Search Result

Results for "

fumarate reduction

" in MedChemExpress (MCE) Product Catalog:

By Targets:	17β-HSD (1) 5-HT Receptor (7) ADC Linker (5) Adrenergic Receptor (3) Aldehyde Dehydrogenase (ALDH) (1) Aldose Reductase (1) Amine N-methyltransferase (1) AMPK (1) Amylases (1) Amyloid-β (2) Anaplastic lymphoma kinase (ALK) (1) Angiotensin Receptor (1) Angiotensin-converting Enzyme (ACE) (2) Antibiotic (9) Antifolate (2) Apolipoprotein (1) Apoptosis (16) ATP Citrate Lyase (1) Autophagy (3) Bacterial (15) Bcl-2 Family (1) Bcr-Abl (12) Beta-secretase (4) Biochemical Assay Reagents (35) BRK (1) c-Met/HGFR (1) Calcium Channel (11) Cannabinoid Receptor (1) Carbonic Anhydrase (2) Caspase (1) CaSR (1) CGRP Receptor (1) Cholinesterase (ChE) (3) Complement System (2) COX (3) Cytochrome P450 (3) DNA Alkylator/Crosslinker (2) DNA/RNA Synthesis (9) Dopamine Receptor (1) Drug Derivative (1) Drug Intermediate (2) Drug Isomer (1) Drug Metabolite (6) E1/E2/E3 Enzyme (4) EGFR (3) Endogenous Metabolite (56) Endothelin Receptor (1) Enterovirus (3) Epigenetic Reader Domain (2) Estrogen Receptor/ERR (1) Fatty Acid Synthase (FASN) (2) Fc Receptor (FcR) (1) Ferroptosis (3) FLT3 (1) Fluorescent Dye (8) FOXO (1) Free Fatty Acid Receptor (2) Fungal (10) FXR (2) GABA Receptor (1) GCGR (1) GLP Receptor (1) GLUT (1) Glutathione S-transferase (1) Glycosidase (2) GnRH Receptor (4) GSNOR (1) Guanylate Cyclase (1) HBV (5) HCN Channel (2) HDAC (2) Heme Oxygenase (HO) (1) HIF/HIF Prolyl-Hydroxylase (1) Histamine Receptor (2) Histone Methyltransferase (1) HIV (1) Huntingtin (1) IFNAR (1) iGluR (2) Indoleamine 2,3-Dioxygenase (IDO) (1) Influenza Virus (1) Insecticide (1) Interleukin Related (13) IRAK (1) Isotope-Labeled Compounds (20) JAK (3) Ligands for E3 Ligase (2) Liposome (1) Lipoxygenase (1) LPL Receptor (3) LXR (2) mAChR (4) MCHR1 (GPR24) (2) MDM-2/p53 (1) MEK (1) Melanocortin Receptor (3) Microtubule/Tubulin (3) Mitochondrial Metabolism (1) MMP (1) MNK (2) Molecular Glues (1) Monoamine Oxidase (1) Monocarboxylate Transporter (1) N-myristoyltransferase (1) Na+/H+ Exchanger (NHE) (2) NADPH Oxidase (1) NAMPT (1) Neurokinin Receptor (2) NF-κB (7) NO Synthase (7) NOD-like Receptor (NLR) (2) Opioid Receptor (1) Oxytocin Receptor (1) P-glycoprotein (1) P2X Receptor (1) p38 MAPK (1) p62 (1) Parasite (2) PCSK9 (1) PD-1/PD-L1 (2) PDI (1) PERK (2) Phosphatase (3) Phosphodiesterase (PDE) (3) Phospholipase (2) PI3K (2) PIN1 (1) PKC (2) PKG (2) Potassium Channel (1) PPAR (1) Progesterone Receptor (1) Prostaglandin Receptor (8) PROTACs (2) Proteasome (2) Pyroptosis (2) Ras (1) Reactive Oxygen Species (10) Renin (5) Reverse Transcriptase (1) ROCK (1) SARS-CoV (5) Ser/Thr Protease (2) Sigma Receptor (4) Sirtuin (1) SNIPERs (12) SOD (2) Sodium Channel (1) STAT (2) TGF-beta/Smad (1) TNF Receptor (4) Transmembrane Glycoprotein (1) TRP Channel (1) Tryptophan Hydroxylase (1) VD/VDR (1) YAP (1) β-glucuronidase (1) γ-secretase (5)
By Research Areas:	Cancer (99) Cardiovascular Disease (42) Endocrinology (8) Infection (35) Inflammation/Immunology (61) Metabolic Disease (71) Neurological Disease (46)
Click Chemistry:	Azide (1)
Oligonucleotides:	Nucleotides and their Analogs (1) Disintegrants (1) Emulsifiers (1) Cationic Lipids (1) Antisense Oligonucleotides (4)

384

Inhibitors & Agonists

Screening Libraries

Fluorescent Dye

Biochemical Assay Reagents

Peptides

Inhibitory Antibodies

Natural
Products

Isotope-Labeled Compounds

Click Chemistry

Oligonucleotides

Cat. No.	Product Name	Target	Research Areas	Chemical Structure

HY-78036

Mesaconic acid Citronic acid; Methylfumaric acid	Endogenous Metabolite	Others
Mesaconic acid is an active product that can be extracted from Saxifraga stolonifera. Mesaconic acid is used as a fire retardant and is a competitive inhibitor of fumarate reduction .

HY-113101

2-Hydroxyadipic acid	Endogenous Metabolite	Others
2-Hydroxyadipic acid is an organic acid, formed by the reduction of 2-ketoadipic acid.

HY-105129

Pimonidazole hydrochloride 4 Publications Verification	Biochemical Assay Reagents	Cancer
Pimonidazole is a novel hypoxia marker for complementary study of tumor hypoxia and cell proliferation in tumor . Pimonidazole accumulates in hypoxic cells via covalent binding with macromolecules or by forming reductive metabolites after reduction of its nitro group, it can be used for qualitative and quantitative assessment of tumor hypoxia .

HY-105129A

Pimonidazole 4 Publications Verification	Biochemical Assay Reagents	Cancer
Pimonidazole is a novel hypoxia marker for complementary study of tumor hypoxia and cell proliferation in tumor . Pimonidazole accumulates in hypoxic cells via covalent binding with macromolecules or by forming reductive metabolites after reduction of its nitro group, it can be used for qualitative and quantitative assessment of tumor hypoxia .

HY-W129633

2,6-Dichlorophenolindophenol sodium hydrate DCIP sodium hydrate; DPIP sodium hydrate	Biochemical Assay Reagents	Others
2,6-Dichlorophenolindophenol (sodium hydrate) is a blue reduction dye used as an indicator for measuring the content of vitamin C.

HY-78036R

Mesaconic acid (Standard) Citronic acid (Standard); Methylfumaric acid (Standard)	Endogenous Metabolite	Others
Mesaconic acid (Standard) is the analytical standard of Mesaconic acid. This product is intended for research and analytical applications. Mesaconic acid is an active product that can be extracted from Saxifraga stolonifera. Mesaconic acid is used as a fire retardant and is a competitive inhibitor of fumarate reduction[1].

HY-D0676

Acid yellow 199	Fluorescent Dye
Acid yellow 199 is an azo dye that can be decolorized through reduction reaction.

HY-164092

Eicosanoyl-CoA	Endogenous Metabolite	Metabolic Disease
Eicosanoyl-CoA is a reduction metabolite of (E)-2,3 eicosanoyl-CoA .

HY-120376

XZH-5	STAT	Cancer
XZH-5 inhibits the phosphorylation of STAT3 and results in the induction of apoptosis and reduction of colony forming ability .

HY-105129AS

Pimonidazole-d10	Isotope-Labeled Compounds	Cancer
Pimonidazole-d₁₀ is the deuterium labeled Pimonidazole. Pimonidazole is a novel hypoxia marker for complementary study of tumor hypoxia and cell proliferation in tumor[1]. Pimonidazole accumulates in hypoxic cells via covalent binding with macromolecules or by forming reductive metabolites after reduction of its nitro group, it can be used for qualitative and quantitative assessment of tumor hypoxia [2].

HY-113114

Tetrahydrocortisone	Endogenous Metabolite	Others
Tetrahydrocortisone is a stress-induced hormone. Tetrahydrocortisone is also a urinary metabolite of Cortisone derived from the reduction of Cortisone by 5-reductase .

HY-N6618

DL-Mannitol	Others	Others
DL-Mannitol is obtained by combining D-mannitol with a sample of Lmannitol obtained by reduction of L-mannono-1, Clactone .

HY-113681

REV 5975	Angiotensin-converting Enzyme (ACE)	Cardiovascular Disease
REV 5975 is a angiotensin converting enzyme (ACE) inhibitor. REV 5975 shows a partial reduction of the angiotensin I effect .

HY-105129R

Pimonidazole hydrochloride (Standard)	Others	Cancer
Pimonidazole (hydrochloride) (Standard) is the analytical standard of Pimonidazole (hydrochloride). This product is intended for research and analytical applications. Pimonidazole is a novel hypoxia marker for complementary study of tumor hypoxia and cell proliferation in tumor[1]. Pimonidazole accumulates in hypoxic cells via covalent binding with macromolecules or by forming reductive metabolites after reduction of its nitro group, it can be used for qualitative and quantitative assessment of tumor hypoxia [2].

HY-105129AR

Pimonidazole (Standard)	Others	Cancer
Pimonidazole (Standard) is the analytical standard of Pimonidazole. This product is intended for research and analytical applications. Pimonidazole is a novel hypoxia marker for complementary study of tumor hypoxia and cell proliferation in tumor[1]. Pimonidazole accumulates in hypoxic cells via covalent binding with macromolecules or by forming reductive metabolites after reduction of its nitro group, it can be used for qualitative and quantitative assessment of tumor hypoxia [2].

HY-W017206

1-Phenyl-2-nitropropene	Drug Intermediate	Others
1-Phenyl-2-nitropropene is the reduction product of acetophenone and can be used to prepare chiral amine compounds .

HY-W011757

Neocuproine hydrochloride monohydrate, 99%	Biochemical Assay Reagents	Others
Neocuproine hydrochloride monohydrate, 99% can be used to prepare complex solutions for studying antioxidant capacity determination in biological samples based on copper reduction complexes.

HY-W133897

tert-Butylamine borane	Biochemical Assay Reagents	Others
tert-Butylamine borane is a mild reducing agent. tert-Butylamine borane involves in the selective reduction of aldehydes and ketones to the corresponding alcohols .

HY-121678

Tetridamine POLI-67	Others	Inflammation/Immunology
Tetridamine ((POLI-67) ) is a non-steroidal anti-inflammatory agent and shows a marked reduction of paw swelling and pain sensibility .

HY-N0893

Tetrahydrocurcumin 2 Publications Verification HZIV 81-2	Cytochrome P450 Autophagy Endogenous Metabolite	Inflammation/Immunology Cancer
Tetrahydrocurcumin is a Curcuminoid found in turmeric (Curcuma longa) that is produced by the reduction of Curcumin. Tetrahydrocurcumin inhibit CYP2C9 and CYP3A4.

HY-111872

SNIPER(ABL)-020	SNIPERs Bcr-Abl	Cancer
SNIPER(ABL)-020, conjugating Dasatinib (ABL inhibitor) to Bestatin (IAP ligand) with a linker, induces the reduction of BCR-ABL protein .

HY-N4203

Isopropyl ferulate	Fungal	Infection
Isopropyl ferulate, isolated from Notopterygium incisum, is used in the reduction of pharmaceuticals, preparation of antifungal agents, cosmetics and as antioxidant agent and so forth .

HY-P2809

Malic dehydrogenase, microorganism MDH; EC 1.1.1.37	Endogenous Metabolite	Metabolic Disease
Malate dehydrogenase (EC 1.1.1.37) (MDH) catalyzes the mutual conversion of oxaloacetate and malate, and is associated with the oxidation/reduction of dinucleotide coenzymes .

