2. RAF1 Protein, Human (Y340D,Y341D, sf9, His, GST) is the recombinant human-derived RAF1, expressed by Sf9 insect cells , with His, GST labeled tag. ,

HY-P703085

	ARG Protein, Human (Active, Sf9, GST) Tyrosine-protein kinase ABL2; Abelson Murine leukemia viral oncogene homolog 2; Abelson tyrosine-protein kinase 2; Abelson-related gene protein; Tyrosine-protein kinase ARG; ABL2; ABLL; ARG; Homo sapiens; Human Kinase; Transferase; Tyrosine-protein kinase; 2.7.10.2	Human	Sf9 insect cells

HY-P702633

	AKT3 Protein, Human (Active, sf9, GST) AKT3; AKT serine/threonine kinase 3; MPPH; PKBG; MPPH2; PRKBG; STK-2; PKB-GAMMA; RAC-gamma; RAC-PK-gamma; RAC-gamma serine/threonine-protein kinase; PKB gamma; RAC-gamma serine/threonine protein kinase; v-akt Murine thymoma viral oncogene homolog 3 (protein kinase B, gamma); EC 2.7.11.1	Human	Sf9 insect cells
	The AKT3 protein, like AKT1 and AKT2, is an important member of the AKT kinase family and plays a central role in a variety of cellular processes, including metabolism, proliferation, survival, growth, and angiogenesis. AKT3 has more than 100 reported targets and coordinates complex signaling pathways that control glucose uptake, regulate glycogen storage, and influence neurogenesis. AKT3 Protein, Human (Active, sf9, GST) is the recombinant human-derived AKT3, expressed by Sf9 insect cells , with GST labeled tag. The total length of AKT3 Protein, Human (Active, sf9, GST) is 479 a.a.,

Compare Products


Products	In-stock - + Add to Cart
Cat. No.
Species
Source
Tag
Accession
Gene ID
Molecular Weight
Purity
Endotoxin Level
Biological Activity
Appearance
Formulation
Storage & Stability
Shipping
Free Sample	Yes No
Size	* This product has been "discontinued". Optimized version of product available: / In-stock - + Add to Cart Get quote

Cat. No.	Product Name	Chemical Structure

HY-50935S

Troglitazone-d4
Troglitazone-d₄ is deuterium labeled Troglitazone. Troglitazone is a PPARγ agonist, with EC50s of 550 nM and 780 nM for human and murine PPARγ receptor, respectively.

HY-B0637S

Bezafibrate-d6
Bezafibrate-d₆ is the deuterium labeled Bezafibrate. Bezafibrate is an agonist of PPAR, with EC50s of 50 μM, 60 μM, 20 μM for human PPARα, PPARγ and PPARδ, and 90 μM, 55 μM, 110 μM for murine PPARα, PPARγ and PPARδ, respectively; Bezafibrate is used as an hypolipidemic agent.

HY-104077S

Remdesivir-d5 2 Publications Verification
Remdesivir-d₅ is a deuterium labeled Remdesivir. Remdesivir (GS-5734) is a nucleoside analogue, with effective antiviral activity, with EC50s of 74 nM for SARS-CoV and MERS-CoV in HAE cells, and 30 nM for murine hepatitis virus in delayed brain tumor cells. Remdesivir is highly effective in the control of 2019-nCoV (COVID-19) infection in vitro[1][2].

HY-W104379S

Arprinocid-15N3
Arprinocid-15N3 is ¹⁵N₃-labeled Arprinocid (HY-W104379). Arprinocid is a purine analog with activity against murine Toxoplasma gondii .

HY-125138S1

ω-Muricholic acid-d4
ω-Muricholic acid-d₄ (ω-MCA-d₄) is deuterium labeled ω-Muricholic Acid. ω-Muricholic acid (ω-MCA) is a murine-specific secondary bile acid .

HY-B0287S

Clofibrate-d4
Clofibrate-d₄ is the deuterium labeled Clofibrate. Clofibrate is an agonist of PPAR, with EC50s of 50 μM, ∼500 μM for murine PPARα and PPARγ, and 55 μM, ∼500 μM for human PPARα and PPARγ, respectively.

