Search Result

Results for "

Alzheimers diseases

" in MedChemExpress (MCE) Product Catalog:

By Targets:	11β-HSD (2) 5-HT Receptor (21) AAK1 (1) Acyltransferase (3) Adenosine Receptor (1) Adrenergic Receptor (9) Akt (6) Amino Acid Derivatives (6) Amino acid Transporter (1) AMPK (7) Amyloid-β (177) Androgen Receptor (1) Angiotensin-converting Enzyme (ACE) (1) Antibiotic (5) Apolipoprotein (1) Apoptosis (37) Arginase (1) ATP Citrate Lyase (1) ATP Synthase (1) Autophagy (14) Bacterial (15) Bcr-Abl (1) Beta-lactamase (1) Beta-secretase (39) Biochemical Assay Reagents (6) c-Fms (3) c-Met/HGFR (1) Calcium Channel (4) Calmodulin (1) CaMK (2) Cannabinoid Receptor (4) Carbonic Anhydrase (5) Casein Kinase (18) Caspase (4) Cathepsin (2) CCR (1) CDK (8) Cholecystokinin Receptor (1) Cholinesterase (ChE) (226) Collagen (1) COX (4) Cyclophilin (1) Cytochrome P450 (1) DAPK (1) DNA/RNA Synthesis (2) Dopamine Receptor (6) Dopamine Transporter (3) Drug Derivative (1) Drug Intermediate (3) Drug Isomer (2) Drug Metabolite (2) Dynamin (1) DYRK (5) E1/E2/E3 Enzyme (2) EAAT (1) EGFR (3) Endogenous Metabolite (54) ERK (3) FAAH (1) Farnesyl Transferase (1) Fat Mass and Obesity-associated Protein (FTO) (1) Ferroptosis (1) FKBP (2) Fluorescent Dye (5) Free Fatty Acid Receptor (1) Fungal (2) GABA Receptor (1) Glucocorticoid Receptor (2) Glycosidase (1) GlyT (2) GnRH Receptor (2) GPR55 (2) GPR84 (1) GSK-3 (31) HBV (1) HDAC (15) HIF/HIF Prolyl-Hydroxylase (1) Histamine Receptor (11) Histone Acetyltransferase (2) Histone Methyltransferase (2) HIV (1) HSP (1) HSV (1) IFNAR (1) IGF-1R (1) iGluR (20) Imidazoline Receptor (2) Insulin Receptor (1) Interleukin Related (9) Isotope-Labeled Compounds (23) JNK (6) Keap1-Nrf2 (15) KMO (1) Lipoxygenase (3) LPL Receptor (2) LRRK2 (1) mAChR (18) MAGL (1) MAP3K (2) MARCKS (2) MARK (1) mGluR (4) MicroRNA (1) Microtubule/Tubulin (5) Mitochondrial Metabolism (7) MMP (4) Molecular Glues (1) Monoamine Oxidase (48) mTOR (3) nAChR (22) Neurokinin Receptor (1) Neuropeptide S Receptor (2) Neuropeptide Y Receptor (3) Neurotensin Receptor (1) NF-κB (10) NO Synthase (6) NOD-like Receptor (NLR) (8) Notch (2) Nuclear Factor of activated T Cells (NFAT) (1) Nuclear Hormone Receptor 4A/NR4A (1) OGA (4) Orexin Receptor (OX Receptor) (1) Oxidative Phosphorylation (2) P-glycoprotein (5) P2Y Receptor (1) p38 MAPK (4) p62 (2) PAI-1 (1) Parasite (2) PERK (1) Phosphatase (4) Phosphodiesterase (PDE) (11) Phospholipase (10) PI3K (3) Pim (1) PKA (1) PKC (2) Potassium Channel (3) PPAR (6) Prion Protein (1) Prolyl Endopeptidase (PREP) (2) Prostaglandin Receptor (2) PROTACs (3) Proteasome (4) Pyroptosis (2) Radionuclide-Drug Conjugates (RDCs) (1) RAR/RXR (7) Ras (1) Reactive Oxygen Species (11) REV-ERB (1) RIP kinase (1) ROS Kinase (1) SARS-CoV (2) Ser/Thr Protease (6) Serotonin Transporter (1) Sigma Receptor (7) Sirtuin (8) Sodium Channel (1) Somatostatin Receptor (3) STAT (3) Tau Protein (37) Telomerase (1) TGF-β Receptor (3) Thrombopoietin Receptor (3) Thymidylate Synthase (2) TNF Receptor (5) Toll-like Receptor (TLR) (1) Topoisomerase (1) Transmembrane Glycoprotein (2) Transthyretin (TTR) (1) Trk Receptor (2) TRP Channel (2) Tyrosinase (1) VEGFR (2) Virus Protease (2) Wnt (3) α-synuclein (7) β-catenin (4) γ-secretase (32)
By Research Areas:	Cancer (96) Cardiovascular Disease (29) Endocrinology (17) Infection (26) Inflammation/Immunology (86) Metabolic Disease (56) Neurological Disease (872)
Click Chemistry:	Azide (1) Alkynes (6)
Oligonucleotides:	Nucleosides and their Analogs (1) Antisense Oligonucleotides (2) Cholesterol (1)

929

Inhibitors & Agonists

Screening Libraries

Fluorescent Dye

Biochemical Assay Reagents

104

Peptides

Inhibitory Antibodies

126

Natural
Products

Isotope-Labeled Compounds

Click Chemistry

Oligonucleotides

Cat. No.	Product Name	Target	Research Areas	Chemical Structure

HY-13410

Xanomeline oxalate 1 Publications Verification LY246708 oxalate	mAChR	Neurological Disease
Xanomeline oxalate (LY246708 oxalate) is a potent and selective muscarinic receptor agonist (SMRA) and stimulates phosphoinositide hydrolysis in vivo. Xanomeline oxalate can be used for the research of Alzheimer’s disease .

HY-117259

Valiltramiprosate 1 Publications Verification ALZ-801	Amyloid-β	Neurological Disease
ALZ-801 is a potent and orally available small-molecule β-amyloid (Aβ) anti-oligomer and aggregation inhibitor, valine-conjugated proagent of Tramiprosate with substantially improved PK properties and gastrointestinal tolerability compared with the parent compound . ALZ-801 is an advanced and markedly improved candidate for the treatment of alzheimer’s disease .

HY-138935

Iclepertin 1 Publications Verification BI-425809	GlyT	Neurological Disease
Iclepertin (BI-425809) is a potent, selective and orally active glycine transporter 1 (GlyT1) inhibitor. Iclepertin is inactive against GlyT2. Iclepertin can be used for Alzheimer disease and schizophrenia research .

HY-132582C

IONIS-MAPTRx sodium BIIB080 sodium; ISIS 814907 sodium	Tau Protein	Neurological Disease
IONIS-MAPTRx sodium is the first Tau-lowering antisense oligonucleotide (ASO). IONIS-MAPTRx sodium has the potential for the research of Alzheimer Disease .

HY-P1060

LPYFD-NH2	Amyloid-β	Neurological Disease
LPYFD-NH2, a pentapeptide, exerts some inhibitory effect on the aggregation of Aβ(1-42). LPYFD-NH2 can be used for the research of Alzheimer’s disease .

HY-P1060A

LPYFD-NH2 TFA	Amyloid-β	Neurological Disease
LPYFD-NH2 TFA, a pentapeptide, exerts some inhibitory effect on the aggregation of Aβ(1-42). LPYFD-NH2 TFA can be used for the research of Alzheimer’s disease .

HY-P1362A

β-Amyloid (42-1), human TFA Amyloid β Peptide (42-1)(human) TFA	Amyloid-β	Neurological Disease
β-Amyloid (42-1), human TFA is the inactive form of Amyloid β Peptide (1-42). β-Amyloid (42-1), human TFA is a 42-amino acid peptide which plays a key role in the pathogenesis of Alzheimer disease .

HY-106933A

Dabelotine methanesulfonate S 12024-2	Adrenergic Receptor	Neurological Disease
Dabelotine (methanesulfonate) is a cognitive enhancer. Dabelotine (methanesulfonate) can be used for Alzheimer disease (AD) research .

HY-158765

Leuco ethyl violet	Biochemical Assay Reagents	Neurological Disease
Leuco ethyl violet is a photooxidation catalyst for amyloid selectivity and blood-brain barrier (BBB) permeability. Leuco ethyl violet can be used in the study of Alzheimer's disease (AD) .

HY-144762

K027	Cholinesterase (ChE)	Neurological Disease
K027 is a potent reactivator of Organophosphates (OP)-inhibited acetylcholinesterase (AChE). K027 can be used for the research of Alzheimer's disease .

HY-132582

IONIS-MAPTRx BIIB080; ISIS 814907	Tau Protein	Neurological Disease
IONIS-MAPTRx (BIIB080) is the first Tau-lowering antisense oligonucleotide (ASO). IONIS-MAPTRx has the potential for the research of Alzheimer Disease .

HY-P1051

β-Amyloid (12-28) Amyloid β-Protein (12-28)	Amyloid-β	Neurological Disease
β-Amyloid (12-28) (Amyloid β-Protein (12-28)) is a peptide fragment of β-amyloid protein (β1-42). β1-42, a 42 amino acid protein , is the major component of senile plaque cores. β-Amyloid (12-28) shows aggregation properties. β-Amyloid (12-28) has the potential for Alzheimer’s disease research .

HY-P1051A

β-Amyloid (12-28) (TFA) Amyloid β-Protein (12-28) (TFA); Amyloid Beta-Peptide (12-28) (human) TFA; β-Amyloid protein fragment(12-28) TFA	Amyloid-β	Neurological Disease
β-Amyloid (12-28) (TFA) (Amyloid β-Protein (12-28) (TFA)) is a peptide fragment of β-amyloid protein (β1-42). β1-42, a 42 amino acid protein , is the major component of senile plaque cores. β-Amyloid (12-28) (TFA) shows aggregation properties. β-Amyloid (12-28) (TFA) has the potential for Alzheimer’s disease research .

HY-Y0399

L-Norvaline Norvaline	Amyloid-β TNF Receptor Arginase	Neurological Disease Metabolic Disease
L-Norvaline is the inhibitor for arginase, that promotes the production of NO, reduces oxidative stress, improves insulin resistance, and exhibits antioxidant and anti-hyperglycemic effects. L-Norvaline can be used in research of Alzheimer’s disease .

HY-111263

NIAD-4	Amyloid-β	Neurological Disease
NIAD-4 is a fluorophore for optical imaging of amyloid-β (Aβ) in the central nervous system (CNS) for Alzheimer’s disease (AD). NIAD-4 binds to the same Aβ site with the binding affinity (K_i) of 10 nM .

HY-145712

ElteN378	FKBP	Cancer
ElteN378 is an inhibitors of FKBP12e. ElteN378 can be used in study Alzheimer disease, Parkinson disease, Amyotrophic Lateral Sclerosis, proliferation disorders and cancer .

HY-P10534

ccβ	Prion Protein	Infection Neurological Disease
CCβ is a simple 17-amino acid peptide designed in research. CCβ is able to mimic the conformational transition of proteins from α-helix to β-sheet, which is a key step in the aggregation of proteins associated with many diseases, such as Alzheimer's disease and prion disease. CCβ can be used to study diseases related to protein aggregation .