HY-W193398

N-2-Cyclohexylethyl-N-methylamine	Monoamine Oxidase	Cardiovascular Disease
N-2-Cyclohexylethyl-N-methylamine is an amine from A.ridigula Benth for a reduction of monoamine oxidase (MAO) activity .

HY-W712314

4-Arm PEG-amine (MW 5000)	Biochemical Assay Reagents	Others
4-Arm PEG-amine (MW 5000) is a PEG Linker. The reactive primary amine or NH2 rapidly react with aldehyde, ketone to form imine. Imine upon further reduction forms secondary amine via reductive amination. Amine reacts with activated carboxyl acid, NHS ester to form stable amide bonds. 4-Arm PEG reagents are useful crosslinking reagent and used for drug delivery .

HY-100740A

Lanabecestat hydrochloride AZD-3293 hydrochloride; LY3314814 hydrochloride	Beta-secretase	Neurological Disease
Lanabecestat (AZD-3293) hydrochloride is a potent BACE1 inhibitor that has been investigated for its potential as a modifying treatment for Alzheimer's disease. Lanabecestat (hydrochloride) demonstrated significant dose- and time-dependent reductions in concentrations of amyloid beta peptides in plasma, cerebrospinal fluid, and brain. Lanabecestat (hydrochloride) was also shown to produce reductions in Aβ neuritic plaque burden without demonstrating clinical benefits or slowing the progression of Alzheimer's disease pathophysiology.

HY-P1008

Z-VDVAD-FMK 3 Publications Verification Z-VD(OMe)VAD(OMe)-FMK	Caspase	Cancer
Z-VDVAD-FMK is a special inhibitor of caspase-2. Z-VDVAD-FMK produces a reduction in Lovastatin-induced apoptosis .

HY-D0852A

Sodium metavanadate, 99% Sodium vanadate(V), 99%	Biochemical Assay Reagents	Others
Sodium metavanadate, 99% (Sodium vanadate(V), 99%) is a biochemical reagent used as a vanadium source in microbial cultures to study vanadium reduction in mesophilic and thermophilic methanogens .

HY-13338A

(S)-Mabuterol	Adrenergic Receptor	Cardiovascular Disease
(S)-Mabuterol is a selective β2 adrenoreceptor agonist that demonstrates blood pressure reduction and increased heart rate and contractile force in animal models.

HY-W055845

4-Methylbenzamide oxime	Biochemical Assay Reagents	Others
4-Methylbenzamide oxime is a model of benzamide oxime and can be used as a substrate for mitochondrial amidoxime reducing component (mARC) catalytic enzyme reduction .

HY-100582

Ribitol 1 Publications Verification Adonitol; Adonite	Endogenous Metabolite	Others
Ribitol is a crystalline pentose alcohol formed by the reduction of ribose. Enhancing the flux of D-glucose to the pentose phosphate pathway in Saccharomyces cerevisiae for the production of D-ribose and ribitol.

HY-E70522

Dihydrofolate reductase DHFR	Others	Others
Dihydrofolate reductase is a key enzyme in folate metabolism and, therefore, in the production of thymidine. Its role in thymidine biosynthesis is the reduction of dihydrofolate to tetrahydrofolate using the cofactor NADPH .

HY-N9903

Tetrahydrodehydrodiconiferyl alcohol TDDC	Others	Others
Tetrahydrodehydrodiconiferyl alcohol (TDDC) is a reduction product of dihydrodehydrodiconiferyl alcohol catalyzed by phenylcoumaran benzylic ether reductase. Tetrahydrodehydrodiconiferyl alcohol can be isolated from a hydrogenolysis product of protolignin .

HY-111858

SNIPER(ABL)-050	SNIPERs Bcr-Abl	Cancer
SNIPER(ABL)-050, conjugating Imatinib (ABL inhibitor) to MV-1 (IAP ligand) with a linker, induces the reduction of BCR-ABL protein .

HY-W440817

4,4-Bis(octyloxy)butanenitrile	Biochemical Assay Reagents	Others
4,4-Bis(octyloxy)butanenitrile is a lipid building block with a terminal nitrile group. The nitrile group can undergo hydrolysis, reduction, and other reactions.

HY-118930A

MK-0493 hydrochloride	Melanocortin Receptor	Metabolic Disease Endocrinology
MK-0493 hydrochloride is a potent, orally active and selective agonist of the melanocortin receptor 4 (MC4R), demonstrating significant reductions in energy intake .

HY-118930

MK-0493	Melanocortin Receptor	Metabolic Disease Endocrinology
MK-0493 is a potent, orally active and selective agonist of the melanocortin receptor 4 (MC4R), demonstrating significant reductions in energy intake .

HY-P2807

L-Lactate dehydrogenase, Microorganism LAD	Endogenous Metabolite	Inflammation/Immunology Cancer
L-Lactate dehydrogenase, Microorganism (LAD) is a redox enzyme. L-Lactate dehydrogenase catalyzes the reduction of pyruvate to L-lactate by NADH in vivo with absolute enantiospecificity .

HY-129695

PD 132002	Renin	Cardiovascular Disease
PD 132002 is an orally active, potent renin inhibitor. PD 132002 weakly inhibits pepsin. PD 132002 produces substantial reductions in blood pressure .

HY-123429

CK0683A	Antibiotic	Infection
CK0683A is a novel biaminourea antibiotic with antiplaque effects and demonstrated efficacy in experimental mouse dental disease models. A 12-week study in beagles compared its efficacy in terms of plaque and gingivitis reduction, staining potential, and safety. Dogs were selected as the study subjects because the onset and progression of canine periodontal disease is similar to that of humans. As a positive control for plaque and gingivitis reduction and staining, chlorhexidine acetate was selected because it is effective in both humans and dogs.

HY-P2807K

L-Lactate Dehydrogenase, bovine muscle	Endogenous Metabolite	Metabolic Disease
L-Lactate Dehydrogenase, bovine muscle is an oxidoreductase. L-Lactate Dehydrogenase, bovine muscle catalyzes the reversible conversion of lactate to pyruvate with the reduction of NAD+ to NADH .

HY-106682

Falipamil AQ-A 39	Calcium Channel	Cardiovascular Disease
Falipamil (AQ-A 39), a calcium channel blocker, is a bradycardic agent. The bradycardic effect results from a reduction in the diastolic depolarization rate and a prolongation of the action potential duration .

HY-N0510A

Aristolochic acid sodium salt 5+ Cited Publications Aristolochic acid I sodium; TR 1736 sodium; Sodium aristolochate	Biochemical Assay Reagents	Others
Aristolochic acid sodium salt (Sodium aristolate 1) is a component of some Chinese herbal medicines and is responsible for nephrotoxicity. It is a proagent that is activated by reduction of nitro groups to amines, resulting in the formation of cytotoxic DNA adducts.

HY-136625

LY134046	N-myristoyltransferase	Cardiovascular Disease
LY134046 is an inhibitor of norepinephrine N-methyltransferase (NMT) with cardiovascular activity. LY134046 causes sustained reductions in mean arterial blood pressure and heart rate, but no significant reductions in norepinephrine concentrations in the rat brain. LY134046 does not interact with adrenergic or cholinergic receptors, and its hypotensive and bradycardic effects do not require neurogenic tension. LY134046 (40 mg/kg/day) causes sustained and significant inhibition of hypothalamic and brainstem NMT activity, resulting in central norepinephrine depletion.

HY-111851

SNIPER(ABL)-049	SNIPERs Bcr-Abl	Cancer
SNIPER(ABL)-049, conjugating Imatinib (ABL inhibitor) to Bestatin (IAP ligand) with a linker, induces the reduction of BCR-ABL protein with a DC₅₀ of 100 μM .

HY-W012308

2′-Hydroxydihydrochalcone	Drug Metabolite	Inflammation/Immunology
2′-Hydroxydihydrochalcone (Compound 2a) is an anti-inflammatory agent. 2′-Hydroxydihydrochalcone can be synthesized from the reduction of Flavone (HY-N2424) .

HY-144319

SHR5133	HBV	Infection
SHR5133 is a highly potent, orally active HBV capsid assembly modulator. SHR5133 displays HBV DNA reduction (EC₅₀=26.6 nM) .

HY-147391

ASIC-IN-1	Sodium Channel	Neurological Disease
ASIC-IN-1 is a potent acid sensing ion channel inhibitor with an IC₅₀ value of < 10 µM. ASIC-IN-1 causes a dose- dependent reduction of the pain intensity .

HY-168092

VS-15	Indoleamine 2,3-Dioxygenase (IDO) NO Synthase	Inflammation/Immunology
VS-15, a IDO1 inhibitor, selectively binds the heme-free form of IDO1. VS-15 is described as an iNOS inhibitor based on the reduction of NO production .

HY-N1803

3-Acetoxy-11-ursen-28,13-olide 11,12-Dehydroursolic lactone acetate	Others	Others
3-Acetoxy-11-ursen-28,13-olide (11,12-dehydroursolic lactone acetate) is a reduction product of 11-ketoursolic acid .

Cat. No.	Product Name

HY-L098

Drug Metabolite Library

283 compounds

A drug metabolite is a byproduct of the body breaking down, or “metabolizing” a drug into a different substance. Most drugs undergo chemical alteration by various bodily systems as a way to create compounds that are more easily excreted from the body. Drugs can be metabolized by oxidation, reduction, hydrolysis, hydration, conjugation, condensation, or isomerization. Drug metabolism can produce metabolites with physicochemical and pharmacological properties that differ substantially from those of the parent drug, and consequently have important implications for both drug safety and efficacy.

MCE offers a unique collection of 283 drug metabolites which is a useful tool for drug safety and efficacy study and drug repurposing.

HY-L064

Glutamine Metabolism Compound Library

1,197 compounds

Glutamine is an important metabolic fuel that helps rapidly proliferating cells meet the increased demand for ATP, biosynthetic precursors, and reducing agents. Glutamine Metabolism pathway involves the initial deamination of glutamine by glutaminase(GLS), yielding glutamate and ammonia. Glutamate is converted to the TCA cycle intermediate α-ketoglutarate (α-KG) by either glutamate dehydrogenase (GDH) or by the alanine or aspartate transaminases (TAs), to produce both ATP and anabolic carbons for the synthesis of amino acids, nucleotides and lipids. During periods of hypoxia or mitochondrial dysfunction, α-KG can be converted to citrate in a reductive carboxylation reaction catalyzed by IDH2. The newly formed citrate exits the mitochondria where it is used to synthesize fatty acids and amino acids and produce the reducing agent, NADPH.

Cancer cells display an altered metabolic circuitry that is directly regulated by oncogenic mutations and loss of tumor suppressors. Mounting evidence indicates that altered glutamine metabolism in cancer cells has critical roles in supporting macromolecule biosynthesis, regulating signaling pathways, and maintaining redox homeostasis, all of which contribute to cancer cell proliferation and survival. Thus, intervention in glutamine metabolic processes could provide novel approaches to improve cancer treatment.

MCE owns a unique collection of 1,197 compounds targeting the mainly proteins and enzymes involved in glutamine metabolism pathway. Glutamine Metabolism compound library is a useful tool for intervention in glutamine metabolic processes.

Cat. No.	Product Name	Type

HY-D0222

N,N-Dimethyl-1-naphthylamine	Dyes
N,N-Dimethyl-1-naphthylamine is an aromatic amine and a dye. N,N-Dimethyl-1-naphthylamine can be used in nitrate reduction test .