HY-77813S

Benzyl isothiocyanate-d7
Benzyl isothiocyanate-d₇ is the deuterium labeled Benzyl isothiocyanate. Benzyl isothiocyanate is a member of natural isothiocyanates with antimicrobial activity[1][2]. Benzyl isothiocyanate potent inhibits cell mobility, migration and invasion nature and matrix metalloproteinase-2 (MMP-2) activity of murine melanoma cells[2].

HY-B0637S1

Bezafibrate-d4
Bezafibrate-d₄ is deuterium labeled Bezafibrate. Bezafibrate is an agonist of PPAR, with EC50s of 50 μM, 60 μM, 20 μM for human PPARα, PPARγ and PPARδ, and 90 μM, 55 μM, 110 μM for murine PPARα, PPARγ and PPARδ, respectively; Bezafibrate is used as an hypolipidemic agent.

HY-104077S1

Remdesivir-d4
Remdesivir-d₄ is deuterium labeled Remdesivir. Remdesivir (GS-5734), a nucleoside analogue with effective antiviral activity, has EC50s of 74 nM for SARS-CoV and MERS-CoV in HAE cells, and 30 nM for murine hepatitis virus in delayed brain tumor cells. Remdesivir is highly effective in the control of SARS-CoV-2 (COVID-19) infection in vitro[1][2].

HY-B0637S2

Bezafibrate-13C6
Bezafibrate- ¹³C₆ (BM15075- ¹³C₆) is ¹³C labeled Bezafibrate. Bezafibrate is an agonist of PPAR, with EC₅₀s of 50 μM, 60 μM, 20 μM for human PPARα, PPARγ and PPARδ, and 90 μM, 55 μM, 110 μM for murine PPARα, PPARγ and PPARδ, respectively; Bezafibrate is used as an hypolipidemic agent.

HY-104077S2

Remdesivir impurity 9-d4
Remdesivir impurity 9-d₄ is deuterium labeled Remdesivir. Remdesivir (GS-5734), a nucleoside analogue with effective antiviral activity, has EC50s of 74 nM for SARS-CoV and MERS-CoV in HAE cells, and 30 nM for murine hepatitis virus in delayed brain tumor cells. Remdesivir is highly effective in the control of SARS-CoV-2 (COVID-19) infection in vitro[1][2].

HY-W272217S

Octacosane-d58

Octacosane-d₅₈ is the deuterium labeled Octacosane[1]. Octacosane is an endogenous metabolite with antibacterial activity. Octacosane shows high cytotoxicity against murine melanoma B16F10-Nex2 cells besides inducing protection against a grafted subcutaneous melanoma. Octacosane has the larvicidal activity against mosquito Culex quinquefasciatus with the LC50 concentration of 7.2 mg/l[2][3][4].

HY-N6703S

ar-Turmerone-d3

ar-Turmerone-d₃ is the deuterium labeled ar-Turmerone. ar-Turmerone ((+)-ar-Turmerone) is an orally active and major bioactive compound of the herb Curcuma longa with anti-tumorigenesis and anti-inflammatory activities. ar-Turmerone induces apoptosis in U937 cells. ar-Turmerone exerts positive modulation on murine DCs. ar-Turmerone induces NSC proliferation in vitro and in vivo, and can be used for various neurologic disorders study .

HY-B0130AS

Perindopril-d3 erbumine
Perindopril-d₃ (erbumine) is deuterated labeled Perindopril (erbumine) (HY-B0130A). Perindopril erbumine is an angiotensin-converting enzyme inhibitor. Perindopril erbumine modulates NF-κB and STAT3 signaling and inhibits glial activation and neuroinflammation. Perindopril erbumine can be used for the research of Chronic Kidney Disease and high blood pressure .

Cat. No.	Compare	Product Name	Application	Reactivity

HY-P81241

	Leptin Antibody LEP; Leptin Murine Obesity Homolog; Leptin Precursor Obesity Factor; OB; Obese Protein; Obesity; Obesity factor; Obesity homolog mouse; Obesity Murine Homolog Leptin; OBS; LEP_HUMAN.	IHC-P, IHC-F, ICC/IF, ELISA	Human, Mouse, Rat, Pig, Sheep
	Leptin Antibody is a rabbit-derived non-conjugated IgG antibody, targeting Leptin, with a predicted molecular weight of 16 kDa . Leptin Antibody can be used for IHC-P, IHC-F, ICC/IF, ELISA experiments in human, mouse, rat, pig, sheep backgrounds.