HY-109052

Atabecestat JNJ-54861911	Beta-secretase	Neurological Disease
Atabecestat (JNJ-54861911) is a potent brain-penetrant and orally active β-site amyloid precursor protein cleaving enzyme 1 (BACE1) inhibitor, achieves robust and high CSF Aβ reduction. Atabecestat s tolerated and displays a sustained pharmacokinetic (PK) and pharmacodynamic (PD) characteristics. Atabecestat has the potential for Alzheimer's Disease treatment .

HY-P1061

Colivelin Maximum Cited Publications 52 Publications Verification	STAT Amyloid-β	Neurological Disease
Colivelin is a brain penetrant neuroprotective peptide and a potent activator of STAT3, suppresses neuronal death by activating STAT3?in vitro . Colivelin exhibits long-term beneficial effects against neurotoxicity, Aβ deposition, neuronal apoptosis, and synaptic plasticity deficits in neurodegenerative disease . Colivelin has the potential for the treatment of alzheimer's disease and ischemic brain injury

HY-P1061A

Colivelin TFA Maximum Cited Publications 52 Publications Verification	STAT Amyloid-β Apoptosis	Neurological Disease
Colivelin TFA is a brain penetrant neuroprotective peptide and a potent activator of STAT3, suppresses neuronal death by activating STAT3?in vitro . Colivelin TFA exhibits long-term beneficial effects against neurotoxicity, Aβ deposition, neuronal apoptosis, and synaptic plasticity deficits in neurodegenerative disease . Colivelin TFA has the potential for the treatment of alzheimer's disease and ischemic brain injury .

HY-10096

TCS2002	GSK-3	Neurological Disease
TCS2002 (Compound 9b) is a highly selective, orally bioavailable and potent GSK-3β inhibitor with the IC₅₀ of 35 nM. TCS2002 shows good pharmacokinetic profiles including favorable BBB penetration. TCS2002 can be used for the research of Alzheimer’s disease .

HY-100723

THK-523	Amyloid-β	Neurological Disease
THK-523 has demonstrated its high affinity and selectivity for tau pathology both in vitro and in vivo. ¹⁸F-THK523 is a potent tau imaging radiotracer.? ¹⁸F-THK523 is a potent in vivo tau imaging ligand for Alzheimer's disease .

HY-151152

AChE-IN-24	Cholinesterase (ChE)	Neurological Disease
AChE-IN-24 is a potent AChE inhibitor and can penetrate the BBB. AChE-IN-24 has the mighty inhibitory activity to hAChE with an IC₅₀ value of 0.053 μM. AChE-IN-24 can be used for the research of Alzheimer s disease (AD) .

HY-13779

(E/Z)-J147	Monoamine Oxidase Dopamine Transporter	Neurological Disease
(E/Z)-J147 is an exceptionally potent, orally active, neuroprotective agent for cognitive enhancement. (E/Z)-J147 can readily pass the blood brain barrier (BBB). (E/Z)-J147 can inhibit monoamine oxidase B (MAO B) and the dopamine transporter with EC₅₀ values of 1.88 μM and 0.649 μM, respectively. (E/Z)-J147 has potential for the treatment of Alzheimer’s disease (AD) .

HY-P1047

β-Sheet Breaker Peptide iAβ5 [Pro18, Asp21] β-Amyloid (17-21)	Amyloid-β	Neurological Disease
β-Sheet Breaker Peptide iAβ5 is an effective brain amyloid-β (Abeta) degrader. Abeta deposits are associated with Alzheimer's disease (AD), and the related toxicity arises from its β-sheet conformation and aggregation. β-Sheet Breaker Peptide iAβ5 can repeatedly induce the degradation of fibrillary amyloid deposits in vivo. Therefore, β-Sheet Breaker Peptide iAβ5 can prevent and/or reverse neuronal contraction caused by Abeta and reduce the range of interleukin IL-1beta positive microglial-like cells around Abeta deposits. β-Sheet Breaker Peptide iAβ5 can reduce the size and/or number of brain amyloid plaques in AD. β-Sheet Breaker Peptide iAβ5 is labeled with a hydrophobic benzyl alcohol (HBA) tag and shows a bright blue color under acidic conditions, which can be used for quantitative determination.

HY-117924

AUTEN-67 Autophagy enhancer-67	Autophagy	Neurological Disease
AUTEN-67 (Autophagy enhancer-67) is an orally active autophagy enhancer and MTMR14 inhibitor. AUTEN-67 has anti-aging and neuroprotective effects. AUTEN-67 protects neurons from stress-induced cell death. AUTEN-67 also restores nesting behavior in a mice model of Alzheimer disease .

HY-117983

RU-505	Amyloid-β	Neurological Disease
RU-505 is an effective β-amyloid (Aβ)-fibrinogen interaction inhibitor with IC₅₀s of 5.00 and 2.72 μM in fluorescence polarization (FP) and AlphaLISA assays, respectively. RU-505 is highly permeable to the BBB. RU-505 reduces cerebral amyloid angiopathy (CAA). RU-505 can be used for the research of Alzheimer’s disease (AD) .

HY-122487

Troriluzole BHV-4157	mGluR	Neurological Disease Cancer
Troriluzole, a third-generation, tripeptide proagent of Riluzole (HY-B0211), is an orally active glutamate modulator. Troriluzole reduces synaptic glutamate level and increases the synaptic glutamate absorption. Troriluzole has the potential for Alzheimer disease and generalized anxiety disorder (GAD) .

HY-144389

hAChE/Aβ1-42-IN-1	Cholinesterase (ChE) Amyloid-β	Neurological Disease
hAChE/Aβ1-42-IN-1 (Compound 16) is a potent inhibitor of hAChE and Aβ1-42 aggregation. hAChE/Aβ1-42-IN-1 shows acceptable relative safety upon hepG2 cell line and excellent BBB penetration with wide safety margin. hAChE/Aβ1-42-IN-1 has the potential for the research of Alzheimer disease (AD) .

HY-147011

FTO-IN-7	Fat Mass and Obesity-associated Protein (FTO)	Cancer
FTO-IN-7 is an inhibitor of FTO. FTO-IN-7 can be used in study Alzheimer's diseases, breast cancers, small-cell lung cancers,a human bone marrow striated muscle cancer, a pancreatic cancer, malignant glioblastoma .

HY-N13380

6′‐O‐Galloylsalidroside	Others	Cardiovascular Disease Neurological Disease Metabolic Disease
6’-O-Galloylsalidroside is an active component of Rhodiola. 6’-O-Galloylsalidroside is promising for research of Alzheimer’s disease, lung diseases, cerebrovascular disease, diabetes, cardiovascular disease and aging-related diseases .

HY-B2065

Scopolamine hydrochloride (-)-Scopolamine hydrochloride; Hyoscine hydrochloride	mAChR 5-HT Receptor	Neurological Disease
Scopolamine hydrochloride is a non-selective and high affinity (≤1 nM) muscarinic antagonist that is used for the prevention of post-operative nausea and vomiting. Scopolamine readily passes the blood brain barrier. Scopolamine also reversibly inhibits 5-HT3 receptor-responses with an IC₅₀ of 2.09 μM . Scopolamine induces Alzheimer's disease-like pathology through alteration of cholinergic system .

HY-114616

PBB3	Tau Protein Fluorescent Dye	Neurological Disease
PBB3 is a tracer of tau PET. PBB3 can be used to detect levels of tau protein in Alzheimer's disease and non-Alzheimer's disease .

HY-W015229

3-Indolepropionic acid 2 Publications Verification Indole-3-propionic acid; 3-IPA	Endogenous Metabolite Reactive Oxygen Species	Neurological Disease Metabolic Disease
3-Indolepropionic acid is shown to be a powerful antioxidant and has potential in the treatment for Alzheimer’s disease.

HY-101710

Benzgalantamine GLN-1062	Drug Derivative	Neurological Disease
Benzgalantamine (GLN-1062) is a pro-agent of galantamine, used for the treatment for Alzheimer’s disease.

HY-115726

FRM-024	γ-secretase	Neurological Disease
FRM-024 is a potent CNS-penetrant gamma secretase modulator for familial Alzheimer’s disease.

HY-119632

Anisopirol R-2159	Cholinesterase (ChE)	Others
Anisopirol (R-2159) is a compound associated with Alzheimer's disease. Computer simulation studies have found that it may have potential effects on multiple protein targets related to Alzheimer's disease.

HY-N8414

Dehydrogeijerin	Cholinesterase (ChE)	Neurological Disease
Dehydrogeijerin is an inhibitor of acetylcholinesterase with an IC₅₀ of 9.7 μM. Dehydrogeijerin can be used in study Alzheimer’s disease .

HY-W839261

Tyrosine kinase-IN-9	Bcr-Abl	Neurological Disease
Tyrosine kinase-IN-9 (Compound B) is the inhibitor for c-Abl. Tyrosine kinase-IN-9 can be used in research of neurodegenerative diseases including Alzheimer’s and Parkinson’s disease .

HY-16361A

Omigapil maleate CGP3466B; CGP3446 maleate; TCH346 maleate	Apoptosis	Neurological Disease Metabolic Disease
Omigapil maleate, an orally bioavailable GAPDH nitrosylation inhibitor, abrogates Aβ_1-42-induced tau acetylation, memory impairment, and locomotor dysfunction in mice. Omigapil maleate has the potential for the research of Alzheimer's disease . Omigapil maleate (CGP3446B maleate) is a apoptosis inhibitor. Omigapil maleate can be used for the research of congenital muscular dystrophy (CMD) . Omigapil (maleate) is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.

HY-P99185

Bapineuzumab	Amyloid-β	Neurological Disease
Bapineuzumab is an anti-β-amyloid protein (APP) monoclonal antibody. Bapineuzumab can be used for the research of Alzheimer’s disease (AD) .

HY-159173

AChE-IN-71	Cholinesterase (ChE)	Neurological Disease
AChE-IN-71 (compound 12A) is a AChE inhibitor. AChE-IN-71 can be used in the study of Alzheimer’s disease .

HY-163885

SSZ	Cholinesterase (ChE) Beta-secretase γ-secretase	Neurological Disease
SSZ is a multi-target inhibitor, which targets multiple pathological mechanisms of Alzheimer's disease (AD). SSZ targets acetylcholinesterase, butyrylcholinesterase, β-site amyloid precursor protein cleavage enzyme 1 (BACE1), and γ-secretase. SSZ ameliorates Alzheimer’s diseases and exhibits neuroprotective effect in mice .

HY-P2978

Alpha 1 Antichymotrypsin, Human Plasma	Ser/Thr Protease	Neurological Disease
Alpha 1 Antichymotrypsin, Human Plasma is a serine protease inhibitor. Alpha 1 Antichymotrypsin, Human Plasma appears in the amyloid lesions of Alzheimer's disease. Alpha 1 Antichymotrypsin, Human Plasma can be used in Alzheimer's disease research .

HY-168622

AChE-IN-79	Cholinesterase (ChE)	Neurological Disease
AChE-IN-79 (compound 3i) is a AChE inhibitor with the IC₅₀ of 2.7 µM and can be used for study of Alzheimer’s disease .

HY-W020576

Rivastigmine metabolite NAP 226-90	Cholinesterase (ChE)	Neurological Disease
Rivastigmine metabolite (NAP 226-90) is an acetylcholinesterase (AChE) inhibitor which is produced in kidney. Rivastigmine metabolite is promising for research of Alzheimer’s Disease .

HY-163861

Tl45b	Cholinesterase (ChE)	Neurological Disease
Tl45b is an AChE inhibitor, with an IC₅₀ of 0.71 μM. Tl45b can be used for the research of Alzheimer’s disease .