HY-15924

Thiazolyl Blue 130+ Cited Publications MTT; Thiazolyl Blue Tetrazolium bromide; Methylthiazolyldiphenyl-tetrazolium bromide	Chromogenic Substrates
Thiazolyl Blue (MTT) is a cell-permeable and positively charged tetrazolium dye that is used to detect reductive metabolism in cells. Thiazolyl Blue is taken up by cells through the plasma membrane and then reduced to formazan by intracellular NAD (P) H-oxidoreductases. Thiazolyl Blue is frequently used in colorimetric assays to measure cell proliferation, cytotoxicity, and apoptosis .

HY-D0676

Acid yellow 199	Dyes
Acid yellow 199 is an azo dye that can be decolorized through reduction reaction.

HY-111391R

Resazurin (sodium) (Standard)	Fluorescent Dyes/Probes
Resazurin (sodium) (Standard) is the analytical standard of Resazurin (sodium). This product is intended for research and analytical applications. Resazurin sodium (Diazoresorcinol sodium) is commonly used to measure bacterial and eukaryotic cell viability through its reduction to the fluorescent product resorufin.

HY-120512

5-Phenyl-4E-pentenol

Dyes

5-Phenyl-4E-pentenol is a product of the peroxidase-catalyzed reduction of PPHP. 5-Phenyl-4E-pentenol can be rapidly isolated by solid phase extraction and quantified by isocratic reversed-phase high performance liquid chromatography (HPLC) with UV detection. 5-Phenyl-4E-pentenol is a fluorescent dye that can be used to determine the kinetic properties of heme-containing and non-heme peroxidases and to evaluate the ability of oxidative compounds to serve as substrates for peroxidase reduction. .

HY-D1336

FAM amine, 6-isomer	Fluorescent Dyes/Probes
FAM amine, 6-isomer is a fluorescein derivative with an amine group and contains an isomer of the fluorophore. Can be used to modify biomolecules through enzymatic transamination. Its fatty amine groups can also react with electrophiles such as activated esters. The amine can also be conjugated to carbonyl compounds (aldehydes and ketones) by reductive amination.

HY-W009458

3-Indoxyl phosphate sodium

3-IP sodium

Dyes

3-Indoxyl phosphate (3-IP) is a chromogenic and electrochemical substrate for alkaline phosphatase. Upon enzymatic cleavage by alkaline phosphatase, 3-indoxyl is released and subsequently oxidized to produce water-insoluble indigo, which can be quantified by colorimetric detection at 660 nm as a measure of alkaline phosphatase activity. 3-Indoxyl phosphate can also be converted to water-soluble leucoindigo by reduction of indigo in alkaline solution by sodium dithionite, which can be quantified by colorimetric detection at 415 nm or voltametric detection as a measure of alkaline phosphatase activity.2 3-Indoxyl phosphate has been used in ELISAs.

HY-W800697

BP Fluor 430 picolyl azide

Fluorescent Dyes/Probes

BP Fluor 430 Picolyl Azide is an advanced fluorescent probe that incorporatess a copper-chelating motif to raise the effective concentration of Cu(I) at the reaction site. The rate of the CuAAC reaction depends on the concentrations of all reagents, including copper, therefore raising the effective copper concentration at the reaction site will dramatically increase the rate of CuAAC reaction without the need to increase concentration of azide reagent or copper. In addition, the use of BP Fluor 430 Picolyl Azide instead of conventional BP Fluor 430 Azide allows for at least a tenfold reduction in the concentration of the copper catalyst without sacrificing the efficiency of labeling. In summary, the introduction of a picolyl moiety into an azide probe leads to a substantial increase in the sensitivity of alkyne detection. This is of special value for the detection of low abundance targets or where significant increase in signal intensity is desired.

HY-W800693

BP Fluor 405 picolyl azide

Fluorescent Dyes/Probes

BP Fluor 405 Picolyl Azide is an advanced fluorescent probe that incorporatess a copper-chelating motif to raise the effective concentration of Cu(I) at the reaction site. The rate of the CuAAC reaction depends on the concentrations of all reagents, including copper, therefore raising the effective copper concentration at the reaction site dramatically increases the rate of CuAAC reaction without increasing the concentrations of azide reagent or copper. In addition, the use of picolyl azide instead of conventional azides allows for at least a tenfold reduction in the concentration of the copper catalyst without sacrificing the efficiency of labeling. In summary, the introduction of a picolyl moiety into an azide probe leads to a substantial increase in the sensitivity of alkyne detection. This is of special value for the detection of low abundance targets or where significant increase in signal intensity is desired.

Cat. No.	Product Name	Type

HY-W129633

2,6-Dichlorophenolindophenol sodium hydrate DCIP sodium hydrate; DPIP sodium hydrate	Indicators
2,6-Dichlorophenolindophenol (sodium hydrate) is a blue reduction dye used as an indicator for measuring the content of vitamin C.

HY-D0852A

Sodium metavanadate, 99% Sodium vanadate(V), 99%	Microbial Culture
Sodium metavanadate, 99% (Sodium vanadate(V), 99%) is a biochemical reagent used as a vanadium source in microbial cultures to study vanadium reduction in mesophilic and thermophilic methanogens .

HY-N0510A

Aristolochic acid sodium salt Maximum Cited Publications 9 Publications Verification Aristolochic acid I sodium; TR 1736 sodium; Sodium aristolochate	Biochemical Assay Reagents
Aristolochic acid sodium salt (Sodium aristolate 1) is a component of some Chinese herbal medicines and is responsible for nephrotoxicity. It is a proagent that is activated by reduction of nitro groups to amines, resulting in the formation of cytotoxic DNA adducts.

HY-W110791

Sodium diphenylamine-4-sulfonate	Biochemical Assay Reagents
Sodium diphenylamine-4-sulfonate is a oxidation-reduction titration indicator. Sodium diphenylamine-4-sulfonate shows a colourless reduced form and a red-violet oxidized form .

HY-Y1810

Diethylene glycol diethyl ether	3D Bioprinting
Diethylene glycol diethyl ether is an electrolyte solvent for a non-aqueous lithium-air cell. Diethylene glycol diethyl ether can facilitate the reversible reduction and oxidation processes at the porous carbon electrode without a catalyst .

HY-139306

BAMEA-O16B	Drug Delivery
BAMEAO16B is a lipid nanoparticle. BAMEAO16B integrated with disulfide bonds, can efficiently deliver Cas9 mRNA and sgRNA into cells while releasing RNA in response to the reductive intracellular environment for genome editing. BAMEAO16B can be used for the research of gene editing .

HY-W088501

(E)-3-Pentenoic acid	Biochemical Assay Reagents
(E)-Pent-3-enoic acidIt is an unsaturated carboxylic acid. (E)-Pent-3-enoic acidAs a starting material for various chemical reactions including esterification, oxidation and reduction. (E)-Pent-3-enoic acidIt has potential use as a flavoring agent in the food industry.

HY-W075836

Ferrocenylmethyltrimethylammonium iodide

Biochemical Assay Reagents

Ferrocenylmethyltrimethylammonium (iodide) is an organometallic salt consisting of a ferrocenyl group attached to a quaternary ammonium cation via a methylene bridge. Ferrocenylmethyltrimethylammonium (iodide) has been used as a catalyst and reagent in various organic reactions, including oxidation, reduction, and CH bond activation. In addition, it is also used as a precursor for the synthesis of other organometallic compounds and as a potential material for electrochemical applications.

HY-W127671

Tetramethylammonium perchlorate	Biochemical Assay Reagents
Tetramethylammonium perchlorate is used as an intermediate in organic and chemical synthesis. It is used as mobile phase in HPLC analysis and quantification of olanzapine, clozapine and N-desmethylclozapine. It acts as a supporting electrolyte in the electrochemical reduction of 1-bromodecane, 1-iodododecane, 2-iodooctane, and 2-bromooctane on a mercury cathode.

HY-W013140A

Azomethine-H sodium hydrate

Azomethine-H monosodium salt hydrate

Indicators

Azomethine-H sodium hydrate is a compound belonging to the class of organic compounds. It is a derivative of hydrazine and is commonly used as a reducing agent in various industrial and biomedical applications. Azomethine-H sodium hydrate is particularly suitable for the reduction of ketones and aldehydes, making it valuable in organic synthesis reactions. It is also used in the production of medicines, dyes, and other chemical products.

HY-W008635

Tetrabutylammonium tetrahydroborate

Biochemical Assay Reagents

Tetrabutylammonium tetrahydroborate is an organic compound commonly used as a reducing agent and catalyst. It can act as a reducing agent in certain chemical reactions and can promote the reduction of organic compounds such as esters, aldehydes and ketones. In addition, this compound is also widely used in organic synthesis and chemical analysis, and also has important uses in some production processes.

HY-W099640

Tetraoctylammonium iodide

Tetra-n-octylammonium iodide

Cell Assay Reagents

Tetraoctylammonium iodideIt is an organic compound and belongs to the category of quaternary ammonium salts. It is often used as a phase transfer catalyst, meaning it facilitates a reaction between two immiscible phases, such as an aqueous phase and an organic phase. Tetraoctylammonium iodideIt has a variety of applications in organic synthesis, especially in reactions involving nucleophilic substitution, oxidation, and reduction. Additionally, it is used as a surfactant and emulsifier in industrial and laboratory settings.

HY-W021042

Tris(3-hydroxypropyltriazolylmethyl)amine

THPTA

Cell Assay Reagents

Tris(3-hydroxypropyltriazolylmethyl)amine (THPTA) is an accelerating ligand in the copper-catalyzed azide-alkyne cycloaddition reaction (CuAAC) and protects cells from oxidants generated by copper-catalyzed reduction of oxygen by ascorbate. In addition, Tris(3-hydroxypropyltriazolylmethyl)amine can also protect the histidine moiety of biomolecules in a manner proportional to the ligand concentration .

HY-Y1365

Gelatins

Thickeners

Gelatins is a non-toxic, non carcinogenic, biodegradable, and non irritating natural polymer derived from partial hydrolysis of collagen. Due to its strong liquid absorption and swelling ability, Gelatins has excellent hemostatic properties and can be used as a matrix material for the reduction, growth, and stability of metal nanoparticles. Gelatins can also be used for tumor cell culture and tumor therapy ^[1][2][3].

HY-W061674

trans-2-Pentenoic acid

(E)-Pent-2-enoic acid

Biochemical Assay Reagents

(2E)-Pent-2-enoic acid is an unsaturated carboxylic acid, it is also known as 2-pentenoic acid or crotonic acid, the "2E" designation indicates that the molecule has a trans double bond configuration, where the double bond The two carbon atoms on both sides are located on opposite sides, (2E)-Pent-2-enoic acid has a pungent odor, is miscible with water and most organic solvents, it is commonly used in organic synthesis as a variety of chemical reactions, including esterification, oxidation, and reduction, and in addition, its potential use as a flavoring agent in the food industry was investigated.

HY-W110927

Alizarin Red S Indicator (4.3-6.3), IND

5+ Cited Publications

Indicators

Alizarin red S indicator (C.I. 58005) is a reductively active (quinone-based) anthraquinone dye that forms complexes with metal ions (such as zirconium, calcium) or boric acid to label calcium deposition and perform electrochemical sensing functions. Alizarin Red S undergoes reversible redox reactions (for electrochemical detection) and irreversible chelation (for bone staining). Alizarin Red S is mainly used in bone metabolism research (labeling mineralized tissue), sugar detection (boric acid-sugar competition system) and metal ion sensing (such as zirconium ion detection)， and can be used in osteoporosis and metabolic disease research .

HY-W073013

Cobalt(II) TPP

Biochemical Assay Reagents

5,10,15,20-Tetraphenyl-21H,23H-porphine cobalt(II), commonly known as CoTPP or cobalt porphyrin, is a coordination compound. 5,10,15,20-Tetraphenyl-21H,23H-porphine cobalt(II) is widely used in various fields such as catalysis, sensing, and organic electronics because of its unique electronic and optical properties. An efficient catalyst for reactions including oxidation, reduction, and CH bond activation, moreover, it has been used as a fluorescent probe for detecting oxygen content in biological systems and as an active material in organic solar cells.