HY-P80572

	BRAF Antibody BRAF; BRAF1; RAFB1; Serine/threonine-protein kinase B-raf; Proto-oncogene B-Raf; p94; v-Raf Murine sarcoma viral oncogene homolog B1	WB	Human, Mouse, Rat
	BRAF Antibody is a non-conjugated and Mouse origined monoclonal antibody about 84 kDa, targeting to BRAF (4E1). It can be used for WB assays with tag free, in the background of Human, Mouse.

HY-P80794

	Phospho-BRAF (Thr401) Antibody BRAF; BRAF1; RAFB1; Serine/threonine-protein kinase B-raf; Proto-oncogene B-Raf; p94; v-Raf Murine sarcoma viral oncogene homolog B1	WB, IP	Human, Mouse, Rat
	Phospho-BRAF (Thr401) Antibody is a non-conjugated and Rabbit origined monoclonal antibody about 84 kDa, targeting to Phospho-BRAF (Thr401). It can be used for WB,IP assays with tag free, in the background of Human, Mouse, Rat.

HY-P83458

	ABL2 Antibody (YA3203) ABL2; ABLL; ARG; Abelson tyrosine-protein kinase 2; Abelson Murine leukemia viral oncogene homolog 2; Abelson-related gene protein; Tyrosine-protein kinase ARG	WB, FC	Human, Mouse, Rat
	ABL2 Antibody (YA3203) is a rabbit-derived non-conjugated IgG antibody (Clone NO.: YA3203), targeting ABL2, with a predicted molecular weight of 128 kDa (observed band size: 128 kDa). ABL2 Antibody (YA3203) can be used for WB, FC experiment in human, mouse, rat background.

HY-P83705

	MDM2 Antibody (YA3442) ACTFS antibody; Double minute 2 protein antibody; E3 ubiquitin-protein ligase Mdm2 antibody; Hdm 2 antibody; Hdm2 antibody; HDMX antibody; MDM 2 antibody; MDM2 antibody; MDM2 oncogene E3 ubiquitin protein ligase antibody; Mdm2 p53 E3 ubiquitin protein ligase homolog antibody; Mdm2 transformed 3T3 cell double minute 2 p53 binding protein (mouse) binding protein 104kDa antibody; MDM2_HUMAN antibody; MDM2BP antibody; Mouse Double Minute 2 antibody; MTBP antibody; Murine Double Minute Chromosome 2 antibody; Oncoprotein Mdm2 antibody; p53 Binding Protein Mdm2 antibody; p53-binding protein Mdm2 antibody; Ubiquitin protein ligase E3 Mdm2 antibody; Ubiquitin protein ligase E3 Mdm2 antibody	WB, IHC-P, ICC/IF	Human, Monkey
	MDM2 Antibody (YA3442) is a mouse-derived non-conjugated IgG1 antibody (Clone NO.: YA3442), targeting MDM2, with a predicted molecular weight of 55 kDa (observed band size: 90 kDa). MDM2 Antibody (YA3442) can be used for WB, ICC/IF, IHC-P experiment in human, monkey background.

HY-P80317

	S100A4 Antibody 18A2 antibody; 42A antibody; calcium Placental protein antibody; Calvasculin antibody; CAPL antibody; Fibroblast specific protein 1 (FSP1) antibody; Fibroblast specific protein 1 antibody; Fibroblast specific protein antibody; FSP1 antibody; Leukemia multidrug resistance associated protein antibody; Malignant transformation suppression 1 (MTS1) antibody; Malignant transformation suppression 1 antibody; Metastasin antibody; MTS1 antibody; OTTHUMP00000015467 antibody; OTTHUMP00000015468 antibody; P9KA antibody; PEL98 antibody; Placental calcium-binding protein antibody; Protein Mts1 antibody; Protein S100 A4 antibody; Protein S100-A4 antibody; S100 calcium binding protein A4 (calcium protein, calvasculin, metastasin, Murine placental homolog) antibody; S100 calcium binding protein A4 antibody; S100 calcium-binding protein A4 antibody; S100a4 antibody; S10A4_HUMAN antibody;	WB, ICC/IF, IHC-P, IP, FC	Human, Mouse
	S100A4 Antibody is a non-conjugated and Rabbit origined monoclonal antibody about 12 kDa, targeting to S100A4. It can be used for WB,ICC/IF,IHC-P,IP,FC assays with tag free, in the background of Human, Mouse.