HY-P4704

α-Synuclein (61-95) (human)	α-synuclein	Neurological Disease
α-Synuclein (61-95) (human) is the hydrophobic core region of α-synuclein, and induces neuronal cell death. α-Synuclein (61-95) (human) can be used for research of neurodegenerative diseases, including Alzheimer’s disease (AD) and Parkinson’s disease (PD) .

HY-146068

AEP-IN-1	Cathepsin	Neurological Disease
AEP-IN-1 (Compound 13e) is a CNS agent-like non-covalent inhibitor of asparagine endopeptidase (AEP), with the IC₅₀ of 89 nM. AEP-IN-1 can be used for the research of numerous neurological diseases such as Alzheimer’s disease (AD) .

HY-172143

ATUX-8385	Phosphatase	Neurological Disease Cancer
ATUX-8385 is a potent PP2A activator. ATUX-8385 binds to PR65 subunit. ATUX-8385 has the potential for the research of cancers and chronic conditions such as Alzheimer’s disease and chronic obstructive pulmonary disease .

Cat. No.	Product Name

HY-L069

Anti-Alzheimer's Disease Compound Library

1,628 compounds

Alzheimer’s Disease (AD) is a progressive degenerative brain disease which causes mental and physical decline, gradually resulting in death. Despite the significant public health issue that it poses, only few medical treatments have been approved for Alzheimer’s Disease (AD) and these act to control symptoms rather than alter the course of the disease. Discovery of new therapeutic approaches depends on the study of pathology of AD. Recent research findings have led to greater understanding of disease neurobiology in Alzheimer's Disease (AD) and identification of unique targets for drug development. Several important mechanisms have been proposed to explain the underlying pathology of AD, such as Amyloid cascade hypothesis, Tau hypothesis and Cholinergic hypothesis, etc.

MCE offers a unique collection of 1,628 compounds with anti-Alzheimer’s Disease activities or targeting the unique targets of AD. MCE Anti-Alzheimer’s Disease Compound Library is a useful tool for exploring the mechanism of AD and discovering new drugs for AD.

HY-L028

CNS-Penetrant Compound Library

927 compounds

The blood-brain barrier (BBB) is the complex network of brain microvessels. It protects the brain from the external bloodstream environment and supplies the brain with the required nutrients for normal function. However, blood-brain barrier is also the obstacle to deliver beneﬁcial drugs to treat CNS (central nervous system) diseases or brain tumors, as it has the least permeable capillaries in the entire body due to physical barriers (tight junctions). Therefore, it is crucial to discover drugs which can cross this barrier for the treatment of brain-based diseases, such as Alzheimer’s disease (AD), Parkinson’s disease (PD) and epilepsy.

MCE offers a unique collection of 927 compounds with confirmed CNS-Penetrant property. It’s a useful tool for the discovery of drugs used for brain diseases, such as brain tumors, mental disorders, and neurodegenerative diseases.

HY-L086

Neurodegenerative Disease-related Compound Library

2,733 compounds

Neurodegenerative diseases are incurable and life-threatening conditions that result in progressive degeneration and/or death of nerve cells. Some common neurodegenerative diseases include Alzheimer’s Disease (AD), Parkinson’s Disease (PD), Motor Neuron Disease (MND), Huntington’s Disease (HD), Spino-Cerebellar Ataxia (SCA), Spinal Muscular Atrophy (SMA), and Amyotrophic Lateral Sclerosis (ALS). Because the pathophysiology of neurodegenerative disorders is generally poorly understood, it is difficult to identify promising molecular targets and validate them. At the same time, about 85% of the drugs fail in clinical trials. Therefore, validating new targets and discovering new drugs to mitigate neurodegenerative disorders is need of the hour.

MCE offers a unique collection of 2,733 compounds with anti-Neurodegenerative Diseases activities or targeting the unique targets of neurodegenerative diseases. MCE Neurodegenerative Disease-related Compound Library is a useful tool for exploring the mechanism of neurodegenerative diseases and discovering new drugs for neurodegenerative diseases.

HY-L070

Neuroprotective Compound Library

1,287 compounds

Neurodegenerative diseases are characterised by progressive dysfunction and death of neurons, such as Alzheimer’s disease, Parkinson’s disease, and multiple sclerosis (MS). Neuroprotection is an approach to preserve neurons so that neurons cannot be hurt by different pathological factors in neurodegenerative diseases. Neuroprotectors are some agonists and antagonists targeting some key targets in neuroprotactive signal pathways, such as calcium and sodium channel blockers, GABA receptor agonists, NMDA receptor Antagonists, etc. Current neuroprotectors cannot reverse existing damage, but they may protect against further nerve damage and slow down any degeneration of the central nervous system (CNS) and still play important roles in the treatment of neurodegenerative diseases.

MCE offers a unique collection of 1,287 compounds with potential neuroprotective activities. These compounds mainly act on some key targets in neuroprotetive signal pathways, such as calcium channel, sodium channel, adenosine A1 receptor, etc. MCE Neuroprotective Compopund Library is a useful tool in neuroprotective drug discovery.

HY-L134

Anti-Aging Natural Product Library

190 compounds

Aging is an unavoidable process, leading to cell senescence due to physiochemical changes in an organism. Aging cells cease to divide and drive the progression of illness through various pathways, resulting in the death of an organism ultimately. Anti-aging activities are primarily involved in the therapies of age-related disorders such as Parkinson's Disease (PD), Alzheimer's Disease (AD), cardiovascular diseases, cancer, and chronic obstructive pulmonary diseases.

Natural products are known as effective molecules in anti-aging treatments, which delay the aging process through influencing several pathways and thus ensure an extended lifespan. MCE offers a unique collection of 190 natural products with validated anti-aging activity. MCE anti-aging natural product library is a useful tool for the study of aging-related diseases drugs and pharmacology.

HY-L068

Flavonoids Library

521 compounds

Flavonoids are an important class of natural products; particularly, they belong to a class of plant secondary metabolites having a polyphenolic structure, widely found in fruits, vegetables and certain beverages. Flavonoids can be subdivided into different subgroups depending on the carbon of the C ring on which the B ring is attached and the degree of unsaturation and oxidation of the C ring. These subgroups are: flavones, flavonols, flavanones, flavanonols, flavanols or catechins, anthocyanins and chalcones. Flavonoids are now considered as an indispensable component in a variety of nutraceutical, pharmaceutical, medicinal and cosmetic applications. This is attributed to their anti-oxidative, anti-inflammatory, anti-mutagenic and anti-carcinogenic properties coupled with their capacity to modulate key cellular enzyme function. Naturally occurring flavonoids are known to have biological activities for use as drugs, for example, in diseases like cancer, Alzheimer’s disease (AD), atherosclerosis, etc.

MCE offers a unique collection of 521 natural flavonoid compounds which is a useful tool for drug discovery as an important source of lead compounds.

HY-L010

MAPK Compound Library

682 compounds

MAPK families play an important role in complex cellular programs like proliferation, differentiation, development, transformation, and apoptosis. In mammalian cells, four MAPK families have been clearly characterized: ERK1/2, C-Jun N-terminal kinse/stress-activated protein kinase (JNK/SAPK) , p38 kinase and ERK5. They respond to different signals. Each MAPK-related cascade consists of three enzymes that are activated in series: a MAPK kinase kinase (MAPKKK), a MAPK kinase (MAPKK) and a MAP kinase (MAPK). MAPK signaling pathways has been implicated in the development of many human diseases including Alzheimer's disease (AD), Parkinson's disease (PD), amyotrophic lateral sclerosis (ALS) and various types of cancers.

MCE designs a unique collection of 682 MAPK signaling pathway inhibitors that act as a useful tool for MAPK-related drug screening and disease research.

HY-L003

Apoptosis Compound Library

2,688 compounds

Apoptosis is an ordered and orchestrated cellular process that occurs in physiological and pathological conditions, which is also called programmed cell death (PCD). Apoptosis plays a crucial role in developing and maintaining the health of the body by eliminating old cells, unhealthy cells and unnecessary cells. Too little or too much apoptosis contribute to many diseases. When apoptosis does not work correctly, cells that should be eliminated may persist and become immortal, for example, in cancer and leukemia. When apoptosis works overly well, it kills too many cells and inflicts grave tissue damage. This is the case in strokes and neurodegenerative disorders such as Alzheimer's, Huntington's, and Parkinson's disease.

MCE designs a unique collection of 2,688 apoptosis-related compounds mainly focusing on the key targets in the apoptosis signaling pathway and can be used in the research of apoptosis signal pathway and related diseases.

HY-L013

Neuronal Signaling Compound Library

3,098 compounds

Neuronal Signaling is involved in the regulation of the mechanisms of the central nervous system (CNS) such as its structure, function, genetics and physiology as well as how this can be applied to understand diseases of the nervous system. Every information processing system in the CNS is composed of neurons and glia, neurons have evolved unique capabilities for intracellular signaling (communication within the cell) and intercellular signaling (communication between cells). G protein-coupled receptors (GPCRs), including 5-HT receptor, histamine receptor, opioid receptor, etc. are the largest class of sensory proteins and are important therapeutic targets in Neuronal Signaling. Besides, Notch signaling, such as β- and γ-secretase, also plays multiple roles in the development of the CNS including regulating neural stem cell (NSC) proliferation, survival, self-renewal and differentiation. GPCR dysfunction caused by receptor mutations and environmental challenges contributes to many neurological diseases. Notch signaling in neurons, glia, and NSCs is also involved in pathological changes that occur in disorders such as stroke, Alzheimer's disease and CNS tumors. Thus, targeting Neuronal Signaling, such as notch signaling and GPCRs, can be used as therapeutic interventions for several different CNS disorders.

MCE designs a unique collection of 3,098 Neuronal Signaling-related compounds that act as a useful tool for the research of neuronal regulation and neuronal diseases.

HY-L034

Anti-Aging Compound Library

5,395 compounds

Aging is a complex biological process characterized by functional decline of tissues and organs, structural degeneration, and reduced adaptability and resistance, all of which contribute to an increase in morbidity and mortality caused by multiple chronic diseases, such as Alzheimer's disease, cancer, and diabetes. Many theories, which fall into two main categories: programmed and error theories, have been proposed to explain the process of aging, but neither of them appears to be fully satisfactory. The programmed theories imply that aging relies on specific gene regulation, and the error theories emphasize the internal and environmental damages accumulated to living organisms. The damage theories proposed the nine hallmarks that were generally considered to contribute to the aging process: genomic instability, telomere attrition, epigenetic alterations, loss of proteostasis, deregulated nutrient-sensing, mitochondrial dysfunction, cellular senescence, stem cell exhaustion, and altered intercellular communication.

MCE Anti-Aging Compound Library contains 5,395 compounds, mainly targeting Sirtuin, mTOR, IGF-1R, AMPK, p53, Telomerase, Mitophagy, Mitochondrial Metabolism, COX, Cytochrome P450, Oxidase, etc. This library is a useful tool for anti-aging research.

Cat. No.	Product Name	Type

HY-111263

NIAD-4	Fluorescent Dyes/Probes
NIAD-4 is a fluorophore for optical imaging of amyloid-β (Aβ) in the central nervous system (CNS) for Alzheimer’s disease (AD). NIAD-4 binds to the same Aβ site with the binding affinity (K_i) of 10 nM .

HY-D1443

BSB (trans,trans)-1-Bromo-2,5-bis-(3-hydroxycarbonyl-4-hydroxy)styrylbenzene	Fluorescent Dyes/Probes
BSB is a Congo red-derived fluorescent probe. BSB binds not only to extracellular amyloid β protein, but also many intracellular lesions composed of abnormal tau and synuclein proteins. BSB acts as a prototype imaging agent for Alzheimer's disease .