HY-P1956

Human serum albumin

2 Publications Verification

HSA

Native Proteins

Human serum albumin (HSA) is the most abundant protein in plasma and is a major determinant of plasma oncotic pressure. Human serum albumin exhibits antioxidant, anticoagulant, anti-inflammatory, anti-platelet aggregation activities as well as colloid osmotic action. Human serum albumin can block the inhibitory effect of GML on human T cells, providing protective function for T cells. Human serum albumin is also associated with cardiovascular diseases and can partially prevent the LPS (HY-D1056) induced oxidative stress, as well as the upregulation of NF-κB, NF-κB, and peroxynitrite (ONOO ⁻) in the vascular wall, contributing to the reduction of blood pressure .

HY-W035133

5,10,15,20-Tetrakis(p-tolyl)porphyrin

5,10,15,20-Tetra-p-tolyl-21H,23H-porphine

Biochemical Assay Reagents

5,10,15,20-Tetrakis(p-tolyl)porphyrin (TTP) is an organic compound belonging to the class of porphyrins, a cyclic molecule composed of four pyrrole rings linked together. TTP is a synthetic porphyrin commonly used as a sensitizer for dye-sensitized solar cells and a catalyst for organic reactions. Due to its unique structure, TTP has a series of interesting properties, including at specific wavelengths and its potential as a catalyst for various chemical reactions. In dye-sensitized solar cells, TTPs help convert sunlight into electricity by absorbing photons and transferring electrons to the semiconductor layer of the device. In organic chemistry, TTP is often used as a catalyst for various organic compounds in reactions such as oxidation and reduction. Its ability to selectively bind certain substrates makes it a useful tool for synthesizing complex molecules and studying their properties.

HY-P1956A

Human serum albumin (Cell culture grade, Endotoxin<0.125 EU/mg)

HSA (Cell culture grade, Endotoxin<0.125 EU/mg)

Native Proteins

Human serum albumin (Cell culture grade, Endotoxin<0.125 EU/mg) (HSA) is the most abundant protein in plasma and is a major determinant of plasma oncotic pressure. Human serum albumin (Cell culture grade, Endotoxin<0.125 EU/mg) exhibits antioxidant, anticoagulant, anti-inflammatory, anti-platelet aggregation activities as well as colloid osmotic action. Human serum albumin (Cell culture grade, Endotoxin<0.125 EU/mg) can block the inhibitory effect of GML on human T cells, providing protective function for T cells. Human serum albumin (Cell culture grade, Endotoxin<0.125 EU/mg) is also associated with cardiovascular diseases and can partially prevent the LPS (HY-D1056) induced oxidative stress, as well as the upregulation of NF-κB, iNOS, and peroxynitrite (ONOO ⁻) in the vascular wall, contributing to the reduction of blood pressure .

Cat. No.	Product Name	Target	Research Area

HY-P1008

Z-VDVAD-FMK 3 Publications Verification Z-VD(OMe)VAD(OMe)-FMK	Caspase	Cancer
Z-VDVAD-FMK is a special inhibitor of caspase-2. Z-VDVAD-FMK produces a reduction in Lovastatin-induced apoptosis .

HY-P3462A

Cagrilintide acetate 3 Publications Verification	CGRP Receptor	Metabolic Disease
Cagrilintide acetate is a non-selective AMYR/CTR agonist and long-acting acylated amylase analogue. Cagrilintide acetate causes a reduction in food intake and significant weight loss in a dose-dependent manner. Cagrilintide acetate can be used in obesity studies .

HY-145632A

Pemvidutide TFA ALT-801 TFA	GLP Receptor GCGR	Metabolic Disease
Pemvidutide (ALT-801) TFA is a GLP-1R/GCGR dual agonist, shows striking reductions in body weight, liver fat and serum lipids. Pemvidutide TFA can be used in non-alcoholic steatohepatitis (NASH) and obesity research .

HY-P1194

Spantide I	Neurokinin Receptor	Inflammation/Immunology
Spantide I, a substance P analog, is a selective NK₁ receptor antagonist, with K_i values of 230 nM and 8150 nM for NK₁ and NK₂ receptor, respectively. Spantide I provides an approach to reduce type 1 and enhance the type 2 cytokine IL-10 in the infected cornea, leading to a significant reduction in corneal perforation .

HY-P1194A

Spantide I TFA	Neurokinin Receptor	Inflammation/Immunology
Spantide I TFA, a substance P analog, is a selective NK₁ receptor antagonist, with K_i values of 230 nM and 8150 nM for NK₁ and NK₂ receptor, respectively. Spantide I provides an approach to reduce type 1 and enhance the type 2 cytokine IL-10 in the infected cornea, leading to a significant reduction in corneal perforation .

HY-P3788

Ac-Asp-Tyr(2-malonyl)-Val-Pro-Met-Leu-NH2	Peptides	Others
Ac-Asp-Tyr(2-malonyl)-Val-Pro-Met-Leu-NH2 is a peptide, can be used to synthesise tyrosine kinase inhibitor for hair growth reduction .

HY-P3121

Caprooyl-tetrapeptide-3 acetate	Peptides	Metabolic Disease
Caprooyl-tetrapeptide-3 acetate is used for fine lines and wrinkle reduction. Caprooyl-tetrapeptide-3 acetate stimulates the expression of collagen VII and laminin-5 in a model of corticoid-induced skin ageing .

HY-P10166

MLCK Peptide, control	Peptides	Others
MLCK Peptide, control is a myosin light-chain kinase. Adding MLCK peptide to permeabilized L15 cells dramatically decreased IICR. MLCK peptide caused a reduction in the extent of IICR with no change in the affinity of IP3 for the IP3R .

HY-P3866

[Asu1,6]-Oxytocin	Oxytocin Receptor	Metabolic Disease
[Asu1,6]-Oxytocin is an analog of oxytocin. [Asu1,6]-Oxytocin reverses insulin resistance and glucose intolerance prior to reduction of obesity. [Asu1,6]-Oxytocin has the potential for the research of obesity and diabetes .

HY-P3841

Protein Kinase C (beta) Peptide	PKC	Others
Protein Kinase C β Peptide is a peptide fragment of Protein Kinase Cβ. Protein Kinase Cβ is related with hyperglycemia decreases endothelium-derived nitric oxide. Inhibition of Protein kinase Cβ prevents the reduction in endothelium-dependent vasodilation induced by acute hyperglycemia .

HY-P10384

SPSB2-iNOS inhibitory cyclic peptide-2	NO Synthase	Infection
SPSB2-iNOS inhibitory cyclic peptide-2 (Compound CP2) is an inhibitor for the interaction of SPRY domain and SOCS-box protein 2 (SPSB2) and iNOS, through binding SPSB2 on iNOS site with K_D of 21 nM. SPSB2-iNOS inhibitory cyclic peptide-2 is reduction-resistant and oxidatively stable .

HY-P5487

GluR23Y	iGluR	Others
GluR23Y is a biological active peptide. (This GluR23Y peptide was used in ELISA cell-surface assay for the insulin-stimulated endocytosis of native AMPA receptors in cultured hippocampal neurons. GluR23Y prevented any insulin-induced reduction. The blockade of insulin action was observed when the GluR23Y peptide was delivered into neurons by fusing it to the membrane transduction domain of HIV-1.)

HY-P10058

cpm-1285m	Biochemical Assay Reagents	Cancer
cpm-1285m is a cell-permeable mutated peptide analogue of cpm-1285 (Bcl-2 inhibitory peptide). cpm-1285m contains a single substitution of alanine for Leu-151, and exhibits a decrease in Bcl-2 binding affinity with a reduction in IC₅₀ of ∼15-fold. cpm-1285m can be used as a control of cpm-1285 .

HY-P10510

R5 peptide	Biochemical Assay Reagents	Others
R5 peptide is one of the repeating peptide sequences that form the protein diatom in Cylindrotheca fusiformis. R5 peptide can be used as a template for the synthesis of Pd (palladium) nanoparticles (NPs). R5 peptide forms complexes with metal ions through the amine groups in its sequence, and the self-assembled structure of the peptide provides a confined spatial environment for the reduction of metal ions and the nucleation of nanoparticles. R5 peptide can be used in the research of biomimetic nanomaterials .

HY-P2446

ORG 30276 APTAA-LHRH	GnRH Receptor	Endocrinology
ORG 30276 (APTAA-LHRH) is a potent GnRH antagonist that effectively reduces serum LH and FSH levels in male rats. ORG 30276 significantly decreases unoccupied pituitary GnRH receptors, leading to suppressed gonadotropin secretion. ORG 30276 treatment results in a considerable reduction in mRNA levels of gonadotropin beta-subunits in the pituitary gland. ORG 30276's effects on gonadotropin dynamics can be selectively reversed by the replacement of specific sex steroids, with androgens being particularly effective for the FSH beta-subunit mRNA levels.

HY-P5836

Citrullinated LL-37 1cit	Interleukin Related Bacterial Enterovirus	Inflammation/Immunology
Citrullinated LL-37 1cit is a citrullinated LL-37 (HY-P1222) peptide. Citrullinated LL-37 1cit does not alter the antiviral effect of LL-37 toward human rhinovirus. Citrullinated LL-37 1cit shows antibacterial activity toward S. aureus. Citrullinated LL-37 1cit causes a reduction in the levels of IL-8, CCL5, and IL-6 mRNA induced by RV1B .

HY-P5837

Citrullinated LL-37 2cit	Interleukin Related Enterovirus	Inflammation/Immunology
Citrullinated LL-37 2cit is a citrullinated LL-37 (HY-P1222) peptide. Citrullinated LL-37 2cit reduces LL-37 activity against HRV at 10 μg/mL and reduces the antibacterial effect of LL-37. Citrullinated LL-37 2cit causes a reduction in the levels of IL-8, CCL5, and IL-6 mRNA induced by RV1B. Citrullinated LL-37 2cit shows a moderate loss in the ability to reduce HRV-induced CCL5 secretion .

HY-P10384A

SPSB2-iNOS inhibitory cyclic peptide-2 TFA	NO Synthase	Infection
SPSB2-iNOS inhibitory cyclic peptide-2 TFA is the TFA salt form of SPSB2-iNOS inhibitory cyclic peptide-2 (HY-P10384). SPSB2-iNOS inhibitory cyclic peptide-2 TFA is an inhibitor for the interaction of SPRY domain and SOCS-box protein 2 (SPSB2) and iNOS, through binding SPSB2 on iNOS site with K_D of 21 nM. SPSB2-iNOS inhibitory cyclic peptide-2 TFA is reduction-resistant and oxidatively stable .

HY-P0037

Org-30850 Org 30850ANT	Peptides GnRH Receptor	Endocrinology
Org-30850 is a potent LHRH antagonist designed for treating hormone-dependent disorders. In animal studies, a single subcutaneous dose effectively inhibited ovulation in rats and significantly reduced testosterone levels in male rats for up to 48 hours post-administration. Daily doses of Org-30850 in female rats suppressed estrous cycles, decreased uterine and ovarian weights, and lowered estradiol and FSH serum levels. In male rats, prolonged treatment resulted in reversible reductions in gonadal function and testosterone levels, with almost complete recovery observed after cessation of treatment. Unlike comparable LHRH antagonists, Org-30850 exhibited minimal injection site irritation and no edematous reactions, suggesting a more favorable therapeutic profile .

Cat. No.	Product Name	Target	Research Area

HY-P990081

Oloctinebart	Inhibitory Antibodies	Neurological Disease
Oloctinebart is a humanized immunoglobulin G4-kappa, anti-LGALS3 monoclonal antibody. Oloctinebart is used for reduction of amyloid beta oligomers formation .