Compare Products


Products	In-stock - + Add to Cart
Cat. No.
Host
Reactivity
Application
Dilution Ratio
Molecular Weight
Conjugation
Clonality
Immunogen
Appearance
Isotype
Gene ID
SwissProt ID
Purity
Formulation
Free Sample	Yes No
Size	* This product has been "discontinued". Optimized version of product available: / In-stock - + Add to Cart Get quote

Cat. No.	Product Name		Classification

HY-111640

3'-Azido-3'-deoxy-5-methylcytidine		Azide
3'-Azido-3'-deoxy-5-methylcytidine (CS-92) is a potent xenotropic murine leukemia-related retrovirus (XMRV) inhibitor with a CC₅₀ of 43.5 μM in MCF-7 cells. 3'-Azido-3'-deoxy-5-methylcytidine also inhibits HIV-1 reverse transcriptase with an EC₅₀ of 0.06 μM in peripheral blood mononuclear (PBM) cells . 3'-Azido-3'-deoxy-5-methylcytidine is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. It can also undergo strain-promoted alkyne-azide cycloaddition (SPAAC) reactions with molecules containing DBCO or BCN groups.

Cat. No.	Product Name		Classification

HY-132582A

*Tau ASO-12 (murine) (sodium)*		Antisense Oligonucleotides
Tau ^ASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (Tau ^ASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )

HY-146245C

ODN 1826 sodium 3 Publications Verification CpG 1826 sodium		CpG ODNs
ODN 1826 sodium is a class B CpG ODN (oligodeoxynucleotide) that is a TLR9 agonist. ODN 1826 sodium is an immunostimulatory agent that induces NO and iNOS production in mouse models. ODN 1826 sodium also enhances apoptosis (apoptosis) and may promote atherosclerosis. ODN 1826 sequence: 5’-tccatgacgttcctgacgtt-3’ .

HY-115567

5-NIdR 1-(β-D-2-Deoxyribofuranosyl)-5-nitroindole		Nucleosides and their Analogs
5-NIdR (1-(β-D-2-Deoxyribofuranosyl)-5-nitroindole), an artificial nucleoside, exhibits the ability to inhibit the replication of DNA lesions generated by Temozolomide (HY-17364). 5-NIdR induces cancer cells apoptosis and arrests cell cycle at G0 phase. 5-NIdR enhances Temozolomide anti-tumor efficacy in murine glioblastoma model .

HY-160231

ssRNA42 sodium		CpG ODNs
ssRNA42 (sodium) is a 20-mer phosphothioate protected single-stranded RNA oligonucleotide. ssRNA42 (sodium) derives from ssRNA40 by replacement of all G nucleotides with adenosine. ssRNA42 activated human PBMCs to secrete IFN-α, TNF-a, IL- 12p40, and IL-6, but ssRNA42 failed to stimulated murine pDCs and PBMCs.

HY-146245

ODN 1826 CpG 1826		CpG ODNs
ODN 1826 (CpG 1826), a class B CpG ODN (oligodeoxynucleotide), is a TLR9 agonist. ODN 1826 promotes Apoptosis. ODN 1826 is an excellent immune stimulator with antitumor activity. ODN 1826 has protective effects on the heart. ODN 1826 sequence: 5’-tccatgacgttcctgacgtt-3’ .

Inquiry Online

Your information is safe with us. * Required Fields.

MCE Japan Authorized Agent ナミキ商事株式会社コスモ・バイオ株式会社
Salutation			Country or Region *
Applicant Name *			Organization Name *
Department *
Email Address *			Product Name *
Cat. No.			Requested quantity *
Phone Number *
Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent:

Murine

Inhibitors & Agonists

Biochemical Assay Reagents

Peptides

Inhibitory Antibodies

NaturalProducts

Recombinant Proteins

Isotope-Labeled Compounds

Antibodies

Click Chemistry

Oligonucleotides

Natural
Products