HY-19948

Leucomethylene blue mesylate 5+ Cited Publications TRx0237 mesylate; Methylene blue leuco base mesylate	Chromogenic Assays
Leucomethylene blue (TRx0237) mesylate, an orally active second-generation tau protein aggregation inhibitor (K_i of 0.12 μM), could be used for the study of Alzheimer's Disease. Leucomethylene blue mesylate is a common reduced form of Methylene Blue, Methylene Blue is a member of the thiazine class of dyes .

HY-D2343

PB0822	Dyes
PB0822 can be used for in vivo PET imaging when labeled with [ ¹⁸F]fluoride. [ ¹⁸F]PB0822 is a PET radioligand. [ ¹⁸F]PB0822 has a cLogP value of 1.54, which is a good predictive index for BBB penetration. [ ¹⁸F]PB0822 can be used for Alzheimer’s Disease research .

Cat. No.	Product Name	Type

HY-21629

N-Boc-4-piperidinemethanol	Cell Assay Reagents
N-Boc-4-piperidinemethanol (compound 4) is an acetylcholinesterase (AChE) inhibitor. N-Boc-4-piperidinemethanol can used ti study Alzheimer’s Disease .

HY-W286743

Nε-(Carboxymethyl)-L-lysine

CML; N6-(Carboxymethyl)-L-lysine; Nε-(1-Carboxymethyl)-L-lysine

Biochemical Assay Reagents

Nε-(Carboxymethyl)-L-lysine (CML) is a unique post-translational modification (PTM) of proteins that is generated by the non-enzymatic glycation of lysine residues. Nε-(Carboxymethyl)-L-lysine is a relatively recently discovered modification, and has been found to be a major component of the advanced glycation endproducts (AGEs) found in multiple human diseases, such as diabetes, Alzheimer’s disease, and cancer .

HY-W010202

Dihydrolinalool

3,7-Dimethyloct-6-en-3-ol

Biochemical Assay Reagents

Dihydrolinalool, Dihydrolinalool is commonly used as a flavor ingredient in various products, including food, beverages, and perfumes, and it can also be used as a base material for the synthesis of various organic compounds, including pharmaceuticals and agrochemicals. In addition, due to Dihydrolinalool's low toxicity and Biodegradability, which has been studied for its potential use as a bio-based solvent, has also been studied for its potential antioxidant and anti-inflammatory properties, which may make it useful in the study of various diseases, including cancer and Alzheimer's disease. Alzheimer's disease.

HY-D0837

Imidazole

2 Publications Verification

Glyoxaline; 1,3-Diaza-2,4-cyclopentadiene

Cell Assay Reagents

Imidazole (Glyoxaline; 1,3-Diaza-2,4-cyclopentadiene) is a heterocyclic aromatic compound. Imidazole bearing molecules have been used as corrosion, acetylcholinesterase (AChEI) and xanthine oxidase (XO) inhibitors, performing biological activities such as antifungal, antituberculosis, anti-inflammatory, antioxidant, and analgesic, amongst many others. Imidazole inhibits the enzymatic conversion of the endoperoxides (PGG₂ and PGH₂) to thromboxane A2 by platelet microsomes. Imidazole derivatives exhibits inhibition on SARS-CoV-2 3CL ^Pro enzyme, which is promising for research in the field of Alzheimer’s disease, gout, COVID-19 and thrombo-embolic disease .

HY-15908

BCA 5 Publications Verification Disodium bicinchoninate	Biochemical Assay Reagents
BCA (Disodium bicinchoninate) is an orally active and non-competitive Beta-site amyloid precursor protein cleaving enzyme 1 (BACE1) inhibitor with an IC₅₀ value of 28 µM, a K_i value of 43 µM. BCA shows anticancer activity. BCA has the potential for the research of Alzheimer's disease (AD) .

HY-W042416

N,N-Dimethylacetamide 1 Publications Verification DMAc	Co-solvents
N,N-Dimethylacetamide (DMAc) is an organic solvent with blood-brain transmissibility and an FDA-approved drug excipient. N, N-dimethylacetamide exerts anti-inflammatory activity by inhibiting the NF-κB signaling pathway. N, N-dimethylacetamide can be used in studies of weight gain caused by a high-fat diet and neuroinflammation in Alzheimer's disease .

HY-D0837R

Imidazole (Standard)

Cell Assay Reagents

Imidazole (Standard) is the analytical standard of Imidazole. This product is intended for research and analytical applications. Imidazole (Glyoxaline; 1,3-Diaza-2,4-cyclopentadiene) is a heterocyclic aromatic compound. Imidazole bearing molecules have been used as corrosion, acetylcholinesterase (AChEI) and xanthine oxidase (XO) inhibitors, performing biological activities such as antifungal, antituberculosis, anti-inflammatory, antioxidant, and analgesic, amongst many others. Imidazole inhibits the enzymatic conversion of the endoperoxides (PGG2 and PGH2) to thromboxane A2 by platelet microsomes. Imidazole derivatives exhibits inhibition on SARS-CoV-2 3CLPro enzyme, which is promising for research in the field of Alzheimer’s disease, gout, COVID-19 and thrombo-embolic disease .

HY-W042416R

N,N-Dimethylacetamide (Standard)

Co-solvents

N,N-Dimethylacetamide (Standard) is the analytical standard of N,N-Dimethylacetamide. This product is intended for research and analytical applications. N,N-Dimethylacetamide (DMAc) is an organic solvent with blood-brain transmissibility and an FDA-approved drug excipient. N, N-dimethylacetamide exerts anti-inflammatory activity by inhibiting the NF-κB signaling pathway. N, N-dimethylacetamide can be used in studies of weight gain caused by a high-fat diet and neuroinflammation in Alzheimer's disease .

Cat. No.	Product Name	Target	Research Area

HY-P99185

Bapineuzumab	Amyloid-β	Neurological Disease
Bapineuzumab is an anti-β-amyloid protein (APP) monoclonal antibody. Bapineuzumab can be used for the research of Alzheimer’s disease (AD) .

HY-P99317

Solanezumab LY-2062430	Amyloid-β	Neurological Disease
Solanezumab is a humanized monoclonal IgG1 antibody directed against the mid-domain of the amyloid-β (Aβ) peptide. Solanezumab has the potential for the research of Alzheimer’s disease .

HY-P99471

Bepranemab UCB 0107	Tau Protein	Neurological Disease
Bepranemab (UCB 0107) is a humanized, full-length IgG4 monoclonal antibody that binds to a central tau epitope (amino acids 235-250). Bepranemab can be used for Alzheimer’s disease (AD) research .

HY-P99648

Gosuranemab BMS-986168; IPN007; BIIB092	Tau Protein	Neurological Disease
Gosuranemab (BMS-986168) is a humanised IgG4 anti-tau monoclonal antibody. Gosuranemab binds to human N-terminal tau residues 15-22. Gosuranemab has the potential for the research of alzheimer’s disease (AD) .

HY-P99164

Zagotenemab LY33003560	Microtubule/Tubulin	Neurological Disease
Zagotenemab (LY3303560) is a humanised anti-tau antibody that selectively binds and neutralises tau deposits in the brain. Zagotenemab can be used in Alzheimer's disease research .

HY-P9967

Aducanumab BIIB037	Amyloid-β	Neurological Disease
Aducanumab (BIIB037) is a human monoclonal antibody that selectively targets aggregated amyloid-beta (Aβ). Aducanumab shows brain penetration, and can be used for Alzheimer's disease (AD) research .

HY-P99835

Crenezumab MABT 5102A; RG 7412	Amyloid-β	Neurological Disease
Crenezumab (MABT 5102A; RG 7412) is a fully humanized anti-Aβ monoclonal antibody that binds multiple forms of Aβ, such as soluble, oligomeric and fibrillar, for use in Alzheimer's disease research .

HY-P991046

Donanemab (Mouse IgG2b)	Amyloid-β	Neurological Disease
Donanemab (Mouse IgG2b) is an anti-amyloid inhibitory antibody with Mouse IgG2b. Donanemab can be used in research about Alzheimer's disease .

HY-P991045

Donanemab (Mouse IgG2a)	Amyloid-β	Neurological Disease
Donanemab (Mouse IgG2a) (mE8-IgG2a) is a mouse-derived IgG2 monoclonal antibody used in the research of Alzheimer's disease.

HY-P99527

Vanutide cridificar ACC-001; PF 05236806	Amyloid-β	Neurological Disease
Vanutide cridificar (ACC-001) is an aminoterminal Aβ1-7 peptide conjugate. Vanutide cridificar can be used for Alzheimer's disease (AD) research .

HY-P99022

Gantenerumab	Amyloid-β	Neurological Disease
Gantenerumab is a fully human anti-amyloid-β (Aβ) IgG1 monoclonal antibody demonstrates sustained cerebral amyloid-β binding. Gantenerumab can be used for Alzheimer's disease research .

HY-P99859

Donanemab LY3002813	Amyloid-β	Neurological Disease
Donanemab (LY3002813) is a humanized IgG1 monoclonal antibody directed at an N-terminal pyroglutamate amyloid beta (Aβ) epitope. Donanemab has the potential for early Alzheimer's disease research .

HY-P99407

Pepinemab 1 Publications Verification VX 15/2503	Inhibitory Antibodies	Neurological Disease Cancer
Pepinemab (VX 15/2503) is a human monoclonal antibody against SEMA4D, a signalling protein 4D (SEMA4D), also known as CD100, which is a regulator of neuronal development and plays a role in a variety of cellular processes. Pepinemab can be used in the study of various neurodegenerative diseases such as Alzheimer's disease by blocking the activity of SEMA4D .

HY-P99216

Ponezumab 1 Publications Verification PF-04360365; RN 1219	EGFR	Neurological Disease
Ponezumab (PF-04360365) is a humanised anti-amyloid IgG2 monoclonal antibody. Ponezumab reduces Aβ levels in the central nervous system and improves performance in mice in various models of learning and memory. Ponezumab can be used in study of Alzheimer's disease .

HY-P99399

Semorinemab RG 6100; RO7105705; MTAU-9937A	Tau Protein	Neurological Disease
Semorinemab (RG 6100) is an anti-Tau humanized IgG4 monoclonal antibody, targets the N-terminal portion of the Tau protein (amino acid residues 6-23). Semorinemab binds with human Tau with a K_d value of 3.8 nM. Semorinemab can be used for the research of Alzheimer's Disease .

HY-P990110

Lecanemab (Mouse IGG2a) Mab158	Amyloid-β	Neurological Disease
Lecanemab (Mouse IGG2a) is a monoclonal antibody that targets soluble β-amyloid and has the potential to reduce cognitive decline. The variable region of Lecanemab (Mouse IGG2a) is consistent with that of Lecanemab, while the constant region is of Mouse IGG2a sequence. Lecanemab (Mouse IGG2a) holds promise for research in the field of Alzheimer's disease .

HY-P990078

Remternetug LY3372993	Amyloid-β	Neurological Disease
Remternetug is a human immunoglobulin G1-kappa, anti-APP (amyloid beta A4 precursor protein) Aβ42 N3pGlu peptide monoclonal antibody. Remternetug recognizes a pyroglutamated form of Aβ. Remternetug results in rapid and robust amyloid plaque reduction. Remternetug can be used for Alzheimer's disease research .