HY-P990078

Remternetug LY3372993	Amyloid-β	Neurological Disease
Remternetug is a human immunoglobulin G1-kappa, anti-APP (amyloid beta A4 precursor protein) Aβ42 N3pGlu peptide monoclonal antibody. Remternetug recognizes a pyroglutamated form of Aβ. Remternetug results in rapid and robust amyloid plaque reduction. Remternetug can be used for Alzheimer's disease research .

HY-P99552

Tafolecimab IBI-306	PCSK9	Cardiovascular Disease
Tafolecimab (IBI-306) is a human lgG2 monoclonal antibody that specifically binds PCSK-9 and reduces LDL-C levels by inhibiting PCSK-9-mediated endocytosis of the LDL receptor, which in turn enhances clearance of LDL-C and leads to a reduction in LDL-C levels. Tafolecimab may be used in studies of hypercholesterolaemia .

HY-P99396

Spesolimab BI 655130	Interleukin Related	Inflammation/Immunology
Spesolimab (BI 655130) is a mouse-derived humanized IgG1k antibody against IL-36R. IL-36 plays an important role in the immune system and Spesolimab is being investigated in palmoplantar pustulosis (PPP). Spesolimab was associated with a reduction in biomarkers associated with the innate, Th1/Th17 and neutrophil pathways .

HY-P99009

Batoclimab RVT-1401; HBM9161; IMVT-1401	Fc Receptor (FcR)	Inflammation/Immunology
Batoclimab (RVT-1401) is a fully humanized IgG1 monoclonal antibody targeting FcRn. Batoclimab has high affinity for the IgG-binding site on FcRn. By competitively binding to the IgG binding site on FcRn, Batoclimab blocks FcRn-mediated recycling of IgG, resulting in enhanced degradation and subsequent reductions in IgG levels. Batoclimab can be used in the research of autoimmune diseases such as myasthenia gravis and thyroid eye disease .

HY-P990012

Vamikibart	Interleukin Related	Inflammation/Immunology
Vamikibart (RG6179) is a monoclonal antibody targeting IL-6 that can be used to inhibit uveal macular edema (UME) and reduce retinal leakage. Vamikibart can reduce anterior chamber (AC) cell density, indicating a reduction in intraocular inflammation. Vamikibart can also be used to assess the leakage dynamics of ultra-wide-angle fluorescein angiography (UWFA) in the UME model to quantify changes in retinal leakage reflecting the effect of UME inhibition .

HY-P99790

Priliximab CEN 000029; cM-T412	Transmembrane Glycoprotein	Inflammation/Immunology
Priliximab (CEN 000029) is an anti-CD4 humanized monoclonal antibody. Priliximab binds to CD4 on the surface of T cells, resulting in a significant and sustained reduction in circulating CD4 ⁺ T cells. Priliximab can be used in research of rheumatoid arthritis (RA) .

Cat. No.	Product Name	Category	Target	Chemical Structure

HY-78036

Mesaconic acid Citronic acid; Methylfumaric acid	Structural Classification Microorganisms Classification of Application Fields Brassica oleracea L. Ketones, Aldehydes, Acids Source classification Other Diseases Plants Brassicaceae Endogenous metabolite Disease Research Fields	Endogenous Metabolite
Mesaconic acid is an active product that can be extracted from Saxifraga stolonifera. Mesaconic acid is used as a fire retardant and is a competitive inhibitor of fumarate reduction .

HY-113101

2-Hydroxyadipic acid	Classification of Application Fields Other disease Ketones, Aldehydes, Acids Source classification Other Diseases Disease markers Endogenous metabolite Disease Research Fields	Endogenous Metabolite
2-Hydroxyadipic acid is an organic acid, formed by the reduction of 2-ketoadipic acid.

HY-113114

Tetrahydrocortisone	Structural Classification Classification of Application Fields Source classification Other Diseases Endogenous metabolite Disease Research Fields Steroids	Endogenous Metabolite
Tetrahydrocortisone is a stress-induced hormone. Tetrahydrocortisone is also a urinary metabolite of Cortisone derived from the reduction of Cortisone by 5-reductase .

HY-N6618

DL-Mannitol	Structural Classification other families Classification of Application Fields Source classification Other Diseases Plants Disease Research Fields Saccharides	Others
DL-Mannitol is obtained by combining D-mannitol with a sample of Lmannitol obtained by reduction of L-mannono-1, Clactone .

HY-N0893

Tetrahydrocurcumin 2 Publications Verification HZIV 81-2	Structural Classification Classification of Application Fields Anti-aging Source classification Plants Endogenous metabolite Microorganisms Phenols Polyphenols Curcuma longa Inflammation/Immunology Disease Research Fields Zingiberaceae Cancer	Cytochrome P450 Autophagy Endogenous Metabolite
Tetrahydrocurcumin is a Curcuminoid found in turmeric (Curcuma longa) that is produced by the reduction of Curcumin. Tetrahydrocurcumin inhibit CYP2C9 and CYP3A4.

HY-N4203

Isopropyl ferulate	Infection Structural Classification Monophenols Classification of Application Fields Simple Phenylpropanols Source classification Phenols Phenylpropanoids Plants Umbelliferae Kleinia odora (Forssk.) DC. Disease Research Fields	Fungal
Isopropyl ferulate, isolated from Notopterygium incisum, is used in the reduction of pharmaceuticals, preparation of antifungal agents, cosmetics and as antioxidant agent and so forth .

HY-100582

Ribitol 1 Publications Verification Adonitol; Adonite	Structural Classification Microorganisms Animals Classification of Application Fields Source classification Other Diseases Endogenous metabolite Disease Research Fields Saccharides	Endogenous Metabolite
Ribitol is a crystalline pentose alcohol formed by the reduction of ribose. Enhancing the flux of D-glucose to the pentose phosphate pathway in Saccharomyces cerevisiae for the production of D-ribose and ribitol.

HY-78036R

Mesaconic acid (Standard) Citronic acid (Standard); Methylfumaric acid (Standard)	Structural Classification Microorganisms Brassica oleracea L. Ketones, Aldehydes, Acids Source classification Plants Brassicaceae Endogenous metabolite	Endogenous Metabolite
Mesaconic acid (Standard) is the analytical standard of Mesaconic acid. This product is intended for research and analytical applications. Mesaconic acid is an active product that can be extracted from Saxifraga stolonifera. Mesaconic acid is used as a fire retardant and is a competitive inhibitor of fumarate reduction[1].

HY-N9903

Tetrahydrodehydrodiconiferyl alcohol TDDC	Source classification Epimedium grandiflorum C. Morren Plants Berberidaceae	Others
Tetrahydrodehydrodiconiferyl alcohol (TDDC) is a reduction product of dihydrodehydrodiconiferyl alcohol catalyzed by phenylcoumaran benzylic ether reductase. Tetrahydrodehydrodiconiferyl alcohol can be isolated from a hydrogenolysis product of protolignin .

HY-N1803

3-Acetoxy-11-ursen-28,13-olide 11,12-Dehydroursolic lactone acetate	Triterpenes Structural Classification Terpenoids Source classification Myrtaceae Plants Eucalyptus globulus Labill.	Others
3-Acetoxy-11-ursen-28,13-olide (11,12-dehydroursolic lactone acetate) is a reduction product of 11-ketoursolic acid .

HY-B0722

Histamine dihydrochloride Maximum Cited Publications 10 Publications Verification	Structural Classification Natural Products Classification of Application Fields Source classification Metabolic Disease Endogenous metabolite Disease Research Fields	Endogenous Metabolite Reactive Oxygen Species
Histamine dihydrochloride is a reactive oxygen species (ROS) inhibitor. Histamine dihydrochloride can suppress ROS production and work together with IL-2 to activate T cells and NK cells, leading to immune activation in the tumor microenvironment, which consequently kills acute myeloid leukemia (AML) cells. Histamine dihydrochloride can cause a reduction in vaginal tetrazo reduction, increased epithelial growth, and heightened keratinization in mouse models of ovariectomy. Histamine dihydrochloride can be used in the research of acute myeloid leukemia, malignant melanoma, and renal cell carcinoma .

HY-N1322

Sanggenol A	Structural Classification Flavonoids Flavones Source classification Plants Moraceae Morus alba Linn.	Bacterial β-glucuronidase
Sanggenol A acts as a dual inhibitor of nitrofuranone reduction mediated by the intestinal microbial nitrification reductases EcNfsA and EcNfsB. In addition, Sanggenol A is also an effective inhibitor of intestinal bacterial β-glucuronidase .

HY-N4072

6''-O-Acetylglycitin 2 Publications Verification	Monophenols Flavonoids Classification of Application Fields Leguminosae Glycine max (L.) merr Source classification Phenols Metabolic Disease Plants Disease Research Fields Isoflavones	Others
6''-O-Acetylglycitin, a acetyl glucoside, is one of the isoflavone isomer in soybeans, shows various extents of content reduction dependent on storage temperature, packaging condition, and its isoflavone isomer kind .

HY-N4046

Hexacosyl (E)-ferulate n-Hexacosyl trans-ferulate	Structural Classification Monophenols Source classification Dendranthema morifolium (Ramat.) Tzvel. Phenols Plants Compositae	Others
Hexacosyl (E)-ferulate (n-Hexacosyl trans-ferulate) is an antioxidant agent that displays significant antioxidant activity in the DPPH (HY-112053) assay with the RC₅₀ (50% reduction concentration) of 0.0976 mg/mL .

HY-N0893R

Tetrahydrocurcumin (Standard)	Structural Classification Microorganisms Source classification Phenols Polyphenols Plants Curcuma longa Endogenous metabolite Zingiberaceae	Cytochrome P450 Autophagy Endogenous Metabolite
Tetrahydrocurcumin (Standard) is the analytical standard of Tetrahydrocurcumin. This product is intended for research and analytical applications. Tetrahydrocurcumin is a Curcuminoid found in turmeric (Curcuma longa) that is produced by the reduction of Curcumin. Tetrahydrocurcumin inhibit CYP2C9 and CYP3A4.

HY-W011142

2'-Deoxyuridine 5'-monophosphate disodium dUMP disodium	Natural Products Classification of Application Fields Source classification Metabolic Disease Endogenous metabolite Disease Research Fields	Endogenous Metabolite
2'-Deoxyuridine 5'-monophosphate (dUMP) disodium is a deoxynucleotide that is reductively methylated to dTMP (2'-deoxythymidine 5'-monophosphate) by bisubstrate enzyme thymidylate synthase (TS). dTMP is a nucleotide required for DNA synthesis .

HY-100582R

Ribitol (Standard) Adonitol (Standard); Adonite (Standard)	Structural Classification Microorganisms Animals Source classification Endogenous metabolite Saccharides	Endogenous Metabolite
Ribitol (Standard) is the analytical standard of Ribitol. This product is intended for research and analytical applications. Ribitol is a crystalline pentose alcohol formed by the reduction of ribose. Enhancing the flux of D-glucose to the pentose phosphate pathway in Saccharomyces cerevisiae for the production of D-ribose and ribitol.

HY-B0722R

Histamine (dihydrochloride) (Standard)	Structural Classification Natural Products Source classification Endogenous metabolite	Endogenous Metabolite Reactive Oxygen Species
Histamine (dihydrochloride) (Standard) is the analytical standard of Histamine (dihydrochloride). This product is intended for research and analytical applications. Histamine dihydrochloride is a reactive oxygen species (ROS) inhibitor. Histamine dihydrochloride can suppress ROS production and work together with IL-2 to activate T cells and NK cells, leading to immune activation in the tumor microenvironment, which consequently kills acute myeloid leukemia (AML) cells. Histamine dihydrochloride can cause a reduction in vaginal tetrazo reduction, increased epithelial growth, and heightened keratinization in mouse models of ovariectomy. Histamine dihydrochloride can be used in the research of acute myeloid leukemia, malignant melanoma, and renal cell carcinoma .