HY-P9999

Trontinemab RG6102; RO-7126209	Amyloid-β	Neurological Disease
Trontinemab (RG6102) is a brain-penetrant, anti-amyloid, bispecific and humanizedized IgG1-κ antibody, targeting to Aβ plaques and transferrin receptor 1 (TFR1). Trontinemab binds to fibrillar Aβ as well as Aβ plaques triggering plaque clearance by engaging immune cells on Alzheimer disease (AD) brain sections. Trontinemab also shows specific affinity to cynomolgus and human TFR1 .

HY-P991073

MEDI-1814	Amyloid-β	Neurological Disease
MEDI-1814 is a fully human IgG1 antibody that targets the C terminus of Aβ42. MEDI-1814 binds to and sweeps away the circulated Aβ peptides, hence, restricting them from aggregating into toxic oligomers. MEDI-1814 can be used for the study of Alzheimer's diseases. The isotype control for MEDI-1814 can refer to Human IgG1 kappa, Isotype Control (HY-P99001) .

HY-P99163

Tilavonemab ABBV-8E12; C2N-8E12	Tau Protein	Neurological Disease
Tilavonemab (ABBV-8E12) is a humanized anti-tau antibody that targets the extracellular form of pathological tau protein aggregates by binding to the N-terminal 25-30 amino acid residues of tau protein. Tilavonemab blocks the ability of human and mouse neurons to take up tau aggregates, reduces the loss of brain volume, slows the progression of tau pathology, and improves cognitive abilities in transgenic mice expressing mutant human tau. Tilavonemab is used in Alzheimer's disease research .

Cat. No.	Product Name	Category	Target	Chemical Structure

HY-Y0399

L-Norvaline Norvaline	Structural Classification Classification of Application Fields Ketones, Aldehydes, Acids Source classification Metabolic Disease Endogenous metabolite Disease Research Fields	Amyloid-β TNF Receptor Arginase
L-Norvaline is the inhibitor for arginase, that promotes the production of NO, reduces oxidative stress, improves insulin resistance, and exhibits antioxidant and anti-hyperglycemic effects. L-Norvaline can be used in research of Alzheimer’s disease .

HY-W015229

3-Indolepropionic acid 2 Publications Verification Indole-3-propionic acid; 3-IPA	Structural Classification Human Gut Microbiota Metabolites Microorganisms Ketones, Aldehydes, Acids Source classification Endogenous metabolite	Endogenous Metabolite Reactive Oxygen Species
3-Indolepropionic acid is shown to be a powerful antioxidant and has potential in the treatment for Alzheimer’s disease.

HY-119398

Lanuginosine	Structural Classification Alkaloids Fissistigma polyanthum (Hook. f. et Thoms.) Merr. Source classification Plants Annonaceae Isoquinoline Alkaloids	Amyloid-β Cholinesterase (ChE)
Lanuginosine (Compound 12) is an AChE inhibitor (IC₅₀: 10.9 μM). Lanuginosine inhibits Aβ aggregation. Lanuginosine can be used for research of Alzheimer’s disease .

HY-130750

Phycocyanobilin	Structural Classification Microorganisms Ketones, Aldehydes, Acids Source classification	Reactive Oxygen Species
Phycocyanobilin, an orally active antioxidative agent, is an effective scavenger for various reactive oxygen species. Phycocyanobilin can be used for the research of Alzheimer’s disease .

HY-N13380

6′‐O‐Galloylsalidroside	Structural Classification Distylium racemosum Siebold & Zucc. Source classification Phenols Polyphenols Hamamelidaceae Plants	Others
6’-O-Galloylsalidroside is an active component of Rhodiola. 6’-O-Galloylsalidroside is promising for research of Alzheimer’s disease, lung diseases, cerebrovascular disease, diabetes, cardiovascular disease and aging-related diseases .

HY-B2065

Scopolamine hydrochloride (-)-Scopolamine hydrochloride; Hyoscine hydrochloride	Alkaloids Structural Classification Other Alkaloids Source classification Atropa belladonna Linn. Solanaceae Plants	mAChR 5-HT Receptor
Scopolamine hydrochloride is a non-selective and high affinity (≤1 nM) muscarinic antagonist that is used for the prevention of post-operative nausea and vomiting. Scopolamine readily passes the blood brain barrier. Scopolamine also reversibly inhibits 5-HT3 receptor-responses with an IC₅₀ of 2.09 μM . Scopolamine induces Alzheimer's disease-like pathology through alteration of cholinergic system .

HY-N8414

Dehydrogeijerin	Structural Classification Natural Products Euryops arabicus Steud. ex Jaub. & Spach Source classification Plants Umbelliferae	Cholinesterase (ChE)
Dehydrogeijerin is an inhibitor of acetylcholinesterase with an IC₅₀ of 9.7 μM. Dehydrogeijerin can be used in study Alzheimer’s disease .

HY-N8755

Chikusetsusaponin Ib	Triterpenes other families Terpenoids Source classification Plants	Cholinesterase (ChE)
Chikusetsusaponin Ib has anti-Alzheimer's disease activity and is a potent AChE inhibitor .

HY-N7954

Neopanaxadiol	Panax ginseng C. A. Meyer Triterpenes Structural Classification Terpenoids Source classification Plants Araliaceae	Others
Neopanaxadiol, an aglycone of protopanaxadiol type ginsenosides, has the potential for Alzheimer's disease research .

HY-W230975

(E/Z)-Piperine (E/Z)-Bioperine; (E/Z)-1-Piperoylpiperidine	Structural Classification Alkaloids Piperidine Alkaloids Source classification Piperaceae Plants Piper nigrum Linn.	Cytochrome P450 P-glycoprotein
(E/Z)-Piperine ((E/Z)-Bioperine) is an alkaloid with a pungent property. (E/Z)-Piperine shows anti-inflammation, immunomodulatory and anti-cancer, antispasmodic and anti-secretory effects. (E/Z)-Piperine demonstrates significant neuroprotective effect in Alzheimer’s disease and Parkinson’s disease .

HY-125125

Danshenxinkun D	Quinones Structural Classification Terpenoids Labiatae Samanea saman (Jacq.) Merr. Source classification Diterpenoids Plants Phenanthrenequinones	Dopamine Receptor
Danshenxinkun D is an anti-Alzheimer's disease (AD) candidate. Danshenxinkun D can significantly reverse the expression of PSEN1 and DRD2 mRNA in H₂O₂ treated PC12 cells. Danshenxinkun D can be used in the study of anti-Alzheimer's disease product candidate [1].

HY-N12075

Dehydrodiscretamine chloride	Structural Classification Alkaloids Piperidine Alkaloids Nandina domestica Thunb. Fissistigma polyanthum (Hook. f. et Thoms.) Merr. Source classification Plants Annonaceae Berberidaceae	Cholinesterase (ChE)
Dehydrodiscretamine chloride is a dual inhibitor of AChE and BChE with IC₅₀s of 17.8 and 118.8 μM, respectively. Dehydrodiscretamine chloride has antioxidant activity. Dehydrodiscretamine chloride can be used in study Alzheimer’s disease .

HY-122957

Huperzine C	Lycopodiaceae Alkaloids Lycopodium serratum Thunb． Source classification Plants	Cholinesterase (ChE)
Huperzine C is an alkaloid isolated from Huperzia serrate. Huperzine C is an acetylcholinesterase (AChE) inhibotor, with an IC₅₀ of 0.6 μM. Huperzine C can be used for the research of Alzheimer’s disease .

HY-P0265

β-Amyloid (1-40)	Structural Classification Natural Products Source classification Endogenous metabolite	Amyloid-β
β-Amyloid (1-40) is a primary protein in plaques found in the brains of patients with Alzheimer's disease.

HY-N5077

Sinapine 2 Publications Verification	Alkaloids Structural Classification Monophenols Neurological Disease Classification of Application Fields Other Alkaloids Cruciferae Source classification Phenols Plants Inflammation/Immunology Disease Research Fields	Cholinesterase (ChE) P-glycoprotein
Sinapine is an alkaloid isolated from seeds of the cruciferous species. Sinapine exhibits anti-inflammatory, anti-oxidant, anti-tumor, anti-angiogenic and radio-protective effects. Sinapine is also an acetylcholinesterase (AChE) inhibitor and can be used for the research of Alzheimer’s disease, ataxia, myasthenia gravis, and Parkinson’s disease .

HY-N8453

Macranthoin G Methyl 3,5-dicaffeoyl quinic acid	Structural Classification Caprifoliaceae Lonicera japonica Thunb. Source classification Phenols Polyphenols Plants	p38 MAPK
Macranthoin G is an inhibitor of p38 MAPK. Macranthoin G protects the cytotoxicity induced by Aβ or hydrogen peroxide in neuronal cells by downregulating p38 MAPK. Macranthoin G can used in study Alzheimer’s Disease .

HY-N5077B

Sinapine hydroxide	Alkaloids Monophenols other families Classification of Application Fields Neurological Disease Source classification Phenols Plants Disease Research Fields Inflammation/Immunology	Cholinesterase (ChE) P-glycoprotein
Sinapine hydroxide is an alkaloid isolated from seeds of the cruciferous species. Sinapine hydroxide exhibits anti-inflammatory, anti-oxidant, anti-tumor, anti-angiogenic and radio-protective effects. Sinapine hydroxide is also an acetylcholinesterase (AChE) inhibitor and can be used for the research of Alzheimer’s disease, ataxia, myasthenia gravis, and Parkinson’s disease .

HY-N0450

Sinapine thiocyanate 2 Publications Verification	Alkaloids Structural Classification Monophenols Classification of Application Fields Other Alkaloids Cruciferae Source classification Phenols Plants Disease Research Fields Cancer	P-glycoprotein Cholinesterase (ChE)
Sinapine thiocyanate is an alkaloid isolated from seeds of the cruciferous species. Sinapine thiocyanate exhibits anti-inflammatory, anti-oxidant, anti-tumor, anti-angiogenic and radio-protective effects. Sinapine thiocyanate is also an acetylcholinesterase (AChE) inhibitor and can be used for the research of Alzheimer’s disease, ataxia, myasthenia gravis, and Parkinson’s disease .

HY-N2971

Buxbodine B	Structural Classification Alkaloids Buxaceae Other Alkaloids Source classification Buxus macowanii Oliv. Plants	Cholinesterase (ChE)
Buxbodine B is an inhibitor for acetylcholinesterase (AChE) with an IC₅₀ of 50 μM. Buxbodine B can be used in research of Alzheimer's disease .

HY-N9861

Kayaflavone	Ranunculus ternatus Thunb. Structural Classification Flavonoids Flavones Ranunculaceae Source classification Plants	Amyloid-β
Kayaflavone is an amentoflavone type biflavonoid. Kayaflavone has an inhibitory activity against amyloid-β42 cytotoxicity in PC-12 cells with an EC₅₀ value of 5.29 μΜ. Kayaflavone is promising for research of Alzheimer’s disease .

HY-113303

FAPy-adenine	Ketones, Aldehydes, Acids Source classification Endogenous metabolite	Endogenous Metabolite
FAPy-adenine is an oxidized DNA base. Fapy-adenine shows an increased trend levels in the Alzheimer's disease brain. Oxidized nucleosides are biochemical markers for tumors, aging, and neurodegenerative diseases .

HY-N0690

Schisandrin C 4 Publications Verification Schizandrin-C; Wuweizisu-C	Structural Classification Classification of Application Fields Source classification Lignans Phenylpropanoids Plants Schisandraceae Schisandra chinensis (Turcz.) Baill. Disease Research Fields Cancer	Apoptosis Virus Protease Molecular Glues
Schisandrin C (Schizandrin-C) is a phytochemical lignan isolated from Schizandra chinensis . Schisandrin C has diverse biological activities, including anticancer, anti-inflammatory?and antioxidant effects. Schisandrin C is a molecular glue. Schisandrin C can be used for cancer, alzheimer’s disease, and liver diseases?research . Schisandrin C induces cell apoptosis .

HY-N7046

Silybin B Silibinin B	Flavanonols Structural Classification Flavonoids Glycine soya Source classification Phenols Polyphenols Cyamopsis tetragonoloba (L.) Taub. Plants Compositae	Amyloid-β
Silybin B (Silibinin B), a flavonolignan separated from Silybum marianum, has anti-tumor activity. Silybin B is the most potent antifibrillogenic and anti-oligomeric component of silymarin and proposes it as a promising anti Alzheimer’s disease agent candidate .

HY-N6906

Oleuroside 1 Publications Verification	Structural Classification Iridoids Canarium album (Lour.) Rauesch. Terpenoids Source classification Phenols Polyphenols Plants Burseraceae	Others
Oleuroside is a phenolic secoiridoid in olive. Oleuroside can protect against mitochondrial dysfunction in models of early Alzheimer's disease and brain ageing .

HY-N7751

Isotanshinone II	Structural Classification Eupatorium buniifolium Hook. & Arn. Terpenoids Labiatae Source classification Diterpenoids Plants	Others
Isotanshinone II is a natural product that can be isolated from Salvia glutinos. Isotanshinone II can be used to study Alzheimer's disease .

HY-17387

(-)-Huperzine A 5 Publications Verification Huperzine A	Structural Classification Alkaloids Neurological Disease Classification of Application Fields Anti-aging Terpenoids Huperziaceae Sesquiterpenes Pyridine Alkaloids Huperzia serrata Plants Disease Research Fields	Cholinesterase (ChE) Apoptosis iGluR
(-)-Huperzine A (Huperzine A) is an alkaloid isolated from Huperzia serrata, with neuroprotective activity. (-)-Huperzine A is a potent, highly specific, reversible and blood-brain barrier penetrant inhibitor of acetylcholinesterase (AChE), with an IC₅₀ of 82 nM. (-)-Huperzine A also is non-competitive antagonist of N-methyl-D-aspartate glutamate (NMDA) receptor. (-)-Huperzine A is developed for the research of neurodegenerative diseases, including Alzheimer’s disease .

HY-N12581

Kuwanon U	Structural Classification Flavonoids Flavonones Source classification Morus alba L. Plants Moraceae	Cholinesterase (ChE)
Kuwanon U is a potent cholinesterase inhibitor with IC₅₀s of 19.69, 10.11 µM and K_is of 6.48, 9.59 µM for acetylcholinesterase (AChE) and butyrylcholinesterase (BChE), respectively. Kuwanon U has the potential for the research of Alzheimer’s disease (AD) .

HY-W742564

Acacetin-7-O-β-D-galactopyranoside	Structural Classification Flavonoids Flavones Source classification Dendranthema morifolium (Ramat.) Tzvel. Plants Compositae	Cholinesterase (ChE)
Acacetin-7-O-β-D-galactopyranoside is a flavonoid that can be isolated from flower heads of Chrysanthemum morifolium. Acacetin-7-O-β-D-galactopyranoside inhibits AChE activity and can be used for research of Alzheimer’s disease .

HY-B0193

Prazosin 10+ Cited Publications	Classification of Application Fields Disease Research Fields Endocrinology	Adrenergic Receptor
Prazosin is an α-adrenergic receptor antagonist. Prazosin can reduce inflammation, relieve anxiety, alleviate panic, prevent memory decline, and modulate the pain-relieving effects of opioids. Prazosin can be used in the study of hypertension and Alzheimer’s disease .

HY-N12027

AChE/BChE-IN-14	Structural Classification Alkaloids Fissistigma polyanthum (Hook. f. et Thoms.) Merr. Source classification Plants Annonaceae Isoquinoline Alkaloids	Cholinesterase (ChE)
AChE/BChE-IN-14 (compound 13) is a benzylisoquinoline alkaloid isolated from the roots of Fissistigma polyanthum. AChE/BChE-IN-14 exhibits AChE and BChE inhibitions with antioxidant activities. AChE/BChE-IN-14 can be used for Alzheimer’s disease research .

HY-N0785

Ginkgolide C 1 Publications Verification BN-52022	Structural Classification Ginkgoaceae Terpenoids Source classification Diterpenoids Plants Endogenous metabolite Ginkgo biloba	AMPK Sirtuin MMP Endogenous Metabolite
Ginkgolide C is a flavone isolated from Ginkgo biloba leaves, possessing multiple biological functions, such as decreasing platelet aggregation and ameliorating Alzheimer disease.

HY-N2898

Artanin	Source classification Rutaceae Zanthoxylum nitidum (Roxb.) DC. Coumarins Phenylpropanoids Plants	Cholinesterase (ChE)
Artanin is a coumarin, has biological activities related to Alzheimer’s disease. Artanin exerts function including AChE inhibitory and AChE- and self-induced amyloid beta (Aβ) aggregation inhibitory activities, with IC₅₀s of 51 μM, 98 μM, and 124 μM, respectively .

HY-N8260

Angeloylgomisin Q	Structural Classification Source classification Lignans Phenylpropanoids Plants Schisandraceae Schisandra chinensis (Turcz.) Baill.	Others
Angeloylgomisin Q is a new dibenzocyclooctadiene lignan from the stems of Schisandra sphaerandra . Angeloylgomisin Q has the potential for alzheimer's disease research .

HY-N3963

Gomisin M2 (+)-Gomisin M2	Classification of Application Fields Neurological Disease Source classification Lignans Plants Infection Monophenols Phenols Phenylpropanoids Schisandraceae Disease Research Fields Inflammation/Immunology Schisandra chinensis (Turcz.) Baill.	HIV
Gomisin M2 ((+)-Gomisin M2) is a lignan isolated from the fruits of Schisandra rubriflora with anti-HIV activity (EC₅₀ of 2.4 μM). Gomisin M2 exhibits anti-cancer and anti-allergic activities and has the potential for Alzheimer’s disease research .

HY-N11641

Methyl ganoderate A acetonide	Triterpenes Structural Classification Microorganisms Terpenoids Source classification	Cholinesterase (ChE)
Methyl ganoderate A acetonide, a lanostane triterpene, is a natural product that could be isolated from the fruiting bodies of Ganoderma lucidum. Methyl ganoderate A acetonide is a potent AChE inhibitor with an IC₅₀ value of 18.35 μM. Methyl ganoderate A acetonide can be used in research of Alzheimer’s disease (AD) .

HY-113262

8-Hydroxyguanosine	Alkaloids Structural Classification Other Alkaloids Source classification Disease markers Nervous System Disorder Endogenous metabolite	Endogenous Metabolite Interleukin Related
8-Hydroxyguanosine, an oxidized nucleoside, is a marker of RNA oxidative damage and oxidative stress. 8-Hydroxyguanosine stimulates proliferation and differentiation of murine B cells with immunostimulatory activity. 8-Hydroxyguanosine is promising for research of Alzheimer’s disease and Down’s syndrome .

HY-N2807

Acanthoside B	Monophenols Cistanche salsa (C. A. Mey.) G. Beck Source classification Lignans Phenols Orobanchaceae Phenylpropanoids Plants	Others
Acanthoside B is a potential bioactive lignan with anti-inflammatory and anti-amnesic activities. Acanthoside B can be used for alzheimer's disease and lung inflammation research

HY-B1328

Pyridoxine 5+ Cited Publications Pyridoxol	Structural Classification Natural Products Microorganisms Source classification Disease markers Nervous System Disorder Endogenous metabolite Cardiovascular System Disorder	Endogenous Metabolite Keap1-Nrf2
Pyridoxine (Pyridoxol) is a pyridine derivative. Pyridoxine exerts antioxidant effects in cell model of Alzheimer's disease via the Nrf-2/HO-1 pathway.

HY-N4005

Isoastilbin	Flavanonols Flavonoids other families Source classification Phenols Polyphenols Plants	Bacterial Tyrosinase
Isoastilbin is a dihydroflavonol glycoside compound in Rhizoma Smilacis glabrae and Astragalus membranaceus. Isoastilbin inhibits glucosyltransferase (GTase) with an IC₅₀ value of 54.3 μg/mL, and also inhibits tyrosinase activity. Isoastilbin shows neuroprotective, antioxidation, antimicrobial and anti-apoptotic properties and has the potential for Alzheimer’s disease research .

HY-N8960

1-Hydroxybisabola-2,10-dien-4-one	Structural Classification Natural Products Terpenoids Sesquiterpenes Source classification Piperaceae Plants Piper retrofractum Vahl	Others
1-Hydroxybisabola-2,10-dien-4-one is a compound with potential anti-Alzheimer's disease activity. The activity of 1-Hydroxybisabola-2,10-dien-4-one was evaluated in the Caenorhabditis elegans Alzheimer's disease pathological model. 1-Hydroxybisabola-2,10-dien-4-one has a wide range of applications in life science related research .

HY-N0450R

Sinapine (thiocyanate) (Standard)	Alkaloids Structural Classification Monophenols Other Alkaloids Cruciferae Source classification Phenols Plants	P-glycoprotein Cholinesterase (ChE)
Sinapine (thiocyanate) (Standard) is the analytical standard of Sinapine (thiocyanate). This product is intended for research and analytical applications. Sinapine thiocyanate is an alkaloid isolated from seeds of the cruciferous species. Sinapine thiocyanate exhibits anti-inflammatory, anti-oxidant, anti-tumor, anti-angiogenic and radio-protective effects. Sinapine thiocyanate is also an acetylcholinesterase (AChE) inhibitor and can be used for the research of Alzheimer’s disease, ataxia, myasthenia gravis, and Parkinson’s disease .

HY-N0690R

Schisandrin C (Standard)	Structural Classification Source classification Lignans Phenylpropanoids Plants Schisandraceae Schisandra chinensis (Turcz.) Baill.	Apoptosis Virus Protease
Schisandrin C (Standard) is the analytical standard of Schisandrin C. This product is intended for research and analytical applications. Schisandrin C (Schizandrin-C) is a phytochemical lignan isolated from Schizandra chinensis . Schisandrin C has diverse biological activities, including anticancer, anti-inflammatory and antioxidant effects. Schisandrin C is a molecular glue. Schisandrin C can be used for cancer, alzheimer’s disease, and liver diseases research . Schisandrin C induces cell apoptosis .

HY-B1804

Tricaprilin Trioctanoin; Glyceryl trioctanoate	Structural Classification Natural Products Neurological Disease Classification of Application Fields Source classification Endogenous metabolite Disease Research Fields	Endogenous Metabolite
Tricaprilin (Trioctanoin) is an orally active and well tolerated ketogenic agent that safely induces ketosis. Tricaprilin restores brain electrical activity and metabolism to help counteract neuroinflammation in migraine. Tricaprilin is promising for research of migraine prevention and Alzheimer’s disease (AD). Tricaprilin is a pure C8 medium chain triglyceride (MCT) .

HY-N12423

Bis-(-)-8-demethylmaritidine	Crinum asiaticum L. Structural Classification Alkaloids Other Alkaloids Source classification Plants Amaryllidaceae	Cholinesterase (ChE)
Bis-(-)-8-demethylmaritidine, a natural alkaloid, is a potent acetylcholinesterase (AChE) inhibitor. Bis-(-)-8-demethylmaritidine can be used for Alzheimer's disease research .