HY-N12267

N,N′-Diferuloylputrescine (E/Z)-Terrestribisamide	Structural Classification Zea mays L. Gramineae Source classification Phenols Polyphenols Plants	Melanocortin Receptor
N,N′-Diferuloylputrescine ((E/Z)-Terrestribisamide) is a inhibitor of pigmentation with 57% reduction. N,N′-Diferuloylputrescine significantly reduces the protein level of MITF. N,N′-Diferuloylputrescine has strong antioxidant activities as radical scavengers against reactive oxygen species .

HY-B0456

Riboflavin 3 Publications Verification Vitamin B2; E101	Structural Classification Natural Products Human Gut Microbiota Metabolites Microorganisms Classification of Application Fields Source classification Other Diseases Endogenous metabolite Disease Research Fields	Endogenous Metabolite Bacterial
Riboflavin, an orally active and easily absorbed micronutrient, is a precursor of flavin mononucleotide (FMN) and flavin adenine dinucleotide (FAD), which serve as coenzymes for numerous enzymatic reactions and perform key metabolic functions by mediating the transfer of electrons in biological oxidation-reduction reaction .

HY-N0710

alpha-Cyperone 2 Publications Verification α-Cyperone; (+)-α-Cyperone	Structural Classification other families Classification of Application Fields Terpenoids Sesquiterpenes Source classification Plants Endogenous metabolite Inflammation/Immunology Disease Research Fields	Endogenous Metabolite
alpha-Cyperone (α-Cyperone) is associated with the down-regulation of COX-2, IL-6, Nck-2, Cdc42 and Rac1, resulting in reduction of inflammation, which would be highly beneficial for treatment of inflammatory diseases such as AD.

HY-N14038

Crocacin A	Structural Classification Natural Products Microorganisms Source classification	Fungal
Crocacin A has anti-yeast and filamentous fungal activity. Crocacin A can inhibit mouse fibroblasts L929. In the microsomes of the calf's heart, Crocacin A can interrupt the bc1 segment of electronic transmission, causes redshift of 569 nm peak in cytochrome B reduction spectrum .

HY-111346

1-Linoleoyl Glycerol 1-Linoleoyl-rac-glycerol; 1-Monolinolein	Cardiovascular Disease Structural Classification Saururaceae Classification of Application Fields Saururus chinensis (Lour.) Baill. Ketones, Aldehydes, Acids Source classification Plants Disease Research Fields	Phospholipase Apolipoprotein Interleukin Related
1-Linoleoyl glycerol is a LpPLA2 inhibitor. 1-Linoleoyl glycerol acts as a precursor for synthesizing various functional lipids, such as phospholipids. 1-Linoleoyl glycerol mitigates inflammation induced by Apolipoprotein CIII (reduction of IL-6) .

HY-N9022

(S)-1-(4-Hydroxy-2,2-dimethylchroman-6-yl)ethanone	Natural Products Source classification Plants Compositae Tephrosia purpurea (L.) Pers.	Others
(S)-1-(4-Hydroxy-2,2-dimethylchroman-6-yl)ethanone is an enantiopure chiral alcohol. Stereoselective reduction of prochiral ketones is studied by using both cell cultures and wild tissues of various endemic plant species .

HY-118103

Coprostanol Coprostan-3-ol	Structural Classification Classification of Application Fields Source classification Other Diseases Endogenous metabolite Disease Research Fields Steroids	Endogenous Metabolite
Coprostanol (Coprostan-3-ol) is a fecal sterol formed by microbial reduction of cholesterol in the intestines of man and higher animals. Coprostanol can be used as an indicator sterol of fecal pollution. Coprostanol has been recognized as a good indicator of pollution of water resources by sewage discharges .

HY-N1282R

Seneciphylline (Standard)	Alkaloids Structural Classification other families Pyrrole Alkaloids Source classification Plants Compositae Sophora yunnanensis C. Y. Ma	Glutathione S-transferase Cytochrome P450
Seneciphylline (Standard) is the analytical standard of Seneciphylline. This product is intended for research and analytical applications. Seneciphylline is a toxic pyrrolizidine alkaloid in Gynura japonica . Seneciphylline significantly increases the activities of epoxide hydrase and glutathione-S-transferase but causes reduction of cytochrome P-450 and related monooxygenase activities .

HY-N14040

Crocacin B	Structural Classification Natural Products Microorganisms Source classification	Fungal
Crocacin B has anti-yeast and filamentous fungal activity. Crocacin B can inhibit mouse fibroblasts L929. In the microsomes of the calf's heart, Crocacin B can interrupt the bc1 segment of electronic transmission, causes redshift of 569 nm peak in cytochrome B reduction spectrum .

HY-P2450

Leucinostatin A Antibiotic P168	Infection Natural Products Microorganisms Classification of Application Fields Source classification Disease Research Fields	Fungal Antibiotic
Leucinostatin A (Antibiotic P168) is a nonapeptide exerting a remarkable activity especially against Candida albicans and Cryptococcus neoformans. Leucinostatin A is a hydrophobic nonapeptide antibiotic. Leucinostatin A inhibits prostate cancer growth through reduction of insulin-like growth factor-I expression in prostate stromal cells. Antiprotozoal activies .

HY-N14043

Crocacin C	Structural Classification Natural Products Microorganisms Source classification	Fungal
Crocacin C has anti-yeast and filamentous fungal activity. Crocacin C can inhibit mouse fibroblasts L929. In the microsomes of the calf's heart, Crocacin C can interrupt the bc1 segment of electronic transmission, causes redshift of 569 nm peak in cytochrome B reduction spectrum .

HY-N14044

Crocacin D	Structural Classification Natural Products Microorganisms Source classification	Fungal
Crocacin D has anti-yeast and filamentous fungal activity. Crocacin D can inhibit mouse fibroblasts L929. In the microsomes of the calf's heart, Crocacin D can interrupt the bc1 segment of electronic transmission, causes redshift of 569 nm peak in cytochrome B reduction spectrum .

HY-N10307

Anserinone B	Infection Quinones Human Gut Microbiota Metabolites Microorganisms Classification of Application Fields Source classification Benzene Quinones Endogenous metabolite Disease Research Fields	Fungal Bacterial Endogenous Metabolite
Anserinone B is an antifungal and antibacterial benzoquinone. Anserinone B causes radial growth reductions of 50% and 37% against S.fimicola and A. furfuraceus, respectively. Anserinones B also displays moderate cytotoxicity in the NCI’s 60 human tumor cell line panel (GI₅₀=4.4 µg/mL) .

HY-125365

Rifamycin S 1 Publications Verification	Infection Quinones Structural Classification Monophenols Microorganisms Classification of Application Fields Source classification Phenols Naphthalene Quinones Disease Research Fields	Bacterial Reactive Oxygen Species Antibiotic
Rifamycin S, a quinone, is an antibiotic against Gram-positive bacteria (including MRSA). Rifamycin S is the oxidized forms of a reversible oxidation-reduction system involving two electrons. Rifamycin S generates reactive oxygen species (ROS) and inhibits microsomal lipid peroxidation. Rifamycin S can be used for tuberculosis and leprosy .

HY-B0456R

Riboflavin (Standard)	Structural Classification Natural Products Human Gut Microbiota Metabolites Microorganisms Source classification Endogenous metabolite	Endogenous Metabolite Bacterial
Riboflavin (Standard) is the analytical standard of Riboflavin. This product is intended for research and analytical applications. Riboflavin, an orally active and easily absorbed micronutrient, is a precursor of flavin mononucleotide (FMN) and flavin adenine dinucleotide (FAD), which serve as coenzymes for numerous enzymatic reactions and perform key metabolic functions by mediating the transfer of electrons in biological oxidation-reduction reaction .

HY-N0710R

alpha-Cyperone (Standard)	Structural Classification other families Terpenoids Sesquiterpenes Source classification Plants Endogenous metabolite	Endogenous Metabolite
alpha-Cyperone (Standard) is the analytical standard of alpha-Cyperone. This product is intended for research and analytical applications. alpha-Cyperone (α-Cyperone) is associated with the down-regulation of COX-2, IL-6, Nck-2, Cdc42 and Rac1, resulting in reduction of inflammation, which would be highly beneficial for treatment of inflammatory diseases such as AD.

HY-N6967

Levomenol (-)-α-Bisabolol	Structural Classification other families Terpenoids Sesquiterpenes Source classification Plants	Apoptosis
Levomenol ((-)-α-Bisabolol), a monocyclic sesquiterpene alcohol, exerts antioxidant, anti-inflammatory, and anti-apoptotic activities. Levomenol also has neuroprotective effects and prevents neuronal damage and memory deficits through reduction of proinflammatory markers induced by permanent focal cerebral ischemia in mice. Levomenol attenuates nociceptive behaviour and central sensitisation in a rodent model of trigeminal neuropathic pain. Orally active .

HY-125365R

Rifamycin S (Standard)	Quinones Structural Classification Monophenols Microorganisms Source classification Phenols Naphthalene Quinones	Bacterial Reactive Oxygen Species Antibiotic
Rifamycin S (Standard) is the analytical standard of Rifamycin S. This product is intended for research and analytical applications. Rifamycin S, a quinone, is an antibiotic against Gram-positive bacteria (including MRSA). Rifamycin S is the oxidized forms of a reversible oxidation-reduction system involving two electrons. Rifamycin S generates reactive oxygen species (ROS) and inhibits microsomal lipid peroxidation. Rifamycin S can be used for tuberculosis and leprosy .

HY-107302

Sandosaponin A Soyasaponin Bd	Triterpenes Structural Classification Leguminosae Terpenoids Source classification Plants Phaseolus vulgaris Linn.	Endogenous Metabolite
Sandosaponin A (Soyasaponin Bd) is a saponin with inhibitory activity against human recombinant aldehyde reductase (hAKR1B1). Sandosaponin A can inhibit the reduction of l-idose and 4-hydroxynonenal to varying degrees. The presence of Sandosaponin A reveals the challenges posed by the masking effect of conventional aldehyde reductase inhibitors in mixtures when exploring differential aldehyde reductase inhibitors. The inhibitory mechanism of Sandosaponin A may be related to its mode of action on different substrates .

HY-N11844

Quercetin 3-(6″-caffeoylsophoroside)	Structural Classification Natural Products Cardamine hirsuta L. Source classification Plants Brassicaceae	Amylases
Quercetin 3-(6″-caffeoylsophoroside) is an orally active α-amylase inhibitor, with an IC₅₀ of 73.66 μg/mL. Quercetin 3-(6″-caffeoylsophoroside) presents in thehydro-methanolic extract of Cardamine hirsuta Linn. Quercetin 3-(6″-caffeoylsophoroside) shows the antidiabetic activities by oxidative stress reduction and α-amylase inhibition. Quercetin 3-(6″-caffeoylsophoroside) can be used for diabetes mellitus research .

HY-N6967R

Levomenol (Standard)	Structural Classification other families Terpenoids Sesquiterpenes Source classification Plants	Apoptosis
Levomenol (Standard) is the analytical standard of Levomenol. This product is intended for research and analytical applications. Levomenol ((-)-α-Bisabolol), a monocyclic sesquiterpene alcohol, exerts antioxidant, anti-inflammatory, and anti-apoptotic activities. Levomenol also has neuroprotective effects and prevents neuronal damage and memory deficits through reduction of proinflammatory markers induced by permanent focal cerebral ischemia in mice. Levomenol attenuates nociceptive behaviour and central sensitisation in a rodent model of trigeminal neuropathic pain. Orally active .

HY-N7012

7,3',4'-Tri-O-methylluteolin 5-Hydroxy-3',4',7-trimethoxyflavone	Flavonoids Monophenols Classification of Application Fields Flavones Labiatae Source classification Phenols Plants Disease Research Fields Inflammation/Immunology Swartzia polyphylla DC.	TNF Receptor Interleukin Related COX
7,3',4'-Tri-O-methylluteolin (5-Hydroxy-3',4',7-trimethoxyflavone), a flavonoid compound, possesses potent anti-inflammatory effects in LPS-induced macrophage cell line mediated by inhibition of release of inflammatory mediators, NO, PGE2, and pro-inflammatory cytokines. 7,3',4'-Tri-O-methylluteolin significantly induces reduction in the mRNA expressions of inducible nitric oxide synthase and cyclooxygenase-2 .

HY-113224

Desmosterol 5 Publications Verification	Structural Classification Microorganisms Classification of Application Fields Source classification Disease markers Endocrine diseases Metabolic Disease Endogenous metabolite Disease Research Fields Steroids	Endogenous Metabolite LXR Fatty Acid Synthase (FASN) Interleukin Related Reactive Oxygen Species NOD-like Receptor (NLR)
Desmosterol is a cholesterol-like molecule. In the Bloch pathway of cholesterol biosynthesis, Desmosterol is a direct precursor of cholesterol. As an endogenous metabolite, Desmosterol is used to study cholesterol metabolism . Desmosterol is an LXR activator and SREBP inhibitor, which can suppress macrophage inflammasome activation and prevent vascular inflammation and atherosclerosis. A reduction in Desmosterol promotes the production of mitochondrial reactive oxygen species (ROS) in macrophages and pyrin domain-dependent inflammasome activation of NLRP3. Desmosterol holds potential for research in inflammation, metabolism, and cardiovascular diseases .

HY-N15398

Chaetoglobosin E	Structural Classification Alkaloids Microorganisms Source classification Indole Alkaloids	Ferroptosis
Chaetoglobosin E is a Ferroptosis inducer that exhibits significant cytotoxicity against human tumor cell lines MDA-MB231 and A549, with IC₅₀ values of 9.14 and 7.47 μM, respectively. By downregulating the expression of GPX4 in A549 cells, Chaetoglobosin E markedly increases intracellular levels of Fe ²⁺ and the lipid peroxidation product malondialdehyde (MDA), leading to mitochondrial shrinkage, reduction or disappearance of cristae, and subsequent induction of ferroptosis. Chaetoglobosin E can be used for research in the field of cancer .

HY-N7676

Marein 2 Publications Verification	Cardiovascular Disease Structural Classification Chalcones Flavonoids other families Neurological Disease Classification of Application Fields Source classification Phenols Polyphenols Plants Disease Research Fields	AMPK HDAC
Marein has the neuroprotective effect due to a reduction of damage to mitochondria function and activation of the AMPK signal pathway. Marein improves insulin resistance induced by high glucose in HepG2 cells through CaMKK/AMPK/GLUT1 to promote glucose uptake, through IRS/Akt/GSK-3β to increase glycogen synthesis, and through Akt/FoxO1 to decrease gluconeogenesis. Marein is a HDAC inhibitor with an IC₅₀ of 100 μM. Marein has beneficial antioxidative, antihypertensive, antihyperlipidemic and antidiabetic effects .

HY-N7545

Protorubradirin	Structural Classification Microorganisms Antibiotics Source classification Other Antibiotics	Antibiotic Reverse Transcriptase
Protorubradirin is an antibiotic that can be isolated from Streptomyces achromogenes var. rubradirin together with Rubradirin. Protorubradirin has inhibitory activity against HIV reverse transcriptase. In vitro studies have shown that Protorubradirin also inhibits Staphylococcus aureus strains and Streptococci. In infected mice, subcutaneous injection of Protorubradirin showed in vivo inhibitory efficacy against antibiotic-resistant Staphylococcus aureus strains. However, oral administration may result in a significant reduction in the activity of Protorubradirin, possibly due to faster cleavage of its C-nitroso sugar in the acidic gastric environment compared to Rubradirin .

HY-113224R

Desmosterol (Standard)	Structural Classification Microorganisms Source classification Disease markers Endocrine diseases Endogenous metabolite Steroids	Endogenous Metabolite LXR Fatty Acid Synthase (FASN) Interleukin Related Reactive Oxygen Species NOD-like Receptor (NLR)
Desmosterol (Standard) is the analytical standard of Desmosterol. This product is intended for research and analytical applications. Desmosterol is a cholesterol-like molecule. In the Bloch pathway of cholesterol biosynthesis, Desmosterol is a direct precursor of cholesterol. As an endogenous metabolite, Desmosterol is used to study cholesterol metabolism [1]. Desmosterol is an LXR activator and SREBP inhibitor, which can suppress macrophage inflammasome activation and prevent vascular inflammation and atherosclerosis. A reduction in Desmosterol promotes the production of mitochondrial reactive oxygen species (ROS) in macrophages and pyrin domain-dependent inflammasome activation of NLRP3. Desmosterol holds potential for research in inflammation, metabolism, and cardiovascular diseases [1][2][3].

HY-N4267

Yangambin	Cardiovascular Disease other families Classification of Application Fields Source classification Lignans Phenylpropanoids Plants Disease Research Fields	Calcium Channel
Yangambin, a furofuran lignan, is already isolated from plants such as member of the Annonaceae family, including species of the genus Rollinia: R. pickeli, R. exalbidaand R. mucosa, as well from the Magnolia biondii. Yangambin, a selective PAF receptor antagonist, inhibits Ca ²⁺ influx through voltage-gated Ca ²⁺ channels, leading to the reduction in [Ca ²⁺]i in vascular smooth muscle cells and consequent peripheral vasodilation . Yangambin exhibits the antiallergic activity against β-hexosaminidase release with an IC₅₀ of 33.8 μM and for anti-inflammatory activity with an IC₅₀ of 37.4 μM .

HY-B1941

4-tert-Octylphenol 1 Publications Verification	Monophenols Neurological Disease Classification of Application Fields Source classification Phenols Endogenous metabolite Disease Research Fields Endocrinology	Endogenous Metabolite Apoptosis DNA/RNA Synthesis
4-tert-Octylphenol, a endocrine-disrupting chemical, is an estrogenic agent. 4-tert-Octylphenol is also a biodegradation product of non-ionic surfactants alkylphenol polyethoxylates. 4-tert-Octylphenol induces apoptosis in neuronal progenitor cells in offspring mouse brain. 4-tert-Octylphenol reduces bromodeoxyuridine (BrdU), mitotic marker Ki67, and phospho-histone H3 (p-Histone-H3), resulting in a reduction of neuronal progenitor proliferation. 4-tert-Octylphenol disrupts brain development and behavior in mice, which is promising for reserch of immune response, neuro-related diseases and ethology .

HY-N2515

Ginsenoside Rk1 5+ Cited Publications	Panax ginseng C. A. Meyer Triterpenes Structural Classification Classification of Application Fields Terpenoids Source classification Plants Inflammation/Immunology Disease Research Fields Araliaceae	NF-κB PI3K JAK Apoptosis
Ginsenoside Rk1 is a unique component created by processing the ginseng plant (mainly Sung Ginseng, SG) at high temperatures . Ginsenoside Rk1 has anti-inflammatory effect, suppresses the activation of Jak2/Stat3 signaling pathway and NF-κB . Ginsenoside Rk1 has anti-tumor effect, antiplatelet aggregation activities, anti-insulin resistance, nephroprotective effect, antimicrobial effect, cognitive function enhancement, lipid accumulation reduction and prevents osteoporosis . Ginsenoside Rk1 induces cell apoptosis by triggering intracellular reactive oxygen species (ROS) generation and blocking PI3K/Akt pathway .

HY-N3945

Glaucine O,O-Dimethylisoboldine; S-(+)-Glaucine; NSC 34396	Infection Alkaloids Structural Classification other families Classification of Application Fields Source classification Plants Isoquinoline Alkaloids Glaucium flavum Inflammation/Immunology Disease Research Fields Papaveraceae	Phosphodiesterase (PDE) Calcium Channel MMP NF-κB
Glaucine (O,O-Dimethylisoboldine) is an alkaloid extracted from Glaucium flavum that possesses various activities, including cough relief, bronchodilation, anti-inflammatory effects, analgesia, antipyretic properties, and anticancer effects. Glaucine acts as a selective and orally active inhibitor of phosphodiesterase 4 (PDE4), with a K_i of 3.4 µM in human bronchial tissues and polymorphonuclear leukocytes. Glaucine induces relaxation of human isolated bronchi by antagonizing calcium channels. Additionally, Glaucine inhibits the activation of NF-κB, leading to a reduction in the expression of the MMP-9 gene, thereby suppressing the migration and invasion of breast cancer cells. Therefore, Glaucine holds potential for research in asthma and breast cancer .

HY-B1941R

4-tert-Octylphenol (Standard)	Monophenols Source classification Phenols Endogenous metabolite	Endogenous Metabolite Apoptosis DNA/RNA Synthesis
4-tert-Octylphenol (Standard) is the analytical standard of 4-tert-Octylphenol. This product is intended for research and analytical applications. 4-tert-Octylphenol, a endocrine-disrupting chemical, is an estrogenic agent. 4-tert-Octylphenol is also a biodegradation product of non-ionic surfactants alkylphenol polyethoxylates. 4-tert-Octylphenol induces apoptosis in neuronal progenitor cells in offspring mouse brain. 4-tert-Octylphenol reduces bromodeoxyuridine (BrdU), mitotic marker Ki67, and phospho-histone H3 (p-Histone-H3), resulting in a reduction of neuronal progenitor proliferation. 4-tert-Octylphenol disrupts brain development and behavior in mice, which is promising for reserch of immune response, neuro-related diseases and ethology .

Cat. No.	Product Name	Chemical Structure

HY-100582S

Ribitol-1-13C
Ribitol-1- ¹³C is the ¹³C labeled Ribitol. Ribitol is a crystalline pentose alcohol formed by the reduction of ribose. Enhancing the flux of D-glucose to the pentose phosphate pathway in Saccharomyces cerevisiae for the production of D-ribose and ribitol .

HY-113128S

sn-Glycerol 3-phosphate-13C3 disodium
sn-Glycerol 3-phosphate- ¹³C₃ disodium is the ¹³C-labeled sn-Glycerol 3-phosphate disodium. sn-Glycerol 3-phosphate disodium is produced by cytosolic glycerol 3-phosphate dehydrogenase pathway through the reduction of dihydroxyacetone phosphate using NADH formed during glycolysis .

HY-105129AS

Pimonidazole-d10

Pimonidazole-d₁₀ is the deuterium labeled Pimonidazole. Pimonidazole is a novel hypoxia marker for complementary study of tumor hypoxia and cell proliferation in tumor[1]. Pimonidazole accumulates in hypoxic cells via covalent binding with macromolecules or by forming reductive metabolites after reduction of its nitro group, it can be used for qualitative and quantitative assessment of tumor hypoxia [2].

HY-113114S

Tetrahydrocortisone-d5
Tetrahydrocortisone-d₅ is the deuterium labeled Tetrahydrocortisone. Tetrahydrocortisone is a stress-induced hormone. Tetrahydrocortisone is also a urinary metabolite of Cortisone derived from the reduction of Cortisone by 5-reductase[1].

HY-113114S1

Tetrahydrocortisone-d6
Tetrahydrocortisone-d₆ is the deuterium labeled Tetrahydrocortisone. Tetrahydrocortisone is a stress-induced hormone. Tetrahydrocortisone is also a urinary metabolite of Cortisone derived from the reduction of Cortisone by 5-reductase[1].

HY-N6618S

DL-Mannitol-13C
DL-Mannitol- ¹³C is the ¹³C-labeled DL-Mannitol. DL-Mannitol is obtained by combining D-mannitol with a sample of Lmannitol obtained by reduction of L-mannono-1, Clactone[1].