HY-W040141

L-Arabinitol	Structural Classification Human Gut Microbiota Metabolites Microorganisms Classification of Application Fields Source classification Disease markers Endocrine diseases Metabolic Disease Endogenous metabolite Disease Research Fields Saccharides	Endogenous Metabolite
L-Arabinitol is a potential biomarker for the comsuption of the food products such as sweet potato, deerberry, moth bean, and is also associated with Alzheimer's disease and ribose-5-phosphate isomerase deficiency.

HY-W015229R

3-Indolepropionic acid (Standard)	Structural Classification Human Gut Microbiota Metabolites Microorganisms Ketones, Aldehydes, Acids Source classification Endogenous metabolite	Endogenous Metabolite Reactive Oxygen Species
3-Indolepropionic acid (Standard) is the analytical standard of 3-Indolepropionic acid. This product is intended for research and analytical applications. 3-Indolepropionic acid is shown to be a powerful antioxidant and has potential in the treatment for Alzheimer’s disease. In Vitro: 3-Indolepropionic acid is shown to be a powerful antioxidant and has potential in the treatment for Alzheimer’s disease . 3-Indolepropionic acid is a more potent scavenger of hydroxyl radicals than melatonin. Similar to melatonin but unlike other antioxidants, 3-Indolepropionic acid scavenges radicals without subsequently generating reactive and pro-oxidant intermediate compounds . It is also suggested that indolepropionic acid, a gut microbiota-produced metabolite, is a potential biomarker for the development of type 2 diabetes (T2D) that may mediate its protective effect by preservation of β-cell function .

HY-N2195

Nootkatone 3 Publications Verification (+)-Nootkatone	Structural Classification Terpenoids Sesquiterpenes Source classification Vitis vinifera cv. Zalema Plants Vitaceae	Others
Nootkatone, a neuroprotective agent from Vitis vinifera, has antioxidant and anti-inflammatory effects . Nootkatone improves cognitive impairment in lipopolysaccharide-induced mouse model of Alzheimer's disease .

HY-N8728

Aposcopolamine 1 Publications Verification	Structural Classification Alkaloids Other Alkaloids Source classification Solanaceae Plants Duboisia leichhardtii (F.Muell.) F.Muell.	Cholinesterase (ChE) Adrenergic Receptor
Aposcopolamine is an alkaloid that can be isolated from Datura ferox. Aposcopolamin can closely binds with ACHE, ADRA2A and CHRM2. Aposcopolamine can be used for the research of Alzheimer's disease .

HY-N7480A

Quinolactacin A1	Alkaloids Microorganisms Pyrrole Alkaloids Classification of Application Fields Neurological Disease Source classification Quinoline Alkaloids Disease Research Fields	Cholinesterase (ChE)
Quinolactacin A1 is a potent acetylcholinesterase (AChE) inhibitor from solid state fermentation of Penicillium citrinum 90648. Quinolactacin A1 can be used for the research of Alzheimer disease .

HY-N10701

AChE/BChE-IN-11	Structural Classification Oleaceae Syringa oblata Lindl. Source classification Plants Saccharides Monosaccharides	Cholinesterase (ChE)
AChE/BChE-IN-11 (compound 1) is a potent is a dual AChE and BChE inhibitor with IC₅₀ values of 70 and 71 μM for AChE and BChE, respectively. AChE/BChE-IN-11 is a natural product that could be isolated from the leaf of artichoke . AChE/BChE-IN-11 can be used in research of Alzheimer’s disease (AD) research .

Cat. No.	Product Name	Chemical Structure

HY-W015229S

3-Indolepropionic acid-d2
3-Indolepropionic acid-d₂ is the deuterium labeled 3-Indolepropionic acid. 3-Indolepropionic acid is shown to be a powerful antioxidant and has potential in the treatment for Alzheimer’s disease.

HY-P0265AS

β-Amyloid-15N (1-40) TFA
β-Amyloid- ¹⁵N (1-40) (TFA) is the ¹⁵N-labledβ-Amyloid (1-40) (TFA). β-Amyloid (1-40) is a primary protein in plaques found in the brains of patients with Alzheimer's disease[1].

HY-17387S1

(-)-Huperzine A-d4 hydrochloride

(-)-Huperzine A-d₄ hydrochloride is deuterated labeled (-)-Huperzine A (HY-17387). (-)-Huperzine A (Huperzine A) is an alkaloid isolated from Huperzia serrata, with neuroprotective activity. (-)-Huperzine A is a potent, highly specific, reversible and blood-brain barrier penetrant inhibitor of acetylcholinesterase (AChE), with an IC₅₀ of 82 nM. (-)-Huperzine A also is non-competitive antagonist of N-methyl-D-aspartate glutamate (NMDA) receptor. (-)-Huperzine A is developed for the research of neurodegenerative diseases, including Alzheimer’s disease .

HY-B1328S1

Pyridoxine-d3
Pyridoxine-d3 is a deuterium labeled Pyridoxine. Pyridoxine (Pyridoxol) is a pyridine derivative. Pyridoxine exerts antioxidant effects in cell model of Alzheimer's disease via the Nrf-2/HO-1 pathway .

HY-B0591S

Memantine-d3 hydrochloride
Memantine-d₃ (hydrochloride) is deuterium labeled Memantine. Memantine is an orally active, noncompetitive N-methyl-D-aspartate receptor (NMDAR) antagonist. Memantine can be used for the research of moderate-to-severe Alzheimer's disease (AD)[1][2][3].

HY-N0682S1

Pyridoxine-d2 hydrochloride
Pyridoxine-d₂ (hydrochloride) is the deuterium labeled Pyridoxine hydrochloride. Pyridoxine hydrochloride is a pyridine derivative. Pyridoxine (Pyridoxol; Vitamin B6) exerts antioxidant effects in cell model of Alzheimer's disease via the Nrf-2/HO-1 pathway.

HY-B0702S

Nicergoline-13C,d3
Nicergoline- ¹³C,d₃ is the ¹³C- and deuterium labeled Nicergoline. Nicergoline, an ergoline derivative ester of bromonicotinic acid, is a potent, selective and orally active antagonist of α1A-adrenoceptor. Nicergoline has vasodilator effects. Nicergoline also has ameliorative effects on cognitive function in mouse models of Alzheimer's disease[1][2].

HY-P1363S

β-Amyloid-15N (1-42), human TFA
β-Amyloid- ¹⁵N (1-42), human (TFA) is the ¹⁵N-labledβ-Amyloid (1-42) (TFA). β-Amyloid (1-42), human TFA (Amyloid β-Peptide (1-42) (human) TFA) is a 42-amino acid peptide which plays a key role in the pathogenesis of Alzheimer disease[1].

HY-B1804S1

Tricaprilin-d50
Tricaprilin-d₅₀ (Trioctanoin-d_{50Alzheimer’s disease (AD). Tricaprilin is a pure C8 medium chain triglyceride (MCT) .}

HY-B1804S2

Tricaprilin-d15
Tricaprilin-d₁₅ (Trioctanoin-d_{15Alzheimer’s disease (AD). Tricaprilin is a pure C8 medium chain triglyceride (MCT) .}

HY-B1804S

Tricaprilin-13C3

Tricaprilin- ¹³C₃ (Trioctanoin- ¹³C₃) is a ¹³C-labeled Tricaprilin (HY-B1804) . Tricaprilin is an orally active and well tolerated ketogenic agent that safely induces ketosis. Tricaprilin restores brain electrical activity and metabolism to help counteract neuroinflammation in migraine. Tricaprilin is promising for research of migraine prevention and Alzheimer’s disease (AD). Tricaprilin is a pure C8 medium chain triglyceride (MCT) .

HY-10933S

CX516-d10
CX516-d₁₀ is the deuterium labeled CX516. CX516 (BDP 12) is an ampakine and acts as an AMPA receptor positive allosteric modulator for the research of Alzheimer's disease, schizophrenia and mild cognitive impairment (MCI)[1].

HY-N0682S

Pyridoxine-d3 hydrochloride
Pyridoxine-d₃ (hydrochloride) is the deuterium labeled Pyridoxine hydrochloride. Pyridoxine hydrochloride (Pyridoxol; Vitamin B6) is a pyridine derivative. Pyridoxine (Pyridoxol; Vitamin B6) exerts antioxidant effects in cell model of Alzheimer's disease via the Nrf-2/HO-1 pathway.

HY-B1328S

Pyridoxine-d5
Pyridoxine-d₅ (Pyridoxol-d₅) is a deuterium labeled Pyridoxine (HY-B1328). Pyridoxine (Pyridoxol) is a pyridine derivative. Pyridoxine exerts antioxidant effects in cell model of Alzheimer's disease via the Nrf-2/HO-1 pathway.

HY-B1028S

Pantethine-15N2

Pantethine- ¹⁵N₂ is the ¹⁵N₂ labeled Pantethine. Pantethine is an orally active lipid-lowering agent. Pantethine has anti-tumor, anti-inflammatory and anti-SARS-COV virus activities. Pantethine is also a neuroprotective agent. Pantethine can be used in the study of Alzheimer's disease, Parkinson's disease, major depression, systemic sclerosis and pantothenate kinase-related neurodegeneration .

HY-N0682S3

Pyridoxine-13C4 hydrochloride
Pyridoxine- ¹³C₄ (hydrochloride) is the ¹³C-labeled Pyridoxine (hydrochloride). Pyridoxine hydrochloride (Pyridoxol; Vitamin B6) is a pyridine derivative. Pyridoxine (Pyridoxol; Vitamin B6) exerts antioxidant effects in cell model of Alzheimer's disease via the Nrf-2/HO-1 pathway.

HY-10863S

Anandamide-d8

Anandamide-d8 is a deuterated labeled Anandamide . Anandamide is an endocannabinoid. Anandamide modulates both neuronal and immune functions through two protein-coupled cannabinoid receptors (CB1 and CB2). Anandamide can activate numerous other receptors like PPARS, TRPV1, and GPR18/GPR55. Anandamide also has potential anti-fungal and anti-inflammatory activities. Anandamide can be used for the research of Alzheimer’s disease (AD) and ulcerative colitis .

HY-W699983

Imidazole-15N2

Imidazole- ¹⁵N₂ (Glyoxaline- ¹⁵N₂) is ¹⁵N labeled Imidazole. Imidazole (Glyoxaline; 1,3-Diaza-2,4-cyclopentadiene) is a heterocyclic aromatic compound. Imidazole bearing molecules have been used as corrosion, acetylcholinesterase (AChEI) and xanthine oxidase (XO) inhibitors, performing biological activities such as antifungal, antituberculosis, anti-inflammatory, antioxidant, and analgesic, amongst many others. Imidazole inhibits the enzymatic conversion of the endoperoxides (PGG₂ and PGH₂) to thromboxane A2 by platelet microsomes. Imidazole derivatives exhibits inhibition on SARS-CoV-2 3CL ^Pro enzyme, which is promising for research in the field of Alzheimer’s disease, gout, COVID-19 and thrombo-embolic disease .

HY-17368S1

(Rac)-Rivastigmine-d6

(Rac)-Rivastigmine-d₆ is a labelled racemic Rivastigmine. Rivastigmine (ENA 713 free base) is an orally active and potent cholinesterase (ChE) inhibitor and inhibits butyrylcholinesterase (BChE) and acetylcholinesteras (AChE) with IC50s of 0.037 μM , 4.15 μM, respectively. Rivastigmine can pass the blood brain barrier (BBB). Rivastigmine is a parasympathomimetic or cholinergic agent used for the research of mild to moderate dementia of the Alzheimer's type and dementia due to Parkinson's disease[1][2].

HY-N0682S2

Pyridoxine-d5 hydrochloride
Pyridoxine-d₅ (hydrochloride) is the deuterium labeled Pyridoxine hydrochloride[1]. Pyridoxine hydrochloride (Pyridoxol;Vitamin B6) is a pyridine derivative. Pyridoxine (Pyridoxol;Vitamin B6) exerts antioxidant effects in cell model of Alzheimer's disease via the Nrf-2/HO-1 pathway[2].

HY-165677S

C22 Galactosylceramide-d4
C22 Galactosylceramide-d₄ is deuterium labeled C22 Galactosylceramide. C22 Galactosylceramide is a sphingolipid present in the central nervous system, exhibiting elevated levels in the spinal cord of mice on a methionine-restricted diet, while not affecting the brain or liver; furthermore, it has been identified in the postmortem hippocampus of Alzheimer's disease patients .

HY-N6608S

Physostigmine-d3

Physostigmine-d₃ is the deuterium labeled Physostigmine. Physostigmine (Eserine) is a reversible acetylcholinesterase (AChE) inhibitor. Physostigmine can crosses the blood-brain barrier and stimulates central cholinergic neurotransmission. Physostigmine can reverse memory deficits in transgenic mice with Alzheimer's disease. Physostigmine is also an antidote for anticholinergic poisoning[1][2][3][4].

HY-113354S

Anserine-d4

Anserine-d₄ is the deuterium labeled Anserine. Anserine, a methylated form of Carnosine, is an orally active, natural Histidine-containing dipeptide found in skeletal muscle of vertebrates. Anserine is not cleaved by serum carnosinase and act as biochemical buffers, chelators, antioxidants, and anti-glycation agents. Anserine improves memory functions in Alzheimer's disease (AD)-model mice[1][2].

HY-F0004S

β-Nicotinamide mononucleotide-d4

β-Nicotinamide mononucleotide-d₄ is the deuterium labeled β-Nicotinamide mononucleotide. β-nicotinamide mononucleotide (β-NM) is a product of the nicotinamide phosphoribosyltransferase (NAMPT) reaction and a key NAD+ intermediate. The pharmacological activities of β-nicotinamide mononucleotide include its role in cellular biochemical functions, cardioprotection, diabetes, Alzheimer's disease, and complications associated with obesity[1].

HY-113354S1

Anserine-d4 hydrochloride

Anserine-d₄ hydrochloride is the deuterium labeled Anserine (HY-113354). Anserine, a methylated form of Carnosine, is an orally active, natural Histidine-containing dipeptide found in skeletal muscle of vertebrates. Anserine is not cleaved by serum carnosinase and act as biochemical buffers, chelators, antioxidants, and anti-glycation agents. Anserine improves memory functions in Alzheimer's disease (AD)-model mice .

HY-W654336

(S)-Rivastigmine-d4

(S)-Rivastigmine-d₄ is deuterium labeled Rivastigmine. Rivastigmine (ENA 713 free base) is an orally active and potent cholinesterase (ChE) inhibitor and inhibits butyrylcholinesterase (BChE) and acetylcholinesteras (AChE) with IC₅₀s of 0.037 μM , 4.15 μM, respectively. Rivastigmine can pass the blood brain barrier (BBB). Rivastigmine is a parasympathomimetic or cholinergic agent used for the research of mild to moderate dementia of the Alzheimer's type and dementia due to Parkinson's disease .

HY-17552S

sn-Glycero-3-phosphocholine-d9

sn-Glycero-3-phosphocholine-d₉ is the deuterium labeled sn-Glycero-3-phosphocholine. sn-Glycero-3-phosphocholine (Choline Alfoscerate) is a precursor in the biosynthesis of brain phospholipids and increases the bioavailability of choline in nervous tissue. sn-Glycero-3-phosphocholine (Choline Alfoscerate) has significant effects on cognitive function with a good safety profile and tolerability, and is effective in the treatment of Alzheimer's disease and dementia[1][2].

HY-17368S2

Rivastigmine-d3 hydrochloride

Rivastigmine-d₃ hydrochloride is deuterated labeled Rivastigmine (HY-17368). Rivastigmine (ENA 713 free base) is an orally active and potent cholinesterase (ChE) inhibitor and inhibits butyrylcholinesterase (BChE) and acetylcholinesteras (AChE) with IC₅₀s of 0.037 μM , 4.15 μM, respectively. Rivastigmine can pass the blood brain barrier (BBB). Rivastigmine is a parasympathomimetic or cholinergic agent used for the research of mild to moderate dementia of the Alzheimer's type and dementia due to Parkinson's disease .

HY-A0009S

Galanthamine-d3 hydrobromide

Galanthamine-d₃ (hydrobromide) is deuterium labeled Galanthamine (hydrobromide). Galanthamine hydrobromide (Galantamine hydrobromide) is a selective, reversible, competitive, alkaloid AChE inhibitor, with an IC50 of 0.35 µM. Galanthamine hydrobromide is a potent allosteric potentiating ligand (APL) of human α3β4, α4β2, α6β4 nicotinic receptors ( nAChRs). Galanthamine hydrobromide is developed for the research of Alzheimer's disease (AD)[1][2][3].

HY-W654335

Rivastigmine-d4 tartrate

Rivastigmine-d₄ (tartrate) is deuterium labeled Rivastigmine (tartrate). Rivastigmine tartrate (ENA 713; SDZ-ENA 713) is an orally active and potent cholinesterase (ChE) inhibitor and inhibits butyrylcholinesterase (BChE) and acetylcholinesteras (AChE) with IC₅₀s of 0.037 μM, 4.15 μM, respectively. Rivastigmine tartrate can pass the blood brain barrier (BBB). Rivastigmine tartrate is a parasympathomimetic or cholinergic agent used for the research of mild to moderate dementia of the Alzheimer's type and dementia due to Parkinson's disease .

HY-113050SA

2,3-Diphosphoglyceric acid-d3 ammonium

2,3-Diphosphoglyceric acid-d3 ammonium (2,3-DPG-d3 ammonium) is the deuterium labeled 2,3-Diphosphoglyceric acid (HY-113050). 2,3-Diphosphoglyceric acid (2,3-DPG) is an intermediate of the glycolytic pathway. 2,3-Diphosphoglyceric acid stabilizes the deoxygenated form of hemoglobin by allosteric binding and facilitates oxygen release at tissue sites. 2, 3-diphosphoglyceric acid has antiparasitic activity. 2,3-Diphosphoglyceric acid can be used in the study of Alzheimer's disease (AD) .

Cat. No.	Product Name		Classification

HY-16361A

Omigapil maleate CGP3466B; CGP3446 maleate; TCH346 maleate		Alkynes
Omigapil maleate, an orally bioavailable GAPDH nitrosylation inhibitor, abrogates Aβ_1-42-induced tau acetylation, memory impairment, and locomotor dysfunction in mice. Omigapil maleate has the potential for the research of Alzheimer's disease . Omigapil maleate (CGP3446B maleate) is a apoptosis inhibitor. Omigapil maleate can be used for the research of congenital muscular dystrophy (CMD) . Omigapil (maleate) is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.

HY-10399A

Ladostigil hydrochloride TV-3326 hydrochloride		Alkynes
Ladostigil (TV-3326) hydrochloride is an orally active dual inhibitor of cholinesterase and brain-selective monoamine oxidase (MAO), with IC₅₀s of 37.1 and 31.8 μM for MAO-B and AChE, respectively. Ladostigil hydrochloride exhibits neuroprotective, antioxidant and anti-inflammatory activities. Ladostigil can be used for the research of depression and Alzheimer's disease . Ladostigil (hydrochloride) is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.

HY-10400

Ladostigil hemitartrate TV-3326 hemitartrate		Alkynes
Ladostigil (TV-3326) hemitartrate is an orally active dual inhibitor of cholinesterase and brain-selective monoamine oxidase (MAO), with IC₅₀s of 37.1 and 31.8 μM for MAO-B and AChE, respectively. Ladostigil hemitartrate exhibits neuroprotective, antioxidant and anti-inflammatory activities. Ladostigil hemitartrate can be used for the research of depression and Alzheimer's disease . Ladostigil (hemitartrate) is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.

HY-169157

HDAC6-IN-50		Alkynes
HDAC6-IN-50 (Compound 4) is a potent HDAC6 inhibitor with an IC₅₀ of 35 nM. HDAC6-IN-50 can be used for the study of Parkinson's disease (PD) and Alzheimer's disease (AD) research .

HY-159133

BuChE-IN-13		Azide
BuChE-IN-13 (compound 3) is a BuChE inhibitor and shows anti-Alzheimer activity. BuChE-IN-13 can be used for study of neurodegenerative disease .

HY-146691

hMAO-B-IN-2		Alkynes
hMAO-B-IN-2 (compound 6j) is an orally active, potent, selective and BBB penetrated and competitive reversible hMAO-B inhibitor, with an IC₅₀ of 4 nM. hMAO-B-IN-2 shows low toxicity and good neuroprotective effects in SH-SY5Y cell. hMAO-B-IN-2 can be used for alzheimer’s disease research . hMAO-B-IN-2 is a click chemistry reagent, itcontains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.

HY-10399

Ladostigil TV-3326		Alkynes
Ladostigil (TV-3326) is an orally active dual inhibitor of cholinesterase and brain-selective monoamine oxidase (MAO), with IC₅₀s of 37.1 and 31.8 μM for MAO-B and AChE, respectively. Ladostigil exhibits neuroprotective, antioxidant and anti-inflammatory activities. Ladostigil can be used for the research of depression and Alzheimer's disease . Ladostigil is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.

Cat. No.	Product Name		Classification

HY-132582A

Tau ASO-12 (murine) (sodium)		Antisense Oligonucleotides
Tau ^ASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (Tau ^ASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )

HY-113289

Brassicasterol		Cholesterol
Brassicasterol is a metabolite of Ergosterol and has cardiovascular protective effects. Brassicasterol exerts anticancer effects in prostate cancer through dual targeting of AKT and androgen receptor signaling pathways. Brassicasterol inhibits HSV-1 (IC₅₀=1.2 μM) and Mycobacterium tuberculosis. Brassicasterol also inhibits sterol δ 24-reductase, slowing the progression of atherosclerosis. Brassicasterol is also a cerebrospinal fluid biomarker for Alzheimer's disease .

HY-132582

IONIS-MAPTRx BIIB080; ISIS 814907		Antisense Oligonucleotides
IONIS-MAPTRx (BIIB080) is the first Tau-lowering antisense oligonucleotide (ASO). IONIS-MAPTRx has the potential for the research of Alzheimer Disease .

HY-147321

3'-DMTr-dG(iBu)		Nucleosides and their Analogs
3'-DMTr-dG(iBu) is a nucleoside for the synthesis of nucleic acid, such as antiviral agents used in the research of viral infection (HBV, HDV), and oligonucleotides against Alzheimer’s disease and other tauopathies .

Inquiry Online

Your information is safe with us. * Required Fields.

MCE Japan Authorized Agent ナミキ商事株式会社コスモ・バイオ株式会社
Salutation			Country or Region *
Applicant Name *			Organization Name *
Department *
Email Address *			Product Name *
Cat. No.			Requested quantity *
Phone Number *
Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent:

Alzheimers diseases

Inhibitors & Agonists

Screening Libraries

Fluorescent Dye

Biochemical Assay Reagents

Peptides

Inhibitory Antibodies

NaturalProducts

Isotope-Labeled Compounds

Click Chemistry

Oligonucleotides

Natural
Products