HY-100582S1

Ribitol-2-13C
Ribitol-2- ¹³C is the ¹³C labeled Ribitol. Ribitol is a crystalline pentose alcohol formed by the reduction of ribose. Enhancing the flux of D-glucose to the pentose phosphate pathway in Saccharomyces cerevisiae for the production of D-ribose and ribitol

HY-100582S3

Ribitol-5-13C
Ribitol-5- ¹³C is the ¹³C labeled Ribitol. Ribitol is a crystalline pentose alcohol formed by the reduction of ribose. Enhancing the flux of D-glucose to the pentose phosphate pathway in Saccharomyces cerevisiae for the production of D-ribose and ribitol

HY-100582S2

Ribitol-3-13C
Ribitol-3- ¹³C is the ¹³C labeled Ribitol. Ribitol is a crystalline pentose alcohol formed by the reduction of ribose. Enhancing the flux of D-glucose to the pentose phosphate pathway in Saccharomyces cerevisiae for the production of D-ribose and ribitol

HY-A0057AS2

Gabapentin-d4 hydrochloride
Gabapentin-d4 hydrochloride is the deuterium labeled Gabapentin hydrochloride (HY-A0057A). Gabapentin hydrochloride is a potent, orally active P/Q type Ca ²⁺ channel blocker. Gabapentin hydrochloride inhibits neuronal Ca ²⁺ influx and reduction of neurotransmitter release. Gabapentin hydrochloride is a GABA analog that can be used to relieve neuropathic pain .

HY-100442S

Paquinimod-d5
Paquinimod-d5 is a deuterated analog of Paquinimod (HY-100442). Paquinimod (ABR 215757) is a specific and orally active inhibitor of S100A8/S100A9. Paquinimod rescues the pneumonia with substantial reduction of viral loads in SARS-CoV-2-infected mice .

HY-B0456S5

Riboflavin-d8
Riboflavin-d₈ (Vitamin B2-d₈ ) is deuterium labeled Riboflavin. Riboflavin, an orally active and easily absorbed micronutrient, is a precursor of flavin mononucleotide (FMN) and flavin adenine dinucleotide (FAD), which serve as coenzymes for numerous enzymatic reactions and perform key metabolic functions by mediating the transfer of electrons in biological oxidation-reduction reaction .

HY-100442S1

Paquinimod-d5-1
Paquinimod-d5-1 is a deuterated analog of Paquinimod (HY-100442). Paquinimod (ABR 215757) is a specific and orally active inhibitor of S100A8/S100A9. Paquinimod rescues the pneumonia with substantial reduction of viral loads in SARS-CoV-2-infected mice .

HY-W016099S

3-Methyl-2-quinoxalinecarboxylic acid-d4
3-Methyl-2-quinoxalinecarboxylic acid-d₄ is the deuterium labeled 3-Methyl-2-quinoxalinecarboxylic acid. 3-Methyl-2-quinoxalinecarboxylic acid (MQCA), an important N-oxide reductive metabolite of Quinocetone or Olaquindox, potently inhibits the growth of Chang liver cells through S phase arrest of the cell cycle[1].

HY-107322S

Barnidipine-d5 hydrochloride

Barnidipine-d₅ (hydrochloride) is the deuterium labeled Barnidipine hydrochloride. Barnidipine hydrochloride (Mepirodipine hydrochloride) is an L-type calcium antagonist (CaA) with high affinity for [3H] initrendipine binding sites (Ki=0.21 nmol/l), has selective action against CaA receptors[1].Barnidipine hydrochloride (Mepirodipine hydrochloride) is an antihypertensive agent and acts by the reduction of peripheral vascular resistance secondary to its vasodilatory action[2].

HY-B1901S

Eperisone-d10 hydrochloride

Eperisone-d₁₀ (hydrochloride) is the deuterium labeled Eperisone hydrochloride. Eperisone Hydrochloride ((±)-Eperisone hydrochloride) is an antispastic agent used for treatment of diseases characterized by muscle stiffness and pain. It works by relaxing both skeletal muscles and vascularsmooth muscles, thus demonstrating avariety of effects such as reduction ofmyotonia, improvement of circulationand suppression of the pain reflex. Eperisone Hydrochloride ((±)-Eperisone hydrochloride) is a centrally acting muscle relaxant inhibiting the pain reflex pathway, having a vasodilator effect[1][2 [3].

HY-107322AS1

Barnidipine-d5

Barnidipine-d₅ is the deuterium-labeled Barnidipine (HY-107322A). Barnidipine-d₅ (Mepirodipine) is an L-type calcium antagonist (CaA) with high affinity for [ ³H] initrendipine binding sites (K_i=0.21 nmol/l), has selective action against CaA receptors . Barnidipine-d₅ (Mepirodipine) is an antihypertensive agent and acts by the reduction of peripheral vascular resistance secondary to its vasodilatory action .

HY-147338S

5-Methylcytidine 5′-triphosphate-d3 trisodium

5-Methylcytidine 5′-triphosphate-d₃ trisodium is the deuterium labeled 5-Methylcytidine 5’-triphosphate trisodium (HY-147338A). 5-Methylcytidine 5′-triphosphate (5-Methyl-CTP) trisodium is a modified nucleoside triphosphate. 5-Methylcytidine 5′-triphosphate trisodium can apply in replacing unmodified mRNA, resulting in the increase of translational properties and stability, as well as the reduction of innate immune responses in human and other mammalian cells .

HY-W011500S

TCEP-d16 hydrochloride

1 Publications Verification

TCEP-d₁₆ (hydrochloride) is the deuterium labeled TCEP hydrochloride[1]. TCEP hydrochloride (Tris(2-carboxyethyl)phosphine hydrochloride) is a non-thiol reducing agent that is more stable and produces a faster S-S reductive reaction than other chemical reductants. TCEP hydrochloride is a trialkylphosphine, selectively reduces protein disuldes without altering the properties or interacting with thiol-directed agents in the reaction mixture. TCEP hydrochloride is also a commonly used reducing agent in the DNA/AuNP chemistry[2][3][4][5].

HY-23155S

2-Phenylethyl isothiocyanate-d5

2-Phenylethyl isothiocyanate-d₅ isothiocyanate-d₅ is the deuterium labeled 2-Phenylethyl isothiocyanate[1]. 2-Phenylethyl isothiocyanate is a potent antifungal agent. 2-Phenylethyl isothiocyanate significantly inhibited spore germination and mycelial growth of Alternaria alternata, with a MIC (minimum inhibitory concentration) of 1.22 mM. The antifungal effect of 2-Phenylethyl isothiocyanate against Alternaria alternata might be via reduction in toxin content and breakdown of cell membrane integrity[2][3].

HY-147338S2

5-Methylcytidine 5′-triphosphate-d8 trisodium

5-Methylcytidine 5'-triphosphate-d₈ trisodium is the deuterium-labeled form of 5-Methylcytidine 5'-triphosphate trisodium (HY-147338A). 5-Methylcytidine 5'-triphosphate (5-Methyl-CTP) trisodium is a modified nucleoside triphosphate. 5-Methylcytidine 5'-triphosphate trisodium can be used to replace unmodified mRNA, resulting in the increase of translational properties and stability, as well as the reduction of innate immune responses in human and other mammalian cells .

HY-W700621

TCEP-d12 hydrochloride

TCEP-d₁₂ (hydrochloride) (Tris(2-?carboxyethyl)?phosphine hydrochloride-d₁₂) is deuterium labeled TCEP (hydrochloride). TCEP hydrochloride (Tris(2-carboxyethyl)phosphine hydrochloride) is a non-thiol reducing agent that is more stable and produces a faster S-S reductive reaction than other chemical reductants. TCEP hydrochloride is a trialkylphosphine, selectively reduces protein disuldes without altering the properties or interacting with thiol-directed agents in the reaction mixture. TCEP hydrochloride is also a commonly used reducing agent in the DNA/AuNP chemistry .

HY-155227S

ALK/EGFR-IN-1-d5

ALK/EGFR-IN-1-d5 (Compound (-)-9a) is a deuterated dual-target inhibitor of EGFR and ALK, with an IC₅₀ of 1.08 nM for EGFR and an IC₅₀ of 2.395 nM for ALK. ALK/EGFR-IN-1-d5 inhibits the phosphorylated proteins in the EGFR, ALK, and BRK signaling pathways, blocking the cell cycle, leading to a reduction in mitochondrial membrane potential and cell apoptosis (Apoptosis). ALK/EGFR-IN-1-d5 also significantly inhibits tumor growth in animal models and demonstrates good safety. ALK/EGFR-IN-1-d5 holds promise for research in the field of cancer treatment

Cat. No.	Product Name		Classification

HY-129737

A-62198		Azide
A-62198 is a potent and selective renin inhibitor with antihypertensive activity. A-62198 reduces mean arterial pressure (MAP) in anesthetized, salt-deprived monkeys in a dose-dependent manner. A-62198 induced MAP reduction in normal monkeys that reached statistical significance at the highest dose and significantly inhibited plasma renin activity (PRA) at all doses .

Cat. No.	Product Name		Classification

HY-W011142

2'-Deoxyuridine 5'-monophosphate disodium dUMP disodium		Nucleotides and their Analogs
2'-Deoxyuridine 5'-monophosphate (dUMP) disodium is a deoxynucleotide that is reductively methylated to dTMP (2'-deoxythymidine 5'-monophosphate) by bisubstrate enzyme thymidylate synthase (TS). dTMP is a nucleotide required for DNA synthesis .

HY-147217A

Bepirovirsen sodium ISIS 505358 sodium		Antisense Oligonucleotides
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-139306

BAMEA-O16B		Cationic Lipids
BAMEAO16B is a lipid nanoparticle. BAMEAO16B integrated with disulfide bonds, can efficiently deliver Cas9 mRNA and sgRNA into cells while releasing RNA in response to the reductive intracellular environment for genome editing. BAMEAO16B can be used for the research of gene editing .

HY-148130A

Rugonersen sodium RG6091 sodium; RO7248824 sodium		Antisense Oligonucleotides
Rugonersen sodium is a locked-nucleic acid (LNA)- modified antisense oligonucleotides (ASOs), and results in reduction of ubiquitin-protein ligase E3A (UBE3A) silencing. Angelman syndrome (AS) sodium is a severe neurodevelopmental disorder caused by the loss of neuronal E3 ligase UBE3A, Rugonersen has been used for AS reasearch .

HY-Y1365

Gelatins		Emulsifiers Disintegrants
Gelatins is a non-toxic, non carcinogenic, biodegradable, and non irritating natural polymer derived from partial hydrolysis of collagen. Due to its strong liquid absorption and swelling ability, Gelatins has excellent hemostatic properties and can be used as a matrix material for the reduction, growth, and stability of metal nanoparticles. Gelatins can also be used for tumor cell culture and tumor therapy ^[1][2][3].

HY-147217

Bepirovirsen ISIS 505358		Antisense Oligonucleotides
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-148130

Rugonersen RG6091; RO7248824		Antisense Oligonucleotides
Rugonersen (RG6091; RO7248824) is a locked-nucleic acid (LNA)- modified antisense oligonucleotides (ASOs), and results in reduction of ubiquitin-protein ligase E3A (UBE3A) silencing. Angelman syndrome (AS) is a severe neurodevelopmental disorder caused by the loss of neuronal E3 ligase UBE3A, Rugonersen has been used for AS reasearch .

Inquiry Online

Your information is safe with us. * Required Fields.

MCE Japan Authorized Agent ナミキ商事株式会社コスモ・バイオ株式会社
Salutation			Country or Region *
Applicant Name *			Organization Name *
Department *
Email Address *			Product Name *
Cat. No.			Requested quantity *
Phone Number *
Remarks

fumarate reduction

Inhibitors & Agonists

Screening Libraries

Fluorescent Dye

Biochemical Assay Reagents

Peptides

Inhibitory Antibodies

NaturalProducts

Isotope-Labeled Compounds

Click Chemistry

Oligonucleotides

Natural
